ID: 1096325960

View in Genome Browser
Species Human (GRCh38)
Location 12:50662239-50662261
Sequence TACCCAGAGATCCCCAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096325960_1096325962 7 Left 1096325960 12:50662239-50662261 CCTGTTCTGGGGATCTCTGGGTA 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1096325962 12:50662269-50662291 AGAAGGCTTCATGTGCTGTGAGG 0: 1
1: 0
2: 1
3: 20
4: 217
1096325960_1096325963 8 Left 1096325960 12:50662239-50662261 CCTGTTCTGGGGATCTCTGGGTA 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1096325963 12:50662270-50662292 GAAGGCTTCATGTGCTGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 230
1096325960_1096325961 -10 Left 1096325960 12:50662239-50662261 CCTGTTCTGGGGATCTCTGGGTA 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1096325961 12:50662252-50662274 TCTCTGGGTAGTATCTGAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096325960 Original CRISPR TACCCAGAGATCCCCAGAAC AGG (reversed) Intronic
900563043 1:3317493-3317515 AACCCAAAGATCCCCAGACCTGG - Intronic
901816252 1:11795064-11795086 GGCCCAGAGATCCCCAGAGGAGG - Intronic
903151735 1:21414718-21414740 TCCACAGAGATCCCAAGGACAGG - Intergenic
905309963 1:37042497-37042519 CTCCCAGAGCTACCCAGAACTGG + Intergenic
908360129 1:63360884-63360906 TTTCCAGAGAGCCCTAGAACTGG - Intergenic
909746877 1:79108439-79108461 TACCCAGAGATCCCCACACCTGG + Intergenic
912629515 1:111234506-111234528 TAGCCAGAAACCCCCAGACCTGG - Intronic
916425139 1:164673292-164673314 TAACCAGTGCTCCCCAGAAAGGG + Intronic
916542270 1:165768543-165768565 TGCCCAGAGATTCCCTGAAGTGG + Intronic
917038008 1:170770520-170770542 TTCCCAGAGATTCACAGAGCTGG - Intergenic
917188274 1:172386856-172386878 AACCCAGCCATCACCAGAACAGG - Intronic
921059808 1:211576268-211576290 GACCCAGAAAACCCCAGAAGTGG - Exonic
922720358 1:227897062-227897084 CACCCAGAGTCCCCCAGCACTGG + Intergenic
922963318 1:229666497-229666519 CACCCAGAGAATCCCAGAAGTGG - Intergenic
923087393 1:230711965-230711987 TACCCTGAGACCCCCAGAAGAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1065170607 10:23023170-23023192 TTCACAGAGAGTCCCAGAACGGG + Intronic
1066299851 10:34087054-34087076 TGCCCAGGGAGCCCCAAAACGGG + Intergenic
1069848859 10:71392037-71392059 TGCCCAGGGATCTCCAGAAGCGG - Intergenic
1069878753 10:71578864-71578886 TACCCCCACATCCCCAGAACTGG + Intronic
1070729088 10:78812900-78812922 GAGACAGAGATCCCCAGAAATGG + Intergenic
1071551088 10:86566732-86566754 TACTCAGAAATCCCCAGGCCTGG - Intergenic
1071559383 10:86633163-86633185 TACTCAGAGATCCCCAGGCCTGG + Intergenic
1073596284 10:104803653-104803675 AACCCAGAGATAGCCAGAAAGGG - Intronic
1073755083 10:106572778-106572800 TACCCAGATCTCTCCAGCACAGG + Intergenic
1074271798 10:111961286-111961308 TAGCCAGAGATTGCCATAACTGG - Intergenic
1077246169 11:1539917-1539939 TCTCCAGAGATGCCCAGAAATGG - Intergenic
1077546040 11:3170484-3170506 TGCCCAGAGGTCCCCAAAGCTGG + Intergenic
1080762216 11:35262606-35262628 GACCCAGATATCCTCAGAAAGGG + Intronic
1081725036 11:45322003-45322025 TATCCAGAGATCCCTAGAACAGG - Intergenic
1081852106 11:46281140-46281162 TTCTCAGAGATCCTCAGAAGGGG + Intronic
1081978992 11:47254548-47254570 GACTCAGAGATACCCAGACCAGG + Intronic
1082732259 11:56814342-56814364 CACCCAGAGATCTCCAGCACTGG + Intergenic
1083296744 11:61719097-61719119 TCCCCAGAGATACCCATAAAGGG - Intronic
1089282023 11:117381381-117381403 TCCCCAGAGCTCACCAGCACTGG - Intronic
1089735144 11:120545781-120545803 TATCCAAAGATCCCTAAAACTGG - Intronic
1090079576 11:123603009-123603031 TGCCCAGAGGTCCCCTGACCCGG - Intronic
1091972145 12:4796580-4796602 TGCCCAGAGACCCTCAGAAATGG + Intronic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1099545921 12:83979412-83979434 TACACAGATATGCACAGAACTGG + Intergenic
1106218698 13:27726120-27726142 AGCCCAGAGATTCCCAGAGCAGG - Intergenic
1106455953 13:29927028-29927050 TAACCAGGGATCCCTAGATCTGG + Intergenic
1110937185 13:81305627-81305649 TATCCAGAGAACCAGAGAACTGG + Intergenic
1113730468 13:112637748-112637770 TGTCCAGATATCCCCATAACTGG + Intergenic
1116416893 14:44688993-44689015 TAACCAAAAATCCCCAGGACAGG + Intergenic
1117544411 14:56780567-56780589 AACCCAGAGATTCTCAGAAGAGG - Intergenic
1121085032 14:91139387-91139409 TACCCAGAAATAACCAGACCGGG + Intronic
1121586172 14:95064498-95064520 TACCCAAGGATCCCCAGGCCTGG - Intergenic
1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG + Intronic
1124610083 15:31202177-31202199 CATCCAGAGATCAGCAGAACTGG + Intergenic
1125888008 15:43243313-43243335 AACTCAGAAATCACCAGAACAGG - Intronic
1127907327 15:63385554-63385576 TCTCCAGAGATCCCCAGAGATGG + Intergenic
1128241986 15:66107552-66107574 TCCCCACAGAGCCCCAGAGCAGG + Intronic
1128759019 15:70202703-70202725 CAGCCAGAGCTGCCCAGAACAGG - Intergenic
1134747788 16:16601310-16601332 AAGCCAGAGCTCCTCAGAACAGG - Intergenic
1134997680 16:18752353-18752375 AAGCCAGAGCTCCTCAGAACAGG + Intergenic
1137019094 16:35405925-35405947 CACACAGAGGTCCCCAGAGCTGG + Intergenic
1138385415 16:56632805-56632827 AACCCAGAGACCCTCAGTACTGG - Intronic
1138385986 16:56635892-56635914 AACCCAGAGACCCTCAGTACTGG - Intergenic
1141156612 16:81601488-81601510 CCCCCAGAGATCTTCAGAACTGG - Intronic
1141257970 16:82421218-82421240 TATTAAGAGATACCCAGAACAGG - Intergenic
1141663179 16:85452705-85452727 AACCCAGAGACCCTCAGCACAGG + Intergenic
1141989898 16:87603584-87603606 TCCCCAGAGATCCACAGAAGGGG - Intronic
1142215409 16:88827309-88827331 CACCCAGAGAGCTCCAGGACAGG + Intronic
1142731446 17:1861179-1861201 TACACAGAGAACTCCAGAAATGG - Intronic
1143082803 17:4394174-4394196 GACCCAGAGATCCTCAGAGGTGG + Intergenic
1145759979 17:27420392-27420414 CACCGTGAGATGCCCAGAACTGG - Intergenic
1146844436 17:36174179-36174201 CACCGTGAGATGCCCAGAACGGG + Intronic
1146856740 17:36262114-36262136 CACCGTGAGATGCCCAGAACGGG + Intronic
1146863877 17:36326261-36326283 CACCGTGAGATGCCCAGAACGGG - Intronic
1146872650 17:36386025-36386047 CACCGTGAGATGCCCAGAACGGG + Intronic
1146880009 17:36437110-36437132 CACCGTGAGATGCCCAGAACGGG + Intronic
1147066736 17:37926849-37926871 CACCGTGAGATGCCCAGAACGGG - Intronic
1147075535 17:37986649-37986671 CACCGTGAGATGCCCAGAACGGG + Intronic
1147078268 17:38006410-38006432 CACCGTGAGATGCCCAGAACGGG - Intronic
1147087060 17:38066195-38066217 CACCGTGAGATGCCCAGAACGGG + Intronic
1147094206 17:38130345-38130367 CACCGTGAGATGCCCAGAACGGG - Intergenic
1147103005 17:38190158-38190180 CACCGTGAGATGCCCAGAACGGG + Intergenic
1147640468 17:41995118-41995140 TTGCCAGAGAGCCCTAGAACTGG - Intronic
1149847578 17:60016625-60016647 CACCGTGAGATGCCCAGAACGGG + Intergenic
1151700601 17:75740680-75740702 TACCCAGAGATCCTCAGGGTTGG - Intronic
1160845081 19:1162700-1162722 TCTCCAGAGCTCCCCAGAGCTGG + Intronic
1161021435 19:2013418-2013440 AACCCAGAGACCCCCAGCTCCGG - Intronic
1162248778 19:9425322-9425344 TACTCACAGATCCCCAGGATGGG - Intronic
1163409094 19:17142235-17142257 TGACCTGAGATACCCAGAACAGG + Intronic
1163451439 19:17379557-17379579 CACCCAGAGCCCCCCAGAGCTGG + Intergenic
1164841496 19:31396474-31396496 TAGCCAGACAGCCCCACAACAGG + Intergenic
1165410638 19:35658712-35658734 TACCCAGTGATCCCCACCCCAGG + Exonic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1166729911 19:45053089-45053111 TCCCTAAAGCTCCCCAGAACAGG + Exonic
925112367 2:1347209-1347231 TACCCAGGCATCACCATAACAGG + Intronic
926558089 2:14382969-14382991 TACAAAGAGATTCTCAGAACTGG + Intergenic
928405576 2:31011917-31011939 TCTCCAGAGATCCACAGCACTGG + Intronic
928571184 2:32610495-32610517 CACACAGAAATCCCCAGAAATGG - Intronic
931700272 2:64903521-64903543 TCCTCAGAGATCCCCCAAACTGG - Intergenic
931844076 2:66184744-66184766 TACCCAGAGATCCAGAGGAAAGG + Intergenic
934851061 2:97701512-97701534 CACCCAGGGATCCCCAAACCCGG - Intergenic
936724144 2:115291949-115291971 TAATCAGAGAAACCCAGAACTGG + Intronic
937832365 2:126437802-126437824 TACCCACAGATCCCAAGAGAAGG + Intergenic
940189224 2:151021425-151021447 TACACAGAGATACACAGAAGAGG + Intronic
941865317 2:170328254-170328276 TACCCAGGGATACCCACCACTGG + Intronic
943417976 2:187631860-187631882 TACCCAGAGGTCCCTCAAACTGG + Intergenic
943540258 2:189204883-189204905 TACCAGGAGATCCCAAGACCTGG - Intergenic
948302219 2:236915960-236915982 TACCCAGAGTTTCCGAGAATTGG - Intergenic
948804352 2:240447047-240447069 CACCCAGGGATGCCCAGAAGGGG + Intronic
949067409 2:242001599-242001621 GACACAGAGGTCCCCAGAGCAGG - Intergenic
1169286080 20:4308363-4308385 TAGCCAGATATCCCCAGAGCAGG - Intergenic
1172334214 20:34100457-34100479 TATCTAGAGATCCCCAGATAAGG + Intronic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1178617039 21:34143596-34143618 TTTTCAGAGATTCCCAGAACCGG - Intergenic
1182767240 22:32766341-32766363 TACCAAGAAATTCCCAGCACTGG + Intronic
1183112478 22:35660613-35660635 TATCCAGAGATCCACAGTTCTGG + Exonic
1185109236 22:48891634-48891656 TCCTCAGAGATCCCAAGAAATGG - Intergenic
950801344 3:15554165-15554187 TACTCAGAGTTCCCAAGAAGAGG - Intergenic
954706350 3:52482818-52482840 TACCCAGAGCTCCACAGAGGTGG + Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
960884717 3:122382925-122382947 TACCCAGAGCTTCCCAGACAAGG + Intronic
961321734 3:126081950-126081972 TACCTAGAGAGCCCCAGCCCTGG + Intronic
961769825 3:129240863-129240885 TGCCCTCAGATCCCCAGACCAGG + Intergenic
961816066 3:129551033-129551055 TACCCAGAGCCACCCAGAGCTGG + Intronic
963085392 3:141430964-141430986 GTCCCAGAGTTCCCCAGGACAGG - Intronic
967445722 3:189564256-189564278 TACCCAGAGATGCCAAAAAAAGG - Intergenic
967673831 3:192272000-192272022 TTCCCAGAAAACCCTAGAACTGG - Intronic
969723946 4:8908233-8908255 TCCTCAGAGATCCCCAGTTCAGG + Intergenic
970261236 4:14227090-14227112 TACTCATAGATCCCAAGAAGCGG - Intergenic
970974431 4:22026948-22026970 TAACCATAGAACCACAGAACAGG + Intergenic
971602582 4:28614134-28614156 TCCCCAGATATCTGCAGAACTGG - Intergenic
972639222 4:40910632-40910654 TATACAGAGGTCCACAGAACAGG - Intronic
975769990 4:77710429-77710451 TACCCAAATATCCCCAGCCCAGG - Intergenic
975827507 4:78335224-78335246 TGCCCAGCAATCCTCAGAACTGG - Intronic
979378858 4:119984503-119984525 TACTCATAGATCCCTAGAAACGG + Intergenic
989217403 5:38919476-38919498 TTTCCAGAGATCATCAGAACTGG + Intronic
994606749 5:101977162-101977184 TACTCAGACATGCCCAGACCTGG - Intergenic
998175902 5:139902022-139902044 TATCCAGAGACCCACAGAAAGGG + Intronic
999124304 5:149235726-149235748 TACCCACACACCCCCAGAACTGG + Intronic
999437999 5:151579133-151579155 CAACCAGAGAGCCCCAGAATTGG - Intergenic
1000676836 5:164131898-164131920 GTTCCAGAGATCCCCAGAACAGG - Intergenic
1001408468 5:171493812-171493834 CACCCAGAGAGCACCAGAACTGG - Intergenic
1005454467 6:26005914-26005936 TTTGAAGAGATCCCCAGAACTGG - Intergenic
1005807552 6:29488603-29488625 TACCCAAGGATGCCCAGGACTGG - Intergenic
1006603272 6:35239537-35239559 TGGCCACAGATCCCCTGAACAGG + Intronic
1014199320 6:118590818-118590840 TACCAAGAAACACCCAGAACTGG - Intronic
1014214422 6:118738903-118738925 TACACTGGGATCCCCAGGACTGG - Intergenic
1014293371 6:119587683-119587705 TTCCCAGCAATTCCCAGAACAGG + Intergenic
1016322099 6:142857602-142857624 TAACCAGTGATGCCCAAAACTGG - Intronic
1016521289 6:144950026-144950048 TGCCTAGAAATCCCCAGGACAGG + Intergenic
1017352363 6:153457614-153457636 TTACAAGAGATCCCCAGAAGTGG - Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1021725980 7:23548472-23548494 TTACCTGAAATCCCCAGAACAGG - Intergenic
1023621341 7:42076359-42076381 TTCCTTGTGATCCCCAGAACAGG + Intronic
1024604770 7:51014354-51014376 TACGCAGAGATGCCTAGAGCAGG + Intergenic
1026564213 7:71476437-71476459 TACTCACAAATCCCCTGAACAGG + Intronic
1028763294 7:94520312-94520334 TACCCAGACATACCCATACCAGG - Intronic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1034840584 7:154391774-154391796 TACCCAGAGAACCCTACATCAGG - Intronic
1034888774 7:154820632-154820654 TTCCCAGAGGACCCAAGAACTGG + Intronic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1038257118 8:25960142-25960164 GACTCAGAGATCCCTAAAACTGG - Intronic
1039096598 8:33893659-33893681 TACTCAGAGATTCCCAGAGCTGG + Intergenic
1039465979 8:37785311-37785333 TACACAGAGATACACAGATCCGG + Intronic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1042803570 8:72747082-72747104 TACTCACAGATCCCTAGAAATGG + Intronic
1045324670 8:101109295-101109317 TGACCCGAGACCCCCAGAACTGG - Intergenic
1046907681 8:119591647-119591669 AACCCAGAGTACCCCAGATCTGG + Intronic
1047698562 8:127427951-127427973 TTCCCAGATATCCACAGAGCTGG - Intergenic
1050222239 9:3405915-3405937 TACCCACAGTTCCCCAAACCTGG + Intronic
1052411543 9:28128062-28128084 TAACCAGAGCTTTCCAGAACAGG - Intronic
1052968818 9:34363868-34363890 GACTGAGAGCTCCCCAGAACGGG + Intergenic
1057728894 9:97591487-97591509 TTCCCTGACATCCCCAGCACAGG - Intronic
1060554140 9:124499730-124499752 TACTGAGAGAGCCCCAGAATAGG + Intronic
1062037210 9:134387781-134387803 AGCCCAGAGATGCCCAGGACAGG - Intronic
1186511256 X:10131415-10131437 CACCCAGATATACCCAGAAGCGG - Intronic
1188516529 X:30993473-30993495 AAACCAGAGATCCCCAATACAGG - Intergenic
1190712233 X:53079246-53079268 GCCCAAGAGAGCCCCAGAACTGG + Exonic
1191865621 X:65701400-65701422 GGCCCAGAGATCCCCATGACAGG - Intronic
1195329318 X:103784219-103784241 GTCCCTGAGATCCCCAGACCTGG - Intronic
1197069225 X:122273938-122273960 TACCCAGAAGTCACCAGACCTGG + Intergenic
1198263231 X:134985257-134985279 TTCCCAGCTATCCCCAGAAGAGG - Intergenic
1200040505 X:153362632-153362654 CACCCACAGATCCCCAGAAGTGG + Intergenic