ID: 1096309705

View in Genome Browser
Species Human (GRCh38)
Location 12:50509840-50509862
Sequence CTTAGACAGAACTTTGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096309705_1096309706 0 Left 1096309705 12:50509840-50509862 CCTTTATCAAAGTTCTGTCTAAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1096309706 12:50509863-50509885 CAGTTGTAACATCTGATGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 152
1096309705_1096309707 10 Left 1096309705 12:50509840-50509862 CCTTTATCAAAGTTCTGTCTAAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG 0: 1
1: 0
2: 2
3: 4
4: 87
1096309705_1096309708 18 Left 1096309705 12:50509840-50509862 CCTTTATCAAAGTTCTGTCTAAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1096309708 12:50509881-50509903 CTAGGAGTATTAAGGAAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096309705 Original CRISPR CTTAGACAGAACTTTGATAA AGG (reversed) Intronic
907069944 1:51525451-51525473 CTGAGACACAACTGTGATTATGG - Intergenic
907321589 1:53606162-53606184 CACAGGCAGCACTTTGATAAAGG + Intronic
907651123 1:56295779-56295801 CTTAAACTGAACTTTCTTAAAGG + Intergenic
908577824 1:65479641-65479663 CTTAGAAAGCACTTTTAGAAAGG - Intronic
908620538 1:65974927-65974949 CTAATACAGAAATTTGATACTGG + Intronic
909233237 1:73118571-73118593 CTCACACAGAACTTTGACATTGG + Intergenic
912614180 1:111080509-111080531 CTTAGGAATAAATTTGATAAAGG - Intergenic
913128386 1:115814561-115814583 CTTGGACAGTAGTTTGAGAATGG - Intergenic
917004548 1:170398703-170398725 ATTAGAAAGAACTTTGAGGAAGG + Intergenic
917076219 1:171207734-171207756 CTCAGAGAGAACTATGATGATGG + Exonic
920775298 1:208930935-208930957 CTCAGACAGGGCTTTGATCATGG + Intergenic
1064988720 10:21237131-21237153 CTTTGACAGGATTTTGACAATGG - Intergenic
1066439283 10:35422877-35422899 CTTAGAGAAAAATTTTATAAAGG - Intronic
1069279109 10:66631303-66631325 ATTAGACAGAAATTAGACAAAGG + Intronic
1074317719 10:112374579-112374601 CTGAGACAGAAATTTCTTAATGG - Intronic
1078972025 11:16425192-16425214 CTTAGAAAATGCTTTGATAAGGG - Intronic
1079314232 11:19394290-19394312 TATAGACAGTACTTTTATAATGG + Intronic
1079972843 11:27057650-27057672 CTTAGACAAAATTGTTATAAAGG - Intronic
1086639439 11:89133669-89133691 TTTAAACATAACTCTGATAAAGG - Intergenic
1087303605 11:96463373-96463395 GTTAGACAGTACTCTGGTAATGG - Intronic
1088132123 11:106505960-106505982 CTCAGACAGAAGTTTGATGGAGG + Intergenic
1088837467 11:113589975-113589997 CTAAAACAGAACTTTGATTCTGG - Intergenic
1089230587 11:116971385-116971407 CTAAGTGAGAAATTTGATAATGG - Intronic
1093021733 12:14210204-14210226 CTAAGACAGGACTTTGGAAATGG - Intergenic
1094429843 12:30356071-30356093 ATTAGACAGAAATTTACTAAAGG + Intergenic
1095139970 12:38649725-38649747 CTTAGGTATGACTTTGATAAGGG - Intronic
1095934376 12:47660655-47660677 TTTAAACATAACTCTGATAAAGG + Intergenic
1096309705 12:50509840-50509862 CTTAGACAGAACTTTGATAAAGG - Intronic
1096723798 12:53545007-53545029 CTTAGAGAGTACTTTAGTAAGGG + Intronic
1096806099 12:54141939-54141961 CTTAGACAGAAATTTGGTTCTGG - Intergenic
1096846705 12:54411495-54411517 CTTAGTCAGTACTTAGTTAAAGG + Intronic
1100024664 12:90113269-90113291 CTTAGACAAATCTTTGAAAAAGG + Intergenic
1100185240 12:92131667-92131689 CATAGCCAGCATTTTGATAAAGG + Intronic
