ID: 1096321642

View in Genome Browser
Species Human (GRCh38)
Location 12:50619362-50619384
Sequence AGTTGTACTCTGCTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096321642_1096321644 7 Left 1096321642 12:50619362-50619384 CCAGTCAGCAGCAGAGTACAACT 0: 1
1: 0
2: 2
3: 8
4: 124
Right 1096321644 12:50619392-50619414 CACTAAGTGACTGTATCGTTAGG 0: 1
1: 0
2: 1
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096321642 Original CRISPR AGTTGTACTCTGCTGCTGAC TGG (reversed) Intronic
901483922 1:9545013-9545035 AGTTTTACTCTGCTGTCAACTGG + Intronic
903059437 1:20659590-20659612 AGTTGAAATCTTCTGATGACTGG - Intronic
907298866 1:53472743-53472765 AGTTGTTCTTTGCTTTTGACTGG - Intergenic
907815159 1:57911438-57911460 AGCTGTCCTCTGCTGCTGGAAGG - Intronic
908650984 1:66332684-66332706 TGGTGCACTCTGCTGCAGACAGG - Intronic
909132370 1:71753964-71753986 AGGTGTCTGCTGCTGCTGACTGG - Intronic
911627535 1:100142019-100142041 AGTTTGACTATGCTGCTGTCTGG + Intronic
915097227 1:153471646-153471668 CATTGGTCTCTGCTGCTGACAGG + Intergenic
915587282 1:156850941-156850963 AGTCTTGCTCTGCAGCTGACAGG + Intronic
915614351 1:157025231-157025253 TGATGTACTCTGCTGCTTCCAGG + Intronic
919582409 1:199392656-199392678 AGTTGTACTTTGTTACTGATCGG - Intergenic
919969009 1:202559761-202559783 ATTTGTCCTCAGCTGCTGCCTGG - Intronic
1068912202 10:62390133-62390155 ATTCTTACTCTGCTTCTGACTGG + Intronic
1070671664 10:78381611-78381633 AGGTGTTCTCTGCTGGCGACAGG - Intergenic
1076652233 10:131997739-131997761 ACTTGTACTTTGCTGGTGAGTGG + Intergenic
1077480006 11:2809593-2809615 AGTTGGACTCATCTCCTGACTGG + Intronic
1078538847 11:12197559-12197581 TGTTCGACTCTGCTGCTGGCAGG + Intronic
1080066070 11:28015120-28015142 AGTTGAACTGTGTGGCTGACTGG + Intergenic
1081296762 11:41399860-41399882 AGTTGGACTGTGCTACTGAAAGG + Intronic
1081716565 11:45254743-45254765 AGGTGTACTATGCTGCTGCTGGG - Intronic
1083013433 11:59426118-59426140 AGTTGTGATTTGCTGCTGAATGG + Intergenic
1084680320 11:70662936-70662958 CGTAGGACTCTGCTGCTGCCCGG + Intronic
1086731435 11:90255317-90255339 ATTTGTATTCTGCTGCTGTTGGG + Intergenic
1091464706 12:673859-673881 AGATTTACTGTGCTGCTGAGAGG + Intergenic
1091775618 12:3182885-3182907 TGTTGTGCTCAGCTCCTGACTGG - Intronic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1094158816 12:27368240-27368262 TGTTGTACTCTGCTGCCCATAGG + Exonic
1095238845 12:39833085-39833107 AGTTGTAGTTTGCTGATGCCAGG - Intronic
1096321642 12:50619362-50619384 AGTTGTACTCTGCTGCTGACTGG - Intronic
1096892459 12:54785831-54785853 AGTGGTACCCTGCTGCTGGAGGG + Intergenic
1097305778 12:58067526-58067548 AGTTGTACTCTGCTGTTGGCAGG - Intergenic
1098689774 12:73472484-73472506 AGTCGTGTTCTGCTGCTGAAGGG - Intergenic
1101364240 12:104056816-104056838 ATTTCTAGTCTGCTGGTGACTGG + Intronic
1101479352 12:105082595-105082617 AATTGTCCTCAGCTGGTGACAGG - Intronic
1101789699 12:107915485-107915507 AGTGGTTCTCTGCTCCTGCCTGG + Intergenic
1106355408 13:28977382-28977404 AGTTATAATCAGCTGCTAACAGG + Intronic
1112121765 13:96420125-96420147 AGTTGTTTGCTGCTGTTGACTGG - Intronic
1114352402 14:21867475-21867497 ATTTGTACTATTCTGCTAACAGG + Intergenic
1117802861 14:59463810-59463832 AGTTGTACTTTTCTGCCGAGAGG - Exonic
1119798094 14:77417256-77417278 ACGTGTATTCTGCTGCTGAGTGG + Intronic
