ID: 1096308354

View in Genome Browser
Species Human (GRCh38)
Location 12:50498719-50498741
Sequence GGGTGTTCCACCTTCCGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308348_1096308354 -5 Left 1096308348 12:50498701-50498723 CCTTGCCCTCATTCCCATGGGTG No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308344_1096308354 14 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308345_1096308354 4 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308343_1096308354 15 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data
1096308349_1096308354 -10 Left 1096308349 12:50498706-50498728 CCCTCATTCCCATGGGTGTTCCA No data
Right 1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308354 Original CRISPR GGGTGTTCCACCTTCCGGCA TGG Intergenic
No off target data available for this crispr