1104130026 12:125884534-125884556 CTATGACTGAACTTTGAGAATGG + Intergenic
1106733522 13:32566869-32566891 CTTAGCCACAACTTTGCTAACGG - Intergenic
1106882982 13:34152059-34152081 GGTAGATAGAGCTTTGATAAGGG + Intergenic
1108572118 13:51761989-51762011 CTTTGAGAGAACTTTAACAAGGG + Exonic
1109314259 13:60731702-60731724 GTTAGAAAGAACTTTTAGAAGGG - Intergenic
1109335018 13:60982617-60982639 CATAGACAGAAAATAGATAATGG + Intergenic
1111106643 13:83653847-83653869 CTTAAATAGTACTTTGACAATGG - Intergenic
1111216620 13:85151526-85151548 CTAAGACAGTACTATGACAATGG - Intergenic
1111312679 13:86509808-86509830 CTGAGTCAGACCCTTGATAAAGG - Intergenic
1111753750 13:92366430-92366452 CTCATACATAACTTTGATACAGG + Intronic
1114394795 14:22348300-22348322 CTTTTACATAACTTTGAAAAAGG + Intergenic
1115596447 14:34914476-34914498 GTTAGTGAGAATTTTGATAAAGG + Intergenic
1117328861 14:54693108-54693130 CTTAAACAGAATATTGAAAAGGG + Intronic
1118565336 14:67134411-67134433 CATAAACAGTACTTTGAGAAGGG - Intronic
1119038258 14:71248809-71248831 CTTTGAAAGAACATTGAAAAAGG + Intergenic
1124662504 15:31561880-31561902 CTGAGACATAACTTTGATCATGG - Intronic
1124850378 15:33331678-33331700 CACAGACAGAACTTAGCTAAAGG + Intronic
1126569743 15:50137926-50137948 GTAAGTGAGAACTTTGATAAGGG - Intronic
1130760237 15:86811912-86811934 CTTAGAATGCACTTTGAAAATGG - Intronic
1131302971 15:91215880-91215902 CTTAGTCTGAATTTTCATAATGG - Intronic
1131844084 15:96470544-96470566 CTTACTTAGAACCTTGATAAAGG + Intergenic
1135433478 16:22407811-22407833 ATTACACAAAACTGTGATAAGGG + Intronic
1138582501 16:57950775-57950797 TTGAGACAGAGCTTTGATTATGG + Intronic
1150540528 17:66093600-66093622 CTTAGAAATAAATTTGATCAAGG + Intronic
1154279837 18:12992742-12992764 CTTCAACAGAGCTTTGCTAAGGG - Intronic
1155701918 18:28755863-28755885 CTTAGAAAGATCTTTAACAATGG - Intergenic
1158198297 18:54912021-54912043 CTTAGACAGAGCCATAATAATGG - Intronic
1158379803 18:56916512-56916534 CTTAGACAAAAATTTAAAAAAGG + Intronic
1159619436 18:70620390-70620412 CTTAGACAAAGGATTGATAATGG + Intergenic
1166440734 19:42812764-42812786 CTTAGAAATAACTTTGTTCATGG + Intronic
1166477512 19:43141349-43141371 CTTAGAAATAACTTTGTTCATGG + Intronic
1166488942 19:43240831-43240853 CTTAGAAATAACTTTGTTCATGG + Intronic
929366368 2:41161514-41161536 CTATGATATAACTTTGATAATGG - Intergenic
933539591 2:83621554-83621576 CTGAGACTGAACTTTCAGAATGG - Intergenic
933563924 2:83925745-83925767 CTTTGACAGAACTTTGAAGTTGG - Intergenic
936911377 2:117597242-117597264 CTTAGACAGAACTCAGAGGAGGG - Intergenic
938863155 2:135391167-135391189 CTTAATCAGAACTTTAAAAATGG - Intronic
939537840 2:143454542-143454564 CTTAGACAGAATTATAATAAAGG + Intronic
940322545 2:152392216-152392238 CTCAAACAGAACTCTGACAAAGG - Intronic
941847373 2:170146890-170146912 CTTTGACAGGGCTTTTATAAGGG + Intergenic
941954171 2:171187558-171187580 GTTAGACAGAATTTTAAGAAGGG + Intronic
942577149 2:177375756-177375778 CTTAGGCAGAATTTGGATAGAGG + Intronic
943535480 2:189143790-189143812 CTTAAACTGGACTTTGAAAAAGG + Intronic
943884659 2:193200357-193200379 CTTATAAAGAACTTGGGTAAGGG + Intergenic
944880499 2:204008065-204008087 CTTACATAGAACTTTTATAAAGG + Intergenic