1121701720 14:95959716-95959738 AGTAGTTCTCTGCACCTGACAGG - Intergenic
1126647451 15:50889202-50889224 ATGTGTACTCTGCTGCTGTTGGG - Intergenic
1131566208 15:93487820-93487842 AGTTGGACTTTGCCACTGACTGG - Intergenic
1133314902 16:4876880-4876902 AGTGGGACTGTGCTGCTGGCCGG + Exonic
1133819567 16:9224450-9224472 AGTTGTGCTCTCATGGTGACTGG + Intergenic
1141336080 16:83156646-83156668 AGTTTTACTCACCTGCTGCCAGG + Intronic
1141802394 16:86319727-86319749 AATTGAACTCTGCTCCTCACTGG - Intergenic
1144387310 17:14760873-14760895 AGCTCAACTCTGCTGCTGACTGG - Intergenic
1148763305 17:50020758-50020780 AGTTCTACCCTGGTGCTGGCTGG - Intergenic
1151981505 17:77512754-77512776 CTTTGTGCTCTGCAGCTGACAGG - Intergenic
1154096242 18:11417756-11417778 AATTGTACTCTTCTGCACACGGG + Intergenic
1156624950 18:38897565-38897587 ATTTTCACTCTGCTGCTGATGGG - Intergenic
1157843662 18:50982334-50982356 TGTTGTTCTCTGTTGCTGGCTGG + Intronic
1158639617 18:59192481-59192503 AGTTGTAATCAGATGCTGGCTGG - Intergenic
1158653244 18:59306606-59306628 AGTTTCACTCTATTGCTGACAGG - Intronic
1165446549 19:35860003-35860025 AGTCTCACTCTGCTGCTGAGTGG - Intronic
1168432592 19:56293311-56293333 AGTTATTCTCTGCACCTGACTGG - Intronic
1168614997 19:57830381-57830403 AGTTGTCCTCTGCTGCACAGAGG + Exonic
1168622494 19:57890548-57890570 AGTTGTTCTCTTGTGCTGAGTGG + Intronic
926506821 2:13726363-13726385 AGTTGGAGGCTGCTGCAGACAGG - Intergenic
928686050 2:33750105-33750127 AGTTATACTCTGCTTCTAATTGG + Intergenic
928931213 2:36626252-36626274 AGTTTAACTTTTCTGCTGACAGG + Intronic
931725508 2:65106616-65106638 ACTTCTATTTTGCTGCTGACTGG - Intronic
935924801 2:108055754-108055776 AGTTGTACTTCTCTGATGACTGG - Intergenic
936040752 2:109147223-109147245 AGCTGTCCGCTGCTGCTGAGAGG + Intronic
936262944 2:110977951-110977973 AGGTGTTCTCTGGTGCTGATGGG - Intronic
939909306 2:147961607-147961629 TGATGTACTCTGATGCTGGCAGG - Intronic
941757798 2:169206693-169206715 TGTTGACCTCTGCTGGTGACCGG + Exonic
943541370 2:189218722-189218744 AATTGTACACAGCTGATGACTGG - Intergenic
947880744 2:233509116-233509138 AGGGGTACTCTGCTGCTACCAGG + Intronic
1168921474 20:1540166-1540188 ATTTATTCTATGCTGCTGACAGG + Intronic
1171091456 20:22289218-22289240 TGTTGTGATCTGCTGCTGCCCGG + Intergenic
1172502696 20:35438159-35438181 AGTTATTTTCAGCTGCTGACTGG - Exonic
1172619203 20:36308062-36308084 ACTCGGAGTCTGCTGCTGACTGG - Intronic
1172705690 20:36880620-36880642 AGTTGTAGTCTGCAGCTGGAAGG - Intronic
1175955458 20:62606808-62606830 AGTTTTACTCAGCTGCTGGCAGG + Intergenic
1176022784 20:62970643-62970665 TGTTGTTGTCTGCTGCAGACAGG + Intergenic
1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG + Exonic
1179099018 21:38340272-38340294 TGTTGGCCTCTGCTGCTGATGGG - Intergenic
1184316612 22:43698206-43698228 TGTTGGCCTCTGCTGTTGACCGG - Intronic
949353350 3:3149544-3149566 AGAGGTACTATGCTACTGACAGG + Intronic
954905119 3:54055022-54055044 ACTTGTGCTCTCCGGCTGACCGG + Intergenic
955760357 3:62273603-62273625 AGTTTAATTCTGCTGCTAACAGG - Intronic
957889844 3:86342705-86342727 ATGTGTACTCTGCTGCTGTTGGG + Intergenic
963558801 3:146833688-146833710 AATTGCCCTCTGCTGCTGAGTGG - Intergenic
963746043 3:149126140-149126162 AGTGATACAATGCTGCTGACGGG + Intergenic
968547600 4:1206753-1206775 GTTTGTTCTCTGCTGCTGGCGGG - Intronic
