ID: 1096308357

View in Genome Browser
Species Human (GRCh38)
Location 12:50498727-50498749
Sequence CACCTTCCGGCATGGGCGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096308344_1096308357 22 Left 1096308344 12:50498682-50498704 CCTGCATGGGCCAGGTGTTCCTT No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308351_1096308357 -10 Left 1096308351 12:50498714-50498736 CCCATGGGTGTTCCACCTTCCGG No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308350_1096308357 -3 Left 1096308350 12:50498707-50498729 CCTCATTCCCATGGGTGTTCCAC No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308349_1096308357 -2 Left 1096308349 12:50498706-50498728 CCCTCATTCCCATGGGTGTTCCA No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308343_1096308357 23 Left 1096308343 12:50498681-50498703 CCCTGCATGGGCCAGGTGTTCCT No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308345_1096308357 12 Left 1096308345 12:50498692-50498714 CCAGGTGTTCCTTGCCCTCATTC 0: 485
1: 355
2: 126
3: 55
4: 250
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data
1096308348_1096308357 3 Left 1096308348 12:50498701-50498723 CCTTGCCCTCATTCCCATGGGTG No data
Right 1096308357 12:50498727-50498749 CACCTTCCGGCATGGGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096308357 Original CRISPR CACCTTCCGGCATGGGCGTT AGG Intergenic
No off target data available for this crispr