ID: 1096309176

View in Genome Browser
Species Human (GRCh38)
Location 12:50505191-50505213
Sequence GCCTGAAGTGCGGGCGCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096309172_1096309176 -4 Left 1096309172 12:50505172-50505194 CCGCGGTGGCGGCGCTGCCGCCT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 130
1096309166_1096309176 13 Left 1096309166 12:50505155-50505177 CCTGGAGCCGTCGCCGGCCGCGG 0: 1
1: 0
2: 4
3: 19
4: 202
Right 1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 130
1096309171_1096309176 0 Left 1096309171 12:50505168-50505190 CCGGCCGCGGTGGCGGCGCTGCC 0: 1
1: 0
2: 2
3: 29
4: 244
Right 1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 130
1096309170_1096309176 6 Left 1096309170 12:50505162-50505184 CCGTCGCCGGCCGCGGTGGCGGC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096309176 Original CRISPR GCCTGAAGTGCGGGCGCAGC TGG Exonic
900546233 1:3230788-3230810 GGCTGCAGTGCGGTCGCACCGGG - Intronic
901253642 1:7801608-7801630 GTCTGAAGTGGGGGCGAAGGTGG + Intronic
901329636 1:8395794-8395816 GCCTGCAGTGGGGGCACAGGAGG + Intronic
902194997 1:14791769-14791791 GCCTGAGGTGCTAGGGCAGCAGG + Intronic
902839980 1:19068461-19068483 GCTTGAAGTGTGGGGGGAGCTGG - Intergenic
903117286 1:21188734-21188756 GCCAGAAGTGATGGGGCAGCAGG - Intergenic
903839117 1:26225653-26225675 GCCTGGAGCGCGGCGGCAGCTGG + Intergenic
903974141 1:27138217-27138239 ACCTGAAGTGCGGGGGAAGAGGG - Intronic
904005649 1:27361818-27361840 GCCTGAAGTGCTGGTAGAGCAGG + Exonic
906513644 1:46425384-46425406 GTCTGATGTGTGGGGGCAGCTGG + Intergenic
907158954 1:52357684-52357706 CCCTTCAGTGCGGGAGCAGCTGG - Exonic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
919686566 1:200488532-200488554 GCCTGAAGTGGGAGTGCAGACGG + Intergenic
920424860 1:205866963-205866985 GCCTGAAGTGCAGGGGCATATGG + Intergenic
1074529083 10:114284780-114284802 GCCAGAGGTGTGGGTGCAGCTGG - Intronic
1076813751 10:132903490-132903512 GCCTGGAGAGCGGGCCCAGATGG - Intronic
1077352447 11:2099210-2099232 GCCAGAAATGCGGGTCCAGCTGG + Intergenic
1078821914 11:14891651-14891673 ACCTGAAGTGGCGGCGCGGCTGG + Intronic
1079305488 11:19317696-19317718 CCCTGAAGTGGGGGTGCAGAGGG - Intergenic
1083246256 11:61430103-61430125 CCCGGAAGTGCCCGCGCAGCCGG + Exonic
1083613734 11:64016383-64016405 GGCAGAGGGGCGGGCGCAGCTGG - Intronic
1083849083 11:65354951-65354973 GCCTGAGGTGGGTGCGGAGCGGG + Exonic
1084602560 11:70154911-70154933 GCCTGAAGGGCCGGGGCAGAGGG - Intronic
1084979591 11:72822077-72822099 GCGAGAGGCGCGGGCGCAGCAGG + Exonic
1086349473 11:85931059-85931081 GCCTGAAGTGCGGGCTGCTCAGG - Intergenic
1091303336 11:134521764-134521786 GCCTGGAGTGAGGGCGGAGCAGG + Intergenic
1092181836 12:6451602-6451624 TCCTGCAGCGCAGGCGCAGCTGG - Exonic
1094807904 12:34108879-34108901 CCATGAAATGCGGGAGCAGCGGG + Intergenic
1096234652 12:49917929-49917951 GCTTGAAGTGCGGGCAGAACCGG - Intergenic
1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG + Exonic
1099605619 12:84798018-84798040 GCCTGAAGTGCAGGGGCATATGG - Intergenic
1101442451 12:104713837-104713859 GCCTGAAGAGTTGGAGCAGCAGG + Intronic
1102491437 12:113291726-113291748 GGCTGAAGAGCAGGGGCAGCTGG - Intronic
1104157598 12:126148830-126148852 GCCTGGAGGGAGGGCGCAGAGGG - Intergenic
1105847384 13:24305215-24305237 GCCGGAAGTTAGGGCTCAGCTGG - Exonic
1107137306 13:36958333-36958355 GCCTGAAGTGCAGGGGCATATGG - Intronic
1114490171 14:23095494-23095516 GCCGGAAGTGCGTGGGCTGCCGG + Exonic
1115309547 14:31965532-31965554 CCCTGAAGGCAGGGCGCAGCTGG + Intergenic
1122951549 14:105047780-105047802 CCCTGCAGGACGGGCGCAGCTGG - Intergenic
1125677573 15:41511178-41511200 GCCTGCACTGCGGGCGGAGGCGG - Exonic
1129336686 15:74856202-74856224 GCCTGAAGTTTGGGAGCATCTGG - Intronic
1129674029 15:77622702-77622724 GCCAGGAGTGGGGGCGCAGTGGG + Intronic
1129794055 15:78362703-78362725 GGCTGAAGAGTGGGCTCAGCTGG - Intergenic
1130337844 15:82972746-82972768 GCCTCAAGTGCTGGCACAGCAGG + Intronic
1131007097 15:88987206-88987228 GCCTGCAGTGCAGGCCCAGCTGG - Intergenic
1132857683 16:2054209-2054231 CCCTGAAGTGCAGGGGCACCCGG - Intronic
1136290422 16:29268282-29268304 CCCTGAAGGGCAGGGGCAGCTGG - Intergenic
1138251566 16:55505739-55505761 GCCTGAAGTGTGGCAGCACCAGG - Exonic
1139388645 16:66591027-66591049 GCCTGAAGTGGGGGCTGGGCTGG + Intergenic
1139475885 16:67202376-67202398 GCCTGGAGTGGGGGGGCAGGAGG - Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140793316 16:78412635-78412657 GCCAGAAGTGAGGGAGGAGCAGG + Intronic
1142096304 16:88241803-88241825 CCCTGAAGGGCAGGGGCAGCTGG - Intergenic
1142262166 16:89048130-89048152 GCCTGGAGGGCCGGCGCTGCTGG + Intergenic
1144624741 17:16838934-16838956 GCCTGAGGTGGGGGAGGAGCTGG + Intergenic
1144881689 17:18433787-18433809 GCCTGAGGTGGGGGAGGAGCTGG - Intergenic
1145150544 17:20510599-20510621 GCCTGAGGTGGGGGAGGAGCTGG + Intergenic
1145243609 17:21253335-21253357 GGCTGGAGCGCGGGCGCAGGCGG + Exonic
1145938007 17:28726326-28726348 GCCTGAGGGGCGGGGGCAGGCGG - Intronic
1146716213 17:35089104-35089126 GCCGGGAGGGCGGCCGCAGCAGG - Exonic
1147539632 17:41346497-41346519 GCTGGACGTGCGGGCGCGGCTGG - Exonic
1147541582 17:41364828-41364850 GCTGGACGTGCGGGCGCGGCTGG - Exonic
