ID: 1096332106

View in Genome Browser
Species Human (GRCh38)
Location 12:50722627-50722649
Sequence GTCCCCACCATTACATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096332104_1096332106 27 Left 1096332104 12:50722577-50722599 CCTTATTTACCTAGATACTGAGA 0: 1
1: 0
2: 0
3: 4
4: 133
Right 1096332106 12:50722627-50722649 GTCCCCACCATTACATGCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 121
1096332105_1096332106 18 Left 1096332105 12:50722586-50722608 CCTAGATACTGAGATTTCGTAGA 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1096332106 12:50722627-50722649 GTCCCCACCATTACATGCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096332106 Original CRISPR GTCCCCACCATTACATGCCC AGG Intronic
901130458 1:6959499-6959521 GGCCCCACCATCCCCTGCCCGGG - Intronic
901793165 1:11664861-11664883 TTCCCCACCACAAAATGCCCAGG + Intronic
904035802 1:27557990-27558012 CTCCCCACCCTTACAATCCCAGG + Intronic
904999359 1:34656300-34656322 GTCTCCAGCATGACAAGCCCTGG - Intergenic
907520344 1:55019702-55019724 GTCCCCACCTCCACTTGCCCTGG + Intergenic
907858638 1:58328354-58328376 GTCCTCACCATTATATGCCTGGG + Intronic
908332474 1:63084395-63084417 GTCCTCACTCTTAAATGCCCAGG - Intergenic
909250185 1:73344067-73344089 GTCCCTCCCATCACAGGCCCAGG + Intergenic
912416008 1:109508966-109508988 TACCCCACCAGAACATGCCCGGG - Exonic
912763049 1:112386136-112386158 GCCCCCACCCTTGCATGGCCAGG + Intergenic
914460387 1:147878251-147878273 TTCCCCACCATTGCAGGCCCTGG - Intergenic
915598153 1:156906876-156906898 GTTCCCCCCATTACATACCTGGG - Exonic
915672047 1:157497880-157497902 TTCCCCAGCACAACATGCCCAGG + Intergenic
920748900 1:208655543-208655565 GTCCTCATCATCACATGCCTAGG + Intergenic
922830462 1:228550762-228550784 GTCCCCATCATTACAATGCCTGG + Intergenic
1063216981 10:3933557-3933579 TTCCCCACCCTTACTTCCCCTGG + Intergenic
1064489944 10:15844784-15844806 CTTCCCACCCTTACATGCACTGG + Intronic
1065711424 10:28521932-28521954 ATCCCCACCATTTCTTCCCCTGG - Intergenic
1069786163 10:70989192-70989214 GTCACCTCCATTACATTTCCAGG - Intergenic
1071114725 10:82204638-82204660 CTCTCCACCATTACTAGCCCTGG + Intronic
1072451281 10:95541485-95541507 GTCCCTACCACCTCATGCCCAGG + Intronic
1080436569 11:32250199-32250221 GACCCCACCATTCAGTGCCCTGG + Intergenic
1083085015 11:60134077-60134099 GCCCCTCCCATTACAGGCCCAGG + Intergenic
1084195122 11:67520167-67520189 GTCCCGTCCATTACAGACCCAGG + Intronic
1085000287 11:73027703-73027725 CTCCCCGCCATCACAGGCCCAGG + Intronic
1092849157 12:12611609-12611631 GTCCCCGCCATTCCAGGCCCTGG + Intergenic
1093658042 12:21720313-21720335 GTTCCCACCATTAGATGAGCAGG - Intronic
1096332106 12:50722627-50722649 GTCCCCACCATTACATGCCCAGG + Intronic
1098770167 12:74541219-74541241 GTTCCCACCATCGCATGCCCAGG + Exonic
1104500909 12:129284541-129284563 GTCCCCACAATTCCATGACAAGG + Intronic
1113207963 13:107940479-107940501 GTCCCCACAATCACAGTCCCAGG + Intergenic
1115388160 14:32821856-32821878 GTCTCCTCCATGACATGCGCAGG - Exonic
1118607781 14:67515712-67515734 GTCCCCACAACTACAAGCTCCGG - Intronic
1122353397 14:101110288-101110310 GTCCCCACCAGCACCTTCCCTGG - Intergenic
1127384248 15:58454324-58454346 GTCCCAACCATCACCTTCCCAGG + Intronic
1132702878 16:1229534-1229556 TTCCCCACCCTTCCAGGCCCCGG + Intronic
1133584826 16:7182892-7182914 TTCACAACAATTACATGCCCTGG + Intronic
1133767236 16:8846588-8846610 GACCCCAGCAGAACATGCCCAGG + Intronic
1134197078 16:12167517-12167539 GTAGCCACCATTAATTGCCCAGG + Intronic
1138088382 16:54154508-54154530 GTCCCCACCATGCCCTGCCCTGG - Intergenic
1140901089 16:79368615-79368637 GTCCCCACCAGTAGGAGCCCTGG + Intergenic
1141836133 16:86540867-86540889 GTCCCCAGCAGTGCCTGCCCAGG + Intronic
1142275931 16:89118945-89118967 GTCCACACTGTCACATGCCCGGG + Intