ID: 1096313021

View in Genome Browser
Species Human (GRCh38)
Location 12:50538236-50538258
Sequence GTGAAAAATTCCACCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096313018_1096313021 4 Left 1096313018 12:50538209-50538231 CCTTCTCTAATAAGAAGAAGAGG 0: 1
1: 0
2: 4
3: 70
4: 726
Right 1096313021 12:50538236-50538258 GTGAAAAATTCCACCTCAGAGGG 0: 1
1: 0
2: 0
3: 26
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096313021 Original CRISPR GTGAAAAATTCCACCTCAGA GGG Intronic
903015522 1:20359031-20359053 GAGAAAAATCCCACCTCATCGGG - Intergenic
904297690 1:29532245-29532267 CTGTAAAATTCTACCTCAGAGGG + Intergenic
906909571 1:49933230-49933252 GAGAAATATTGCACATCAGAGGG + Intronic
907531937 1:55108016-55108038 GAGACAAATTCCTGCTCAGAAGG + Intronic
908018999 1:59880418-59880440 GTTATATATTCCACCTCAGCAGG + Intergenic
909292086 1:73896294-73896316 GTGAAAAAATCAACCACAAAGGG - Intergenic
909483930 1:76153482-76153504 GTGCGAAATTACACCTGAGATGG + Intronic
910383415 1:86656176-86656198 ATGAAAAATTATACATCAGAGGG + Intergenic
911465133 1:98242061-98242083 GTGAAAATTTCAAGGTCAGAGGG + Intergenic
911475666 1:98369080-98369102 GTGAAGAATTCCACTTAAGAAGG - Intergenic
911605887 1:99904721-99904743 GTGAAAAAATCAATCTCAGAAGG - Intronic
911612988 1:99977526-99977548 GAGTGAAATTCCATCTCAGAAGG + Intronic
913574368 1:120155768-120155790 TTAAAAAATTCTACCTCAGAAGG + Exonic
915827220 1:159090907-159090929 TTCAAAGATTCCACCTCAAATGG + Intronic
916128957 1:161594353-161594375 GTCAAAGACCCCACCTCAGATGG + Intronic
916138876 1:161676217-161676239 GTCAAAGACCCCACCTCAGATGG + Intronic
916424945 1:164671373-164671395 AAGAAAAATTCCACCTCACACGG - Intronic
917251217 1:173063091-173063113 GTGAAAAAATGCTCCTCAGGGGG - Intergenic
918698987 1:187583047-187583069 GTGCAAAATTCAATCTCAGAAGG + Intergenic
921297486 1:213718401-213718423 GTGAATAACTCAACCTCATAGGG - Intergenic
921474886 1:215594517-215594539 TTTAAAAACTCCAACTCAGATGG + Intronic
921945282 1:220881979-220882001 GTGTAAAATTCCTCCTTAGAGGG + Intronic
1066525458 10:36274450-36274472 GTGAAAAATTACACCTACAAAGG + Intergenic
1067493259 10:46734867-46734889 GTGAAAAATTGCACATAAAAAGG - Intergenic
1067601402 10:47605537-47605559 GTGAAAAATTGCACATAAAAAGG + Intergenic
1069066163 10:63943988-63944010 GGGAAAAAATACACGTCAGAAGG - Intergenic
1071652950 10:87413411-87413433 GTGAAAAATTACACATAAAAAGG + Intergenic
1073039671 10:100594617-100594639 GTGAAAAATCCAGTCTCAGAAGG + Intergenic
1075559678 10:123459501-123459523 GTGTTAAATTGCATCTCAGAGGG + Intergenic
1076263734 10:129092797-129092819 TTGAAAAGATCCACCCCAGATGG - Intergenic
1077661287 11:4070747-4070769 GAGAACACTTCCAACTCAGATGG + Intronic
1078637880 11:13068843-13068865 GTCAACATTTCCACCCCAGAGGG + Intergenic
1078914724 11:15768711-15768733 GTGAATAATCCCACATCGGAGGG - Intergenic
1080818383 11:35780938-35780960 GAGTTAAATTCCACCACAGAAGG - Intronic
1085335689 11:75692632-75692654 ATGAAAAATCCAACCTCAAAAGG - Intergenic
1087211585 11:95450503-95450525 GGGAAAAATTCCGCCTGGGAGGG + Intergenic
1087717994 11:101631506-101631528 CTGAACACTTCTACCTCAGAGGG - Intronic
1088466604 11:110146685-110146707 GTGAACAATTCCAACTGGGAAGG + Intronic
1088935704 11:114398085-114398107 GTGGAAAATACCACCTCAAAAGG - Intronic
1096313021 12:50538236-50538258 GTGAAAAATTCCACCTCAGAGGG + Intronic
1098797521 12:74909769-74909791 GTGAGAAATACCACTTCAGATGG + Intergenic
1100180872 12:92084886-92084908 GAGAAAAATTCTACCTCTCATGG + Intronic
1102859101 12:116320025-116320047 GTCAGAAATTCCAACCCAGAGGG - Intergenic
1103172425 12:118833136-118833158 AGGAATCATTCCACCTCAGATGG - Intergenic
1104530289 12:129563784-129563806 GTACAAGATTCCATCTCAGATGG - Intronic
1105012793 12:132766780-132766802 CTGCAACATTCCCCCTCAGACGG + Intergenic
1105328161 13:19389099-19389121 GTGGTAAAATCCACCTCAGGTGG + Intergenic
1105486026 13:20833660-20833682 ATGAAAAATTACAGCTGAGAAGG + Intronic
1107222240 13:37997084-37997106 CTGAAAAATTTCTCCTCTGATGG + Intergenic
1107579511 13:41767355-41767377 GTAAAAATTCCCACCTGAGAGGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1112283312 13:98081734-98081756 ATGAAAAATTCTACCTCATAGGG - Intergenic
1116464913 14:45220599-45220621 GTGAAAAAAGCCAACTCAAAGGG - Intronic
1117775474 14:59179890-59179912 ATGAGAAATTCCACATCACAAGG + Intergenic
1120292518 14:82593228-82593250 AGGAAAAATTTAACCTCAGATGG + Intergenic
1124889539 15:33719584-33719606 GTGAGAAATTACAACTGAGAGGG + Intronic
1125435132 15:39636263-39636285 GAGAAAAATACCACTTTAGATGG - Intronic
1126882338 15:53112554-53112576 GTAAAAGTTTCCACCTCATAGGG + Intergenic
1126902073 15:53324847-53324869 GAGAATAATTCTACCTCACAAGG - Intergenic
1127821519 15:62660652-62660674 GTACAAAATTCCACATCACATGG - Intronic
1129623627 15:77173662-77173684 GTAAAACATTCAAACTCAGAAGG - Intronic
1130762695 15:86836796-86836818 CTGAAAGAATCCATCTCAGAGGG + Intronic
1131901013 15:97087735-97087757 ATGAAAAAATCCACAGCAGAGGG + Intergenic
1131923954 15:97361552-97361574 GTGGGAAATTCAACCTCAGAGGG - Intergenic
1133784679 16:8964399-8964421 GTGAAAAAGTGCACGTCAGCGGG - Intronic
1135249937 16:20892334-20892356 GGGAAAAACACCTCCTCAGAGGG + Intronic
1137974744 16:53021889-53021911 GTGAAAGGAACCACCTCAGAAGG - Intergenic
1138001378 16:53283476-53283498 GGAAAACCTTCCACCTCAGATGG + Intronic
1140110738 16:72002409-72002431 GTGAAAAGTGCCAGCCCAGAGGG + Intergenic
1141149036 16:81551699-81551721 GTGACAATTTCCACCTTGGATGG - Intronic
1143004948 17:3824770-3824792 GTCAGAAATTCCAACTCAGGTGG + Intronic
1145050656 17:19657541-19657563 GTAAAATATTCCACCTCATTTGG + Intronic
1147481232 17:40765518-40765540 TTGTAAAATGCAACCTCAGAGGG + Intergenic
1147549583 17:41430151-41430173 TTTCAAAAGTCCACCTCAGAAGG + Intergenic
1150142431 17:62741610-62741632 TTAAAAAGTTCAACCTCAGAAGG - Intronic
1150203819 17:63385060-63385082 GTGATAAATTCTACCTCCTAGGG + Intronic
1154038162 18:10826962-10826984 GTGAAAAATCCAACCTTTGAAGG - Intronic
1155086680 18:22465816-22465838 CTGAAAAATCACACCTCACATGG - Intergenic
1155319280 18:24603212-24603234 GAGAAAAATTCCACTACAGAGGG - Intergenic
1155518805 18:26648992-26649014 GTGAGGAAAACCACCTCAGAGGG - Intronic
1155605427 18:27600357-27600379 GTGAAAAATTCCACAGCTGATGG - Intergenic
1156438886 18:37164316-37164338 GTGAAAAAGTCTACCTGAGTAGG - Intronic
1156738710 18:40297457-40297479 GTGAAAAATTGCACCTCTTGAGG + Intergenic
1158311676 18:56166228-56166250 GGGAAAATTTCCACCTTAAAAGG - Intergenic
1158429978 18:57376472-57376494 GAGAATAATTCCACCTCAGGAGG - Intergenic
1158866984 18:61647553-61647575 GTGAACACTTCCACCTGATAGGG + Intergenic
1164447542 19:28330859-28330881 GAGAAAAACTCCACTTCTGAAGG - Intergenic
1165778536 19:38418741-38418763 TTGAAACATGCCTCCTCAGATGG - Intronic
926721575 2:15965320-15965342 GTGAAAATTCCTACCTCACAAGG + Intergenic
926791715 2:16578607-16578629 ATGAAAAATTCCACATTAGATGG + Intronic
930876372 2:56222499-56222521 GTGAAAAATTCCAGCCCAGTGGG - Intronic
933921569 2:87052922-87052944 GTGATAAATTGCATCTCTGATGG + Intergenic
933930055 2:87140875-87140897 GTGATAAATTGCATCTCTGATGG - Intergenic
934001388 2:87716660-87716682 GTGATAAATTGCATCTCTGATGG - Intergenic
935446339 2:103160554-103160576 GTGAAAAATTCAACATTACAGGG + Intergenic
936362888 2:111822530-111822552 GTGATAAATTGCATCTCTGATGG + Exonic
940713764 2:157194323-157194345 GTGAAAAAATGTGCCTCAGAAGG - Intergenic
941014201 2:160336126-160336148 GTGAAAAATCCCAGGTCAGAGGG + Intronic
941078389 2:161032323-161032345 TTTAAAAAATCTACCTCAGAAGG + Intergenic
942847065 2:180439800-180439822 GTCAAAGATTCCACCTTTGAGGG + Intergenic
946939145 2:224753028-224753050 GCTAAAAGTTACACCTCAGAGGG + Intergenic
1168792586 20:589629-589651 GAGAAAAATCCCACTTCATAGGG + Intergenic
1170290605 20:14764425-14764447 AAGAAACAATCCACCTCAGATGG - Intronic
1170442949 20:16397188-16397210 GGGAAACATTCCTCCTCAGCTGG - Intronic
1171026234 20:21632898-21632920 GTGAAAAATTCCACTTGACTAGG - Intergenic
1172868159 20:38115750-38115772 AAGAAAACTTCAACCTCAGATGG - Intronic
1173371019 20:42435376-42435398 GTGAATGCTACCACCTCAGAAGG - Intronic
1173539638 20:43841753-43841775 TTGAAAAATTCAAACTCAGAAGG + Intergenic
1174936587 20:54876984-54877006 GTGAAAAATTTCAGATCAGCAGG - Intergenic
1177145387 21:17401785-17401807 GAGAAACATGCCACGTCAGAAGG + Intergenic
1177347617 21:19893661-19893683 CAGAAAAATTCTACCTCTGAAGG + Intergenic
1181488590 22:23247250-23247272 GTGAAAACCTCCACCACAGCTGG + Intronic
1181981606 22:26770828-26770850 GAGGAAAATTCCAACCCAGAAGG + Intergenic
1181993203 22:26853967-26853989 GTGATAAATTTAACCTCATAAGG + Intergenic
1184011304 22:41750693-41750715 GAGAAGAATTCCAACTCACATGG - Intronic
1184621783 22:45684648-45684670 GTGAATATTTCCAGCTCTGATGG - Intronic
1184927896 22:47657062-47657084 CTGGAAGGTTCCACCTCAGAAGG + Intergenic
949229520 3:1734258-1734280 GTGAAAAATCCCACTTCTGGGGG - Intergenic
951507870 3:23468827-23468849 GTGACAAAATCCATCTCACAAGG + Intronic
952235653 3:31477006-31477028 GTCAAAAATTCCTTTTCAGATGG + Intergenic
953074719 3:39557939-39557961 GTGAAAAAGTCCTCCTGTGAGGG - Intergenic
953152850 3:40340968-40340990 GTGAAATATTCCAGGCCAGATGG + Intergenic
955139705 3:56257056-56257078 GGTAATAATTCTACCTCAGAGGG + Intronic
955324681 3:58000844-58000866 GTGTAAAATTACAACTGAGAAGG + Intergenic
960170006 3:114449287-114449309 ATGAGAAATTTCACCTCAAAAGG + Intronic
960576641 3:119236745-119236767 GTACAAAATTCCACCTGAGAAGG + Intronic
962084562 3:132176596-132176618 GTGAAAAATTGCTACTGAGAAGG + Intronic
962898344 3:139735881-139735903 GTGGGAAAGTCCTCCTCAGAGGG - Intergenic
963307696 3:143671855-143671877 GGGAGAAATTACACCTCAGAGGG - Intronic
964709095 3:159652718-159652740 GTGAAAAAAGCCACATAAGAGGG + Intronic
966257970 3:177940785-177940807 ATGAAATGTTTCACCTCAGATGG + Intergenic
967097970 3:186193308-186193330 ATGACAAATTAAACCTCAGAGGG - Intronic
970212588 4:13726048-13726070 GTTAAAAATTCCAGCTCACTGGG + Intergenic
970769923 4:19599822-19599844 ATTCAAAATTCCACCTCAAATGG - Intergenic
970856058 4:20650591-20650613 TTGAAGAATTCCACCTGATATGG - Intergenic
971081019 4:23211286-23211308 GTGAAAAGTGCAACTTCAGATGG + Intergenic
971395970 4:26227841-26227863 GTGAAAAACTCAACCGGAGAAGG - Intronic
976613345 4:87052009-87052031 GTGAAAGGTGCCTCCTCAGAGGG - Intronic
976867989 4:89753926-89753948 GTGAAAAATTCCAACTGATTTGG + Intronic
977148656 4:93480411-93480433 TAGAAAAATTCCACATCTGAAGG - Intronic
978974681 4:114855177-114855199 GTTAAAAATTCATTCTCAGATGG + Intronic
979045724 4:115860730-115860752 GGGAAAAACTGCACCACAGAAGG - Intergenic
979618403 4:122770412-122770434 GTGAAAAATTGGACATCAGAGGG - Intergenic
981535294 4:145793769-145793791 GTTAAAAGTTCAACCTCAAAAGG + Intronic
987258838 5:16183091-16183113 GTGGAAAATTCTATATCAGATGG - Intergenic
987750749 5:22036075-22036097 GTGAAAAAAAGCACCTTAGATGG + Intronic
987900674 5:24007295-24007317 GAGAAATATTGAACCTCAGATGG + Intronic
991970683 5:72138436-72138458 TTGAAAAATTTCATTTCAGAAGG - Intronic
992476903 5:77111655-77111677 CAGAAAAATTCTACCTCACATGG - Intergenic
992734278 5:79703304-79703326 GGGAAAACTTCAACCTCATATGG - Intronic
994311490 5:98277352-98277374 GTAAAAAATTCCACATTAAATGG + Intergenic
994840393 5:104917242-104917264 GAGAATATTTCCCCCTCAGATGG + Intergenic
996364987 5:122691826-122691848 AGGAAAAATTCCTCCTCAGCTGG - Intergenic
996590551 5:125142048-125142070 GTGATAAGTTTAACCTCAGAGGG + Intergenic
996691309 5:126343118-126343140 GTGAAAGACTCTACCTAAGAAGG + Intergenic
998730498 5:145070116-145070138 ATGAAAAATCCCAACTAAGAAGG + Intergenic
999061805 5:148643831-148643853 GTGAAAGGATCCACCTCAGTAGG + Intronic
999719881 5:154391819-154391841 GAGAAAAAGCCCACCTGAGAGGG - Intronic
1001498761 5:172211670-172211692 GTGAAAAATTCCATCTGTGATGG - Exonic
1001658904 5:173375616-173375638 GAGAATAATTCCTCCACAGAGGG - Intergenic
1001971531 5:175958784-175958806 GTGATAACACCCACCTCAGAAGG + Intronic
1002245911 5:177884992-177885014 GTGATAACACCCACCTCAGAAGG - Intergenic
1002344104 5:178536031-178536053 GGGACAGTTTCCACCTCAGAGGG - Intronic
1002518498 5:179776568-179776590 GTGAAAATTTCACCCTCTGAGGG + Exonic
1002818293 6:698628-698650 GGGAAAAAACCCACCTCAGGAGG - Intergenic
1006048508 6:31320426-31320448 GTCACAAATTACACCTCAGCAGG + Intronic
1006854241 6:37121986-37122008 GTGATAAATGCCACTTTAGACGG + Intergenic