1147785654 17:42976784-42976806 GCCTTAAGTGGGGGAGCATCAGG + Intronic
1151365143 17:73612209-73612231 GCCTGCAGCCCGGGTGCAGCTGG - Intronic
1152544811 17:80995127-80995149 CCCTGGAGTGCAGGTGCAGCTGG + Intronic
1160929014 19:1560951-1560973 GCCTGAAGGGCGGGCTCTGGGGG + Intronic
1161104879 19:2438380-2438402 GGCTGAGCTGCGGGCCCAGCTGG - Exonic
1162307432 19:9883673-9883695 TACTGAAGTGCGTGCTCAGCCGG - Intronic
1162481391 19:10928894-10928916 GCCGGGAGTGTGGGCGCGGCTGG + Exonic
1164598889 19:29548079-29548101 GCCTGAACTGGGGCTGCAGCAGG + Intronic
1165274068 19:34733244-34733266 GCCTGGAGTGGGGGCCCTGCGGG - Intergenic
1165446478 19:35859623-35859645 GCCTGCAGTGTGAGTGCAGCTGG + Exonic
1166688948 19:44811368-44811390 GCCTGGAGTCAGGGCACAGCAGG + Intronic
1167049552 19:47070022-47070044 GGCTGACGTGGGGACGCAGCAGG + Intronic
926018330 2:9474021-9474043 ACCTTCAGTGCGCGCGCAGCCGG - Intronic
926107372 2:10160714-10160736 GCCTGAGATGTGGGCGGAGCAGG - Intronic
926795439 2:16615457-16615479 GCCTGCAGTGGGGGCTCAGTGGG - Intronic
929252893 2:39779125-39779147 GCGAGAGGTGCGGGCGCGGCTGG - Exonic
934567206 2:95347386-95347408 GCCTGCAGTCCGGGCGCCCCTGG + Intronic
934671675 2:96217760-96217782 GCCTGAAGTGCAGGGGCATAAGG + Intergenic
937444972 2:121949966-121949988 GCCAGAAGTCAGGGGGCAGCCGG + Intergenic
944414484 2:199468767-199468789 GCCTGAGGGGCGGGGGCTGCTGG - Intronic
1168830130 20:841294-841316 GCCAGCGGCGCGGGCGCAGCCGG + Intronic
1169524795 20:6412720-6412742 GCCTGAAGTGGGGGTGCTACTGG - Intergenic
1171412917 20:24958623-24958645 GGCTGCAGGGCGGGCCCAGCAGG + Intronic
1171975677 20:31593450-31593472 GCCTGAGGTGAGGGTGCAGCTGG + Intergenic
1172440827 20:34965390-34965412 GCCTGGCCTGAGGGCGCAGCAGG + Intergenic
1175050742 20:56152933-56152955 GACTGAAGTTCGGGTGCAGGAGG - Intergenic
1179502856 21:41820920-41820942 GCCAGAGCTGGGGGCGCAGCAGG - Intronic
1180594596 22:16964931-16964953 GCTTGAAGTCAGGGCCCAGCTGG - Intronic
1181128859 22:20717708-20717730 GTCTGAAGTGAAGGTGCAGCCGG - Exonic
1183520084 22:38291734-38291756 GCCTGAAGGTTGGGGGCAGCGGG + Exonic
1184508351 22:44917574-44917596 CCCTGCAGTGCGAGCGCAGCGGG - Intronic
953373076 3:42406537-42406559 GCCTGAAGGGCGGGAGCAGAGGG - Intronic
954370486 3:50167416-50167438 GCCAGAAGTGACGGAGCAGCAGG - Intronic
954686355 3:52372324-52372346 GGCTGAAGTGCGGGCTGAGAAGG - Exonic
962463965 3:135639662-135639684 CCCTGAAGTGCAGGCCCTGCTGG + Intergenic
966945334 3:184773720-184773742 GCCTGAAGAGCGGGGCCAGGAGG - Intergenic
968422762 4:499264-499286 GCCGGAAGCGCGGCTGCAGCAGG + Exonic
968457241 4:706000-706022 GCCTGAGGAGCGGGCGCCGAGGG - Intronic
968576092 4:1366824-1366846 GCCTGCTGTGAGGACGCAGCGGG + Intronic
