ID: 1096327600

View in Genome Browser
Species Human (GRCh38)
Location 12:50678693-50678715
Sequence CCCAACCAGCCCAAGCCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096327593_1096327600 1 Left 1096327593 12:50678669-50678691 CCTGGTACAGTACCTCAGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1096327600 12:50678693-50678715 CCCAACCAGCCCAAGCCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096327600 Original CRISPR CCCAACCAGCCCAAGCCGGA GGG Exonic
900462224 1:2807157-2807179 CTCATCCAGCCCAAGCCGCGTGG - Intergenic
900487580 1:2930706-2930728 CCCACCCAGCGCCAGCCGGGAGG + Intergenic
902059290 1:13628695-13628717 CCCATCCAGCCCATCCCAGATGG + Intergenic
904744342 1:32702134-32702156 CCCACCCATCCCAGGCCAGACGG + Intronic
908296137 1:62715249-62715271 AGGAACCAGCCCAAGCCAGAGGG - Intergenic
909552921 1:76919261-76919283 GCCAAGCAGCCCAAGACGGGAGG - Intronic
909741843 1:79038628-79038650 CCTACCCAGCCCAAGTTGGAAGG - Intergenic
909850997 1:80463855-80463877 ACAAGCCAGCCCAAGCTGGAGGG + Intergenic
912036755 1:105325618-105325640 TTAAACCAGCCCAAGCCAGATGG - Intergenic
915898011 1:159826400-159826422 TCCAGCCATCCCAAGCCAGAAGG - Intergenic
916476088 1:165170330-165170352 CCCATCAACCCCAAGCCTGAGGG + Intergenic
916676421 1:167067470-167067492 CCCAACCAGGGCCAGCCAGAAGG - Intronic
917920282 1:179744407-179744429 CCCACCCAGGCCAGGCCGGGTGG - Intronic
922541153 1:226420966-226420988 CCCAAACAGACCAAGACAGATGG - Intergenic
922798936 1:228355308-228355330 CCCTCCCAGCCCAAGCCAGCTGG - Intronic
923542519 1:234898805-234898827 GACAACCAGCACAAACCGGAAGG + Intergenic
1062805194 10:414074-414096 CCGAACCAACCAAAGCCGGAGGG - Exonic
1064218158 10:13417681-13417703 ACCAACCAGACCCAGCCTGAAGG - Intergenic
1070311792 10:75279143-75279165 CACAGCCAGCCCAGGCCTGATGG - Intergenic
1070599774 10:77857465-77857487 CCCAACCAGCCCAGGCGTGCAGG + Intronic
1071869853 10:89781665-89781687 TCAAACCAGCCCTAGCCAGAGGG - Intergenic
1072083502 10:92056532-92056554 TTAAACCAGCCCAAGCCTGAGGG + Intronic
1073633921 10:105177805-105177827 GACAAACAGCCCAAGCAGGAGGG - Intronic
1076783165 10:132735591-132735613 CCCCACCAGCCCAGGACCGAGGG - Intronic
1080865686 11:36192817-36192839 CCAAACCAGCCAAAGCCTCAGGG + Intronic
1083238476 11:61368087-61368109 CACAACCATCCCAAGCCAGCTGG - Intronic
1084425323 11:69081135-69081157 CCCAGCCAGCCCTTGCGGGAAGG - Intronic
1090356049 11:126140939-126140961 CCCAACCATCCCAGCCCGGCTGG + Intergenic
1090480297 11:127061872-127061894 CCCCACCAGCCCAAGGAGGCAGG - Intergenic
1091730566 12:2877266-2877288 CCTTACCAGCCCGGGCCGGACGG - Exonic
1095573728 12:43710680-43710702 TCCAATCAGCCCTAGCCAGAGGG - Intergenic
1096327600 12:50678693-50678715 CCCAACCAGCCCAAGCCGGAGGG + Exonic
1097791237 12:63817764-63817786 TTCAACCAGCCCTAGCCAGAGGG + Intergenic
1102497079 12:113327153-113327175 CCCACCCAGCACAAGGAGGAAGG + Intronic
1106651985 13:31701033-31701055 CCCAGCCAGACCAAGCCTTATGG + Intergenic
1106964182 13:35039061-35039083 CTCAACCAGCCCTAGCCAGAGGG - Intronic
1118985671 14:70752689-70752711 CCCAACCAGACAAAGACAGACGG + Intronic
1122158788 14:99768011-99768033 GCCCACCAGCCCAAGGCAGATGG - Intronic
1128062061 15:64741490-64741512 CCCAATCAGCCCAATCCAAATGG + Intronic
1129384153 15:75186280-75186302 CCCAGCCACCCCAAGCCTGAAGG - Intergenic
1130837328 15:87663742-87663764 CAGAGCCAGCCCGAGCCGGATGG - Intergenic
1132059634 15:98681596-98681618 ACCAACCACCCCAGGCAGGAGGG - Intronic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1132859278 16:2062032-2062054 CCCCACCAGCCAAAGCCCAAAGG - Intronic
1144140278 17:12341245-12341267 CCCACCCAGCCCAACCCCCACGG - Intergenic
