ID: 1096309707

View in Genome Browser
Species Human (GRCh38)
Location 12:50509873-50509895
Sequence ATCTGATGCTAGGAGTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096309705_1096309707 10 Left 1096309705 12:50509840-50509862 CCTTTATCAAAGTTCTGTCTAAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG 0: 1
1: 0
2: 2
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096309707 Original CRISPR ATCTGATGCTAGGAGTATTA AGG Intronic
904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG + Intergenic
907723776 1:56999760-56999782 ATCTGATGGCAGGAGTCTTGGGG - Intronic
909233952 1:73128503-73128525 ATCTAAGTCTAGGAGTATAAGGG + Intergenic
909281389 1:73758914-73758936 ATCTGGTGTTAAGATTATTATGG + Intergenic
913339747 1:117747069-117747091 TTCTGTTCCTAGGAGGATTATGG + Intergenic
914760912 1:150597537-150597559 ATCTGAGGCCAGGAGTTTTAAGG - Intergenic
921000769 1:211040429-211040451 ATCTGATGATGGGTTTATTAGGG + Intronic
1063431638 10:5995892-5995914 ATCTGTTGCCAGGAGTAAAATGG - Intergenic
1067161401 10:43827859-43827881 ATCTGAAGCTAAGAGTCTCAAGG - Intergenic
1069202169 10:65633913-65633935 ATCTGATGAAAGCTGTATTAGGG - Intergenic
1070104866 10:73421996-73422018 ATAAGATGATAGGAGTATTGTGG - Intergenic
1084897501 11:72284445-72284467 ATTAGATACTAGGAGTAATAAGG - Intergenic
1085812053 11:79692190-79692212 ATTTGATTCTAGGAGTATTAAGG - Intergenic
1087360873 11:97157957-97157979 ATCTGATTATAGCAGAATTAAGG - Intergenic
1087570530 11:99921583-99921605 ATGGAATGCTAGGAGCATTATGG - Intronic
1090183477 11:124720539-124720561 ATCAGATGCTGGGAATATAATGG + Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1100726106 12:97410630-97410652 ATCTGATGGAAGCAGTAATAGGG - Intergenic
1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG + Intergenic
1102540301 12:113614149-113614171 ATTTGAGGCTAGGAGTTTAAGGG - Intergenic
1108883810 13:55155284-55155306 TTCAGATAGTAGGAGTATTATGG - Intergenic
1109145066 13:58769216-58769238 ATCTGATGATATGGTTATTATGG - Intergenic
1110426678 13:75375110-75375132 ATCTGAAGCCACAAGTATTAAGG + Intronic
1114143037 14:19938587-19938609 ATCTGATGCTAAGATTTTGATGG - Intergenic
1115083172 14:29481857-29481879 ATATGATGCTAGCAGTTGTAAGG + Intergenic
1117399545 14:55346081-55346103 ATCTGATGCTACATGTTTTATGG + Intronic
1126363523 15:47870663-47870685 CAGTGATGATAGGAGTATTAGGG - Intergenic
1128626296 15:69208620-69208642 AGCTGATGCCAAGATTATTATGG - Intronic
1128651894 15:69422334-69422356 ATCTAATGATAGGAATAGTATGG + Exonic
1131929930 15:97430570-97430592 ATCAGATCCCAGAAGTATTAGGG - Intergenic
1137331467 16:47501817-47501839 ATCTGATGTTAGAAGCATTCTGG - Intronic
1156801072 18:41114654-41114676 ATCTAATGCCAAAAGTATTATGG - Intergenic
1158613169 18:58961867-58961889 ATCTGTTGCTGGAAGTATTCAGG + Intronic
1159208802 18:65288271-65288293 ATCAAATCCTAGGAGAATTAAGG - Intergenic
925389325 2:3484702-3484724 ATCTGCTGCTAGGAGTTGTGAGG - Intronic
925507110 2:4579484-4579506 ATCTGATGAGGGTAGTATTATGG + Intergenic
926782290 2:16484451-16484473 ATCTGAGGCTGGGAGTACCATGG - Intergenic
929714861 2:44299468-44299490 ATCTCCTGCTAGGAGTAATATGG - Intronic
929805995 2:45145463-45145485 AGCTGTGGCTAGGAGGATTATGG - Intergenic
931372764 2:61679176-61679198 GTCTGAGGCTAGGAATTTTAAGG - Intergenic
934165742 2:89292766-89292788 GTCTGAAGGTTGGAGTATTAGGG + Intergenic
934201535 2:89889690-89889712 GTCTGAAGGTTGGAGTATTAGGG - Intergenic
937951780 2:127393807-127393829 ATCTGGTGCTAGGTGTGCTAAGG + Intergenic