980444638 4:132888485-132888507 GCCTGAAGTGCAGGGGCATATGG - Intergenic
983666606 4:170190813-170190835 GCCTGAAGTGCAGGGGCATGTGG + Intergenic
983904450 4:173169252-173169274 GCCGGGACTGCGGGCGGAGCGGG + Intronic
985675210 5:1227336-1227358 CCCTGAAGTCCCCGCGCAGCTGG - Intronic
990494331 5:56332433-56332455 GCCTGAAATGCAGGTGAAGCAGG - Intergenic
998515643 5:142751384-142751406 GCTGGAAGTGCAGGCTCAGCTGG + Intergenic
999744827 5:154584139-154584161 GCCTGAGGGGCAGGCTCAGCAGG - Intergenic
1006743139 6:36323385-36323407 CCCAGAAGAGCGGGGGCAGCAGG - Exonic
1008659577 6:53652263-53652285 GGCTGAAGTGCGTGCGCTTCTGG + Exonic
1010440880 6:75892529-75892551 GGCTGAAGTGGAGGCACAGCTGG + Exonic
1011189195 6:84712770-84712792 GCCTGAAGTGCAGGGGCATATGG + Intronic
1018253572 6:161896054-161896076 GACTAAAGTGCGGGTGAAGCAGG + Intronic
1031471899 7:122176484-122176506 GCCTGAAGTGCAGGGGCATATGG - Intergenic
1032194016 7:129779654-129779676 GGCAGAAGTCCCGGCGCAGCTGG - Intergenic
1032726189 7:134591926-134591948 GCCTGAAGTGCAGGGGCATATGG - Intergenic
1033644197 7:143288314-143288336 GCCTGGTGTGTGGGCGCGGCAGG + Exonic
1033806309 7:144958188-144958210 GCCGCAAGTGTGGGCTCAGCAGG - Intergenic
1034444713 7:151107928-151107950 GCCTGAAGGGTGGGGGCAGGAGG - Intronic
1034891928 7:154847821-154847843 GGCTGAAGTGAGGGGGCGGCAGG - Intronic
1041663330 8:60420050-60420072 GCCTGAAGTGCAGGGGCATATGG + Intergenic
1043463956 8:80486958-80486980 GGCTGAAGCGCGGGCGGCGCTGG - Exonic
1047443664 8:124900852-124900874 GCCTGAAGTGCAGGGGCAAATGG + Intergenic
1049463187 8:142739470-142739492 ACCTGCACTGCGCGCGCAGCTGG - Intergenic
1049673135 8:143878476-143878498 GCTTGAAATGCGGGCGGAGCGGG - Intergenic
1050230884 9:3525477-3525499 CCCTGAAGTGCGGCCGGCGCAGG + Intronic
1053055408 9:34990664-34990686 GCCTGCAGTGGGGGTGCTGCTGG - Exonic
1055110292 9:72552463-72552485 GCCTGAAGTGGGGGTGGAGTGGG + Intronic
1057605703 9:96496636-96496658 GCCTGGATTGCGGGGTCAGCCGG - Intronic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1062275933 9:135730635-135730657 GCCTGAAGTGCCGGCAGGGCTGG - Intronic
1189946897 X:46188915-46188937 GCCTGAAGTGCAGGGGCACATGG - Intergenic
1190567262 X:51743559-51743581 GCCAGAAGAGCGGGCTCCGCCGG - Exonic
1190712542 X:53081211-53081233 GCCTAAATTGCAGGCGCAGGCGG + Intergenic
1193086536 X:77451919-77451941 GCCTGAAGTGGAGGGGCAGATGG + Intronic
1196950815 X:120874811-120874833 GGCTGCGGTGCGGGCACAGCTGG - Intronic
1198450985 X:136767171-136767193 GGCTGGAGTGAGGGAGCAGCTGG - Intronic
1198531290 X:137551107-137551129 GCCGAAAGCGCGGGCGCCGCAGG + Intergenic