1148021209 17:44555222-44555244 CCCAGCCACCCCAAGGCAGATGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148846812 17:50534355-50534377 CCCACACAGGCCAGGCCGGAGGG + Intronic
1148945515 17:51259621-51259643 CCCAACGAGTCCAAGGCTGACGG + Intronic
1151734109 17:75928075-75928097 CCCAACCACCCCAAGCCTGCAGG - Exonic
1152168254 17:78724787-78724809 CCCAGCCAGCCCAACCCCCATGG - Intronic
1152615783 17:81337179-81337201 CCCATCCAGCCCAGGCCACACGG + Intergenic
1152770283 17:82163326-82163348 CCCAAGCTGGTCAAGCCGGAGGG - Exonic
1157121715 18:44917615-44917637 CCCATCCACCCCCAGCAGGAGGG + Intronic
1157158357 18:45289270-45289292 CCCCACCAGCCCAAGGTGGGAGG + Intronic
1159482215 18:69004274-69004296 ACCAACCAGCCCAGGTCAGAGGG + Intronic
1162022023 19:7872417-7872439 CCCTCGCAGCCCAAGCCGAAAGG - Exonic
1164825565 19:31282575-31282597 CCAAACCAGCCCAGGCCGTCCGG + Intronic
1166107027 19:40602501-40602523 CCCAGCCAGCCCAGCCCGGCCGG + Intronic
1167145378 19:47678466-47678488 CCCATCCAGCCCAAGCCCGCGGG - Intronic
1167145753 19:47680218-47680240 CCCATCCAGCCCAAGCCCGCGGG + Exonic
1167306485 19:48713049-48713071 CCCAACCATACCACGCCGGAGGG + Exonic
1167915796 19:52739373-52739395 CCCAACCTGTCCCAGCCTGAGGG + Intergenic
927309881 2:21618094-21618116 TCAAACCAGCCCTAGCCAGAGGG - Intergenic
929551743 2:42897687-42897709 CCTAACTAGGCCAAGCAGGATGG - Intergenic
932572745 2:72946455-72946477 CCCAGCCAGACCAAGCCCCAAGG - Intronic
934614576 2:95763184-95763206 CCCACCCAGCCCAGGAAGGATGG + Intergenic
934780537 2:96966981-96967003 CCCCAACAGACCAAGACGGATGG + Intronic
936030004 2:109063151-109063173 CCCAACAGGCACAAGCCAGAGGG - Intergenic
939447480 2:142328936-142328958 ACCGACCAACCCAAGCTGGAAGG + Intergenic
944955013 2:204798632-204798654 CCCAACCTCCTCAAGCAGGATGG - Intronic
947023560 2:225711352-225711374 CCTAACCAGCCCCACCCTGAGGG - Intergenic
948662384 2:239515388-239515410 CCCAGCCAGCCCCATCCAGAGGG + Intergenic
1170284966 20:14696869-14696891 CTCAACCAGCCCAGTACGGAAGG - Intronic
1173725383 20:45293649-45293671 CCCCGACAGCCCAAGCCGGACGG + Exonic
1174453829 20:50636078-50636100 CCCCACCAGGCCCAGCCGGGAGG - Intronic
1176047539 20:63100639-63100661 CCCAGCCACCCCCAGCAGGATGG - Intergenic
1176150651 20:63589087-63589109 GCCAAGCAGCCCAAGCTGAAGGG + Exonic
1178498933 21:33109989-33110011 CCTAACAAGCCCAAGCTTGATGG - Intergenic
1179212898 21:39340683-39340705 CCCAACCTTCCCACCCCGGACGG - Intergenic
1180241661 21:46511431-46511453 CCAAATCAGCCAAAGCCTGAGGG + Exonic
1181027245 22:20133122-20133144 CCCACCCAGCCCCAGCCTGCAGG - Intronic
1181559611 22:23692507-23692529 CCCAACGAGGCCAAGCCAGATGG + Exonic
1184369056 22:44070998-44071020 CCCCACCAGGCCAAGGCGGGCGG - Intronic
1184685571 22:46095258-46095280 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685586 22:46095299-46095321 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685601 22:46095340-46095362 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685629 22:46095419-46095441 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685660 22:46095501-46095523 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685675 22:46095542-46095564 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685719 22:46095661-46095683 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685734 22:46095702-46095724 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685763 22:46095780-46095802 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685778 22:46095821-46095843 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685793 22:46095862-46095884 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184993546 22:48186280-48186302 CCCCACGAGCCCAGGCAGGAGGG + Intergenic