1007862800 6:44930697-44930719 GTAACAAACTCCACCCCAGAGGG - Intronic
1008735757 6:54541875-54541897 GTCAAATATTCATCCTCAGAAGG - Intergenic
1010541798 6:77100384-77100406 ATAAAAACTTCCACTTCAGAAGG + Intergenic
1011834241 6:91410574-91410596 ATGAAAAACTCAACCTAAGAGGG - Intergenic
1012043153 6:94236449-94236471 GTGAAAAATTCCATTCCAAAAGG + Intergenic
1014914789 6:127133387-127133409 GAGAAAAATCCCACCTTAGGAGG + Intronic
1014953613 6:127589222-127589244 GTGGTAGATTCCACCTCAGGTGG + Intronic
1015749190 6:136543331-136543353 GTGAAAAATTCAGACTCAAAAGG + Intronic
1022343752 7:29493546-29493568 GTGAAGAATTCCATTTTAGATGG - Intronic
1023262812 7:38375139-38375161 TTCAAAAATCCCACCTAAGAAGG + Intergenic
1028794346 7:94886860-94886882 GTGAAGAATTCAACCTTAGAGGG + Intergenic
1029103831 7:98157714-98157736 GTGAAAAAATCAATCTCAAAAGG + Intronic
1031050288 7:116938003-116938025 GTGAAGAGTTGCTCCTCAGAGGG + Intergenic
1031865600 7:127035827-127035849 GTGAAAAAAGCCATCTGAGAGGG - Intronic
1033913490 7:146294031-146294053 GTGAAAAAATCAACCCCATAAGG + Intronic
1034655154 7:152723225-152723247 GAGCAAAATTCCATCTCATAAGG + Intergenic
1038072039 8:24028005-24028027 GTGAATTATTCCACCTGAGGTGG + Intergenic
1038840979 8:31184559-31184581 GTGAAACATTCTTCCTTAGATGG + Intergenic
1042199483 8:66267752-66267774 GTGACAAGTTTCACCTCACAAGG + Intergenic
1043413489 8:80024648-80024670 ATGAAAAATAGCATCTCAGATGG - Intronic
1043471655 8:80569104-80569126 GAAATAAATTCCACCTCTGAGGG - Intergenic
1043500484 8:80849478-80849500 GAAATAAATTCCACCTCTGATGG - Intronic
1045294736 8:100863177-100863199 TTGAAAAATTCCTCCCCAGAAGG + Intergenic
1045639593 8:104233200-104233222 ATAATAAATTCCTCCTCAGAAGG + Intronic
1047318524 8:123756176-123756198 TTGAAAAAATCAACTTCAGATGG + Intergenic
1047777690 8:128087118-128087140 GTGAAAGAACCTACCTCAGAGGG - Intergenic
1047982734 8:130199741-130199763 AGAAAAAATTCCACCTCAAATGG + Intronic
1048439279 8:134448002-134448024 GTGGAGAATTCCACCTGACAAGG + Intergenic
1050530387 9:6583365-6583387 ATGAAATATTCCACCTTAAAAGG + Intronic
1051497568 9:17741869-17741891 CTGATAACTTCCAGCTCAGATGG + Intronic
1051725205 9:20081896-20081918 GGGAAAATTTCCTCCTCAGATGG + Intergenic
1052109765 9:24566929-24566951 GTGAAGAAGTCCTCCTCACACGG + Intergenic
1054736787 9:68761122-68761144 ATGAAAATATCCACATCAGAAGG - Intronic
1055683462 9:78743082-78743104 GTGAAAAACTCCAGCTGAGCCGG - Intergenic
1056889093 9:90473067-90473089 GAGAAAACTTCCACACCAGATGG + Intergenic
1058669924 9:107352168-107352190 GTGAAAAAGTCCAAAACAGAAGG - Intergenic
1060713563 9:125896408-125896430 GTGGAAATTTCCAACTCAAAGGG + Intronic
1061936559 9:133860874-133860896 CTGCAAAATTCAGCCTCAGAGGG - Intronic
1192960307 X:76123369-76123391 GTGATAAATTCCAAGTCATAGGG - Intergenic
1195168697 X:102245431-102245453 GTAAAAAATTTAACCTCATAAGG - Intergenic
1195190160 X:102441656-102441678 GTAAAAAATTTAACCTCATAAGG + Intronic
1198050433 X:132946766-132946788 ATTAAAAAATCTACCTCAGAGGG + Intronic
1198457850 X:136835155-136835177 GTGAAAAAGTCAACCTCAAAAGG - Intergenic