947382297 2:229556678-229556700 CTTAGAGACAACTCTGAAAATGG + Intronic
1169712045 20:8575458-8575480 CTTAGACATAAATTTGGCAAAGG + Intronic
1171066616 20:22022976-22022998 CTTGGATAGAACTTTGCCAAGGG + Intergenic
1172255320 20:33512593-33512615 CCTAGACAGAAATTTGAGAATGG - Intronic
1176259085 20:64169653-64169675 CCTAAACAAAACTTTGGTAAGGG - Intronic
1177662672 21:24106455-24106477 CTTACATAAAACTTTAATAAAGG - Intergenic
1182983306 22:34693205-34693227 CTTAAAGAAAATTTTGATAATGG - Intergenic
949176544 3:1069786-1069808 CTTAAATAAAAATTTGATAAAGG + Intergenic
955835860 3:63054314-63054336 GTCAGACAAAACTTTGATAAAGG + Intergenic
957597852 3:82290372-82290394 CTTAGACAGCCATATGATAATGG + Intergenic
957835909 3:85589083-85589105 CTTAGAAAAGATTTTGATAAAGG + Intronic
958267960 3:91462140-91462162 CTTAGATACAATTTTGAGAAAGG + Intergenic
959214662 3:103436595-103436617 CTTTGACAGCACTGTGAAAACGG - Intergenic
959739316 3:109697731-109697753 GTTAAACAGAACTGTGCTAATGG - Intergenic
959884704 3:111486373-111486395 CTAACACAGAACTATGACAAAGG + Intronic
962054521 3:131856138-131856160 AATAGACAGAAGTTTGATATTGG - Intronic
963314372 3:143743376-143743398 CTTGGACAGAGCTGTGATATGGG - Intronic
963575419 3:147055561-147055583 ATTAGATAGAAATTTGATGAAGG + Intergenic
965853027 3:173053675-173053697 ATCAGACAGAATTTTAATAAGGG - Intronic
970386458 4:15561785-15561807 CAGAGACAGAACTTTGTTAGAGG - Intronic
971178517 4:24305457-24305479 GTTAGTCAGAACTGTAATAATGG + Intergenic
975144845 4:70955781-70955803 CTTATGCAAAATTTTGATAAAGG + Intronic
975378197 4:73669456-73669478 ATTAGGCAGAAATTTGATTAAGG + Intergenic
976922238 4:90454963-90454985 CTTAGAGAGAACCTGGATAAGGG + Intronic
977316465 4:95455258-95455280 CTTAGACATCACTTTGCCAATGG - Intronic
977903721 4:102452061-102452083 CTTAGACTGAACTCTTAGAAAGG - Intergenic
977956250 4:103030277-103030299 GTTAGAAAGCAATTTGATAAAGG + Intronic
980780788 4:137488809-137488831 CTAAGTCAGAACTATGACAATGG + Intergenic
981146970 4:141335076-141335098 CTTAGTTAGAACTTTGGTGAAGG + Intergenic
983872759 4:172841208-172841230 ATTAAACAGAACATTGATAATGG + Intronic
986237285 5:5923618-5923640 CTTATATAGAACTCTGATTATGG - Intergenic
986529477 5:8720884-8720906 CTTAGAGAGAACTTTTGTGAGGG - Intergenic
986554101 5:8993429-8993451 ATTAGACAGAAATTTGAGTAAGG - Intergenic
987044842 5:14098377-14098399 CATAGACAGAAAGTAGATAAGGG + Intergenic
987585354 5:19848011-19848033 CTTAGGCAGCCCCTTGATAAGGG + Intronic
988097073 5:26629376-26629398 CTTATAATGCACTTTGATAAGGG - Intergenic
988642499 5:33056527-33056549 CTTAAAAAGAACTTTGTGAATGG - Intergenic
994056543 5:95422978-95423000 CTGAGACAGAATTTGGCTAACGG + Intronic
997049352 5:130361016-130361038 ATTAGAGAGAAGTTTGGTAAAGG - Intergenic
999113158 5:149139638-149139660 CATAGACAGCTCTTTGAAAAGGG - Intergenic
1000587658 5:163120390-163120412 ATGAGACAGAACGTTAATAAGGG - Intergenic
1000943391 5:167391087-167391109 CTTAGATAATTCTTTGATAATGG - Intronic
1001870071 5:175146209-175146231 CTAACACTGAACTTTGACAAAGG + Intergenic
1003785735 6:9485062-9485084 CTTAAAAATAACTGTGATAATGG + Intergenic
1004257945 6:14082304-14082326 GTTAGCAAGAACTTTGAAAAGGG + Intergenic
1005640663 6:27793128-27793150 CTTAGACTGAACTTTGGTTCGGG + Intergenic
1008857665 6:56111491-56111513 CTTCAACAGAAGTTGGATAAAGG + Intronic
1008987245 6:57559437-57559459 CTTAGATACAATTTTGAGAAAGG - Intronic
1009175204 6:60451995-60452017 CTTAGATACAATTTTGAGAAAGG - Intergenic
1009497096 6:64364132-64364154 CTTGGCCAGAAATTTGGTAAAGG - Intronic
1009906058 6:69870898-69870920 CTTTGACAGAGATTTGATATGGG + Intronic
1010311683 6:74393697-74393719 CTGAGACATAACTGTGATACAGG + Intergenic
1012018181 6:93880268-93880290 CTTAGCATCAACTTTGATAAAGG - Intergenic
1012033691 6:94104497-94104519 CTGAGACAGGAATTTGGTAAAGG - Intergenic
1012646806 6:101694593-101694615 CTTAGCCAGAACTTTGCTGTAGG - Intronic
1013218286 6:108051663-108051685 CTGAGACAGAACTTTTTAAATGG + Intronic
1013974852 6:116065275-116065297 CTTAGAGAGAGCTATCATAAAGG + Intergenic
1015242388 6:131039879-131039901 CTTATTCTGAAATTTGATAAAGG + Intronic
1016914108 6:149228713-149228735 TTTAGAGAGAGCTTTGACAAAGG - Intronic
1017796644 6:157850657-157850679 CTTAAACAAAAATTTGATAGTGG + Intronic
1023369380 7:39497766-39497788 CTATGACAGAACATAGATAACGG - Intergenic
1026223540 7:68421181-68421203 CATAGAAAGAACTTAGTTAATGG - Intergenic
1027428484 7:78085687-78085709 CTTAGGCAGAACCTTGATGAAGG - Intronic
1027536093 7:79404226-79404248 GATAAACAGAACTTTGATCAAGG + Intronic
1029976749 7:104842079-104842101 CCTAGACAGCACTTTTATAGAGG + Intronic
1030729225 7:112965164-112965186 CTTAGTCAGAATTTTGTTAAGGG + Intergenic
1030902273 7:115139408-115139430 GTCAGACAGAACTTTATTAAAGG + Intergenic
1031668563 7:124515954-124515976 AATAGAAAGAATTTTGATAAGGG - Intergenic
1033350315 7:140556998-140557020 CTTAGAGAGAACATTCAGAATGG - Intronic
1033991602 7:147294502-147294524 CTTAGCCAGTCCTTTGTTAATGG - Intronic
1040975299 8:53186912-53186934 CAGAGACAGAAAGTTGATAATGG - Intergenic
1043230408 8:77793339-77793361 TTGAGTCATAACTTTGATAAAGG - Intergenic
1044897453 8:96907564-96907586 GGTATACAGAACTTTGAAAATGG + Intronic
1047655504 8:126972758-126972780 ATTAGACACAACGTAGATAAGGG - Intergenic
1048064931 8:130957906-130957928 CTCAGACAGAAGTTTGTTACAGG + Intronic
1051816525 9:21113597-21113619 CATATAAAGAACTTTGGTAAAGG + Intergenic
1055162089 9:73142527-73142549 CTTAAACACAACACTGATAACGG + Intergenic
1057589317 9:96358622-96358644 ATTAGTCTGAACATTGATAAAGG + Intronic
1058007819 9:99938482-99938504 CTTTTATAGAAATTTGATAAAGG + Intronic
1059043203 9:110837064-110837086 CTCAGACTGGCCTTTGATAAAGG - Intergenic
1059379808 9:113914225-113914247 CTTAGACACTACCTTGCTAAGGG - Intronic
1060728418 9:126021588-126021610 CTTAGAAAGAACCTTGATGATGG - Intergenic
1186187578 X:7036945-7036967 CTTAGAAATAACTTTGTTCACGG + Intergenic
1187094534 X:16132753-16132775 ATAAGAAAGAAATTTGATAATGG - Intronic
1187533022 X:20113582-20113604 TTTAAACACAACTTTGAAAAAGG + Intronic
1188713203 X:33428064-33428086 ATTGGTCAGAACTTTGATGAAGG - Intergenic
1191005703 X:55709293-55709315 CTTAAACAAAAATTTGAAAAGGG - Intergenic
1192135761 X:68598747-68598769 CTTACACAGAAAATTGATAAAGG + Intergenic
1193390955 X:80928675-80928697 CTTACACATATCATTGATAAGGG - Intergenic
1198397932 X:136241356-136241378 CTGAGACAGAAATTTGGTTATGG - Intronic
1199388276 X:147248637-147248659 CTTATGTAGAGCTTTGATAATGG - Intergenic
1199433975 X:147792475-147792497 CGTTGAAAGAACTTTGATATGGG + Intergenic