969924901 4:10576400-10576422 AGTTGTTCTCTGGAGCTGTCTGG - Intronic
970823982 4:20252186-20252208 AGTTGTTCGCTGGGGCTGACTGG - Intergenic
977783787 4:101009128-101009150 CATTGTACTGTGCTGCTGATGGG + Intergenic
980192710 4:129545061-129545083 AGTTGGACTCTGCTGCTGATAGG - Intergenic
980629642 4:135415193-135415215 ATTTGGTCTCTGCTGCTGGCAGG - Intergenic
982301026 4:153879694-153879716 TGTTGTTCTCTGCTGTTGGCAGG - Intergenic
982846863 4:160264177-160264199 GGTTGTACTCTGCTTTTGCCAGG + Intergenic
983018739 4:162647900-162647922 ACTTGTACACTGCTGCTGGAAGG - Intergenic
987646279 5:20676363-20676385 TGTTGGACTCTGCTACAGACTGG + Intergenic
990798719 5:59574525-59574547 AATTCAACTCTGATGCTGACTGG - Intronic
991470616 5:66965082-66965104 AGTTCTACTCTTCTGCTGATGGG + Intronic
991583907 5:68183404-68183426 TGTTGTCCTCTGCTGCACACTGG + Intergenic
995030973 5:107481122-107481144 AGTTAGACTCTCCTGCTGACAGG + Intronic
997161046 5:131609647-131609669 GGTTGGTCTCTGTTGCTGACAGG - Intronic
997179654 5:131814907-131814929 TGTTGTTGTCTGCTGCTGACTGG - Intronic
1001924611 5:175627154-175627176 CCTGGTGCTCTGCTGCTGACTGG + Intergenic
1002653002 5:180717239-180717261 AGTTGTAGTTTGCTGGTGCCAGG + Intergenic
1003502265 6:6712422-6712444 AGTGGTACCCTGCTGGTGGCTGG - Intergenic
1006527272 6:34617653-34617675 AGCGGTACTCTGCTGCTGGTGGG - Intronic
1007428033 6:41759786-41759808 AGTGGCACACTGCTGCTCACAGG - Intergenic
1010618077 6:78038589-78038611 ATTAGGACTCTGCTGCTTACTGG - Intergenic
1019025095 6:168954386-168954408 AGATATACTTTGCTGCTGTCTGG - Intergenic
1021776116 7:24057041-24057063 AGTTGGTCTTTGTTGCTGACAGG + Intergenic
1022312098 7:29206921-29206943 AGTTGTCCCCTGCGGCTGAGAGG + Intronic
1023716052 7:43045478-43045500 TGCTGTACTCAGCTGCTGGCTGG - Intergenic
1024696158 7:51858688-51858710 TGTTGTCCTCTGCTGATAACAGG - Intergenic
1035120391 7:156561877-156561899 AGTTGTTGTCTGCTTCTGTCTGG - Intergenic
1038618436 8:29117106-29117128 AGTAGAACTTTGCTGGTGACTGG - Intronic
1042849821 8:73205461-73205483 AATTGGACTCGGCTGCTTACAGG + Intergenic
1043955390 8:86353318-86353340 AGATCTACTCTTCTGATGACAGG - Intronic
1044004592 8:86925966-86925988 AGTTGTTTGCTGCTGCTGGCTGG + Intronic
1044077280 8:87837969-87837991 GGTTGTTCTTTGCTGCTAACAGG + Intergenic
1046323316 8:112606569-112606591 ATGTGTACTCTGCTGCTGATGGG - Intronic
1049386660 8:142346201-142346223 TTTTGTACTTTGTTGCTGACTGG - Intronic
1053277382 9:36793791-36793813 TGTTGTGCTCTGCTGCTCCCAGG + Intergenic
1057559925 9:96119328-96119350 ATTTGTTCTCTGCTGCTCCCTGG + Intergenic
1060805004 9:126569781-126569803 TGTTAGTCTCTGCTGCTGACAGG + Intergenic
1060833807 9:126739646-126739668 TGTTGGTCTCTGCTGCTGGCAGG + Intergenic
1060922130 9:127428584-127428606 ATTTGCACACTGCTGCTGAGTGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1190601397 X:52096607-52096629 TGTTGGTCTCTGCTGCTGGCAGG + Intergenic
1193675982 X:84453464-84453486 CATTGTTCTCTTCTGCTGACAGG - Intronic
1195419623 X:104659407-104659429 AGTTGTACCCAGTTGCTAACAGG + Intronic
1196230987 X:113221020-113221042 ACTTGTCCTCAGCTGATGACTGG + Intergenic
1199347678 X:146761087-146761109 AGGTCTACTCTGCTGCTGAGAGG - Intergenic
1202304816 Y:23457762-23457784 ATTTGTCCTCAGCTGCTGCCTGG - Intergenic
1202565994 Y:26212829-26212851 ATTTGTCCTCAGCTGCTGCCTGG + Intergenic