951904194 3:27688141-27688163 TTCAACCAGCCCTAGCCAGAGGG + Intergenic
953979845 3:47408080-47408102 CCCCACCACCCCAGGCGGGAAGG - Intronic
956389856 3:68759858-68759880 CCCACCCAGACAAAGCCAGAAGG - Intronic
956889530 3:73598572-73598594 CCCAACAAGCCCAGGGCAGATGG + Intronic
961837377 3:129674264-129674286 TCCAAACAGCCCAAGTAGGACGG - Intronic
962928643 3:140017649-140017671 CCCAACCATCCAAAGGCTGATGG - Intronic
966451958 3:180073389-180073411 TTAAACCAGCCCAAGCCAGAGGG + Intergenic
966908041 3:184541992-184542014 TCCAACCAGCCAAAGCGGGGAGG - Intronic
969193564 4:5543277-5543299 ACCATCCACCCCAAGCCGGCAGG + Intronic
969259560 4:6024824-6024846 CCTGGCCAGCCCAAGCCGTAAGG - Intergenic
995262659 5:110123313-110123335 TTAAACCAGCCCAAGCCAGAGGG - Intergenic
997346530 5:133196298-133196320 CCCAGGCAGCCCCAGACGGATGG - Intergenic
998153154 5:139768747-139768769 CCCATCCAGCCCAGGAGGGAGGG - Intergenic
999883143 5:155889852-155889874 CCCAACCAGCCCAAGGAATAGGG - Intronic
1002417854 5:179130154-179130176 CCCGACCAGCCCAAACCAGTGGG - Intronic
1006520816 6:34570130-34570152 CCCCACCAGCCCCTGCCGGCTGG + Intergenic
1007059156 6:38921369-38921391 GCCAACCTGGCCAAGCAGGAAGG + Exonic
1007284596 6:40738395-40738417 CCCAGGGAGCCCCAGCCGGAGGG - Intergenic
1010502570 6:76618685-76618707 CCCAACCAGCCCTAGCAAGCAGG - Intergenic
1014215029 6:118745170-118745192 CCCACCCAGCCCAGGGCAGAGGG + Intergenic
1015171587 6:130260711-130260733 TCCAACCAGCCCAAGCCATGCGG + Intronic
1019721250 7:2572942-2572964 CCCAACCAGTAAAAGCAGGAAGG - Intronic
1022139680 7:27482407-27482429 CCAAACCAAACCAAGCCAGAGGG + Intergenic
1022344287 7:29499311-29499333 CCCAAACTGCCCAAGGAGGAAGG + Intronic
1024034625 7:45496830-45496852 TCCACCCAGCCCAAGCCCCACGG - Intergenic
1024170186 7:46777427-46777449 TTCAACCAGCCCTAGCCAGAGGG + Intergenic
1026847566 7:73706359-73706381 CCAAAATAGCCCAGGCCGGATGG + Intronic
1027226741 7:76248366-76248388 CCCAACCAGACCAAGCCACCTGG - Intronic
1032385697 7:131521793-131521815 CCCAGCCAGCCCCACCCGCAAGG - Intronic
1037959170 8:23083737-23083759 CCCCAGCAGGCCAAGCCTGAAGG - Intergenic
1040397749 8:47015574-47015596 TTAAACCAGCCCTAGCCGGAGGG - Intergenic
1040820677 8:51553171-51553193 CTCAAGCAGCCCAAGCCCTATGG + Intronic
1040964010 8:53065691-53065713 CCCACCCAAGCCAAGCCTGAGGG + Intergenic
1046448413 8:114356635-114356657 CTAAACCAGCCCTAGCCAGAGGG + Intergenic
1048590543 8:135817008-135817030 ACCAACCAGTCCAAGTCTGAAGG - Intergenic
1049599023 8:143498671-143498693 ACCAAGCAGCCCAAGGGGGATGG + Intronic
1050122093 9:2317855-2317877 CTAAACCAGCCCTAGCCAGAGGG - Intergenic
1056211557 9:84369427-84369449 TCAAACCAGCCCTAGCCAGAGGG - Intergenic
1061666202 9:132162142-132162164 CCCACCCAGCGCCAGCCCGAGGG + Exonic
1062429696 9:136521461-136521483 CCCACCCTGCCCAAGGCGGGTGG + Intronic
1186471843 X:9827808-9827830 CCCAACCACCCCGACCCGGAAGG - Intronic
1188068984 X:25695841-25695863 TCAAACCAGCCCTAGCCAGAGGG - Intergenic
1191116840 X:56861263-56861285 TTAAACCAGCCCAAGCCAGAGGG - Intergenic
1192432579 X:71122302-71122324 TCCAACCTGCCCATGCCAGAGGG + Exonic
1192714863 X:73628482-73628504 TCAAACCAGCCCTAGCCAGAGGG - Intronic
1194546296 X:95239220-95239242 TTCAACCAGCCCTAGCCAGAGGG + Intergenic
1196684009 X:118495651-118495673 CGCCACCAGCCGAAGCAGGAGGG - Intergenic
1198343875 X:135740924-135740946 CCCATACAGCCCAAGAGGGATGG - Intergenic
1199245971 X:145604564-145604586 TTCAACCAGCCCTAGCCAGAGGG + Intergenic
1199308790 X:146298216-146298238 TTAAACCAGCCCAAGCCAGAGGG - Intergenic
1200064510 X:153498021-153498043 CCCAGCCAGCCCAAGGGGCAGGG + Intronic