940232208 2:151467685-151467707 ATCTGATTCTAGGAACTTTATGG - Intronic
944945594 2:204681215-204681237 ATCTGATATTAGGATTAGTATGG + Intronic
945824116 2:214699312-214699334 ATATGATGCCAGGTGTATTTTGG + Intergenic
946093761 2:217253795-217253817 ATCTGAGGCTAGGAGTGTTAGGG + Intergenic
946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG + Intronic
1175063536 20:56265665-56265687 TTCTGATGCGAGGAGTAAAATGG + Intergenic
1177351581 21:19949828-19949850 ATCTAATGTTAGGATAATTAAGG + Intergenic
1177865440 21:26507539-26507561 ATCAGATGCTATGAGTATAAAGG - Intronic
1178930697 21:36816137-36816159 AACTGAGGCTAAGAGTAGTATGG - Intronic
950018922 3:9772696-9772718 AACTGTTGCCAGGAGAATTAGGG + Intronic
951816041 3:26756069-26756091 ATCTGAGGCTAGGAGAAATTTGG - Intergenic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
959625489 3:108445073-108445095 ATCTGGGGTTAGCAGTATTATGG + Intronic
960868791 3:122229011-122229033 ATCTGATGCTCAGATTCTTAGGG + Intronic
963175017 3:142289160-142289182 ATCTCATGCTAAGAAAATTAAGG - Intergenic
964232664 3:154488478-154488500 ATCTGATGCTATGTGTCTTGGGG - Intergenic
964675255 3:159271209-159271231 ATCAGAGGCTAGGAGTCTTTAGG + Intronic
967580514 3:191147631-191147653 ATTTGAGGCTAGGACTATTAGGG + Intergenic
971991412 4:33900555-33900577 ATCTGATGCTACCATTAATATGG + Intergenic
973113958 4:46431591-46431613 AAGTGATGCTAGGAGTTTTCTGG - Intronic
974334967 4:60530767-60530789 ATCTAATTCCAGGAGTTTTATGG - Intergenic
977363755 4:96040104-96040126 ATCTGATGCTAATTATATTATGG + Intergenic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
984125854 4:175809319-175809341 AGATGATGCTAGGTTTATTATGG + Intronic
984691251 4:182728373-182728395 ATCTATTGGTAGGAGTATGAAGG - Intronic
987001945 5:13668612-13668634 ATTTGTTGCTACTAGTATTATGG - Intergenic
991094168 5:62721657-62721679 ATATGAGGCTTGGAGTATTTTGG + Intergenic
991900071 5:71451990-71452012 AGCAGAGGCTAGCAGTATTAAGG - Intergenic
993846218 5:92947025-92947047 AAATGATGCTAGCAGGATTATGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
997361247 5:133296519-133296541 GTCTGATGGTAGGAGTGGTATGG - Intronic
999484869 5:151985381-151985403 TTATGTTCCTAGGAGTATTATGG + Intergenic
1007142401 6:39588996-39589018 ATATTATGCTAAGTGTATTAGGG - Intronic
1008364606 6:50662825-50662847 ATCTGATGCTCTGAATATTTTGG - Intergenic
1010373232 6:75135940-75135962 AACTGATGCTAGAATTATTTTGG - Intronic
1012696684 6:102392500-102392522 ATATGATTCTTGGTGTATTAAGG - Intergenic
1016661499 6:146586174-146586196 ATCTGAGGCTAGGAGTAGATGGG - Intergenic
1019322671 7:422765-422787 GTCTGATGCTGGGAGTGTTGGGG - Intergenic
1021286512 7:18787608-18787630 ATCTGAAGGTAGGAATATTTAGG + Intronic
1028738355 7:94243743-94243765 ATCTGGTGCTAGGAAGATGAAGG - Intergenic
1032636011 7:133709978-133710000 ATTTGATGCTAAGAGGATAATGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1048309008 8:133303901-133303923 ATCTGCTGCTAAGATTATGAGGG + Intergenic
1054726920 9:68661887-68661909 ATGTGATGCTAGCAGTATGTAGG + Intergenic
1192995140 X:76505484-76505506 TTCTGTAGCTAGGAGGATTATGG + Intergenic
1193433491 X:81441741-81441763 ATCTGATGGTAGTAGTTGTATGG + Intergenic
1194202342 X:90968764-90968786 GACAGATGCTAGCAGTATTAGGG + Intergenic
1197144502 X:123156515-123156537 ATCTGAGCCTAAGAGTATTGGGG - Intergenic
1199867480 X:151865545-151865567 ATCTGATGCTAAAATTAATATGG - Intergenic
1200548179 Y:4544218-4544240 GACAGATGCTAGCAGTATTAGGG + Intergenic
1202016290 Y:20410221-20410243 AGCTGATGATAGGACTATTGAGG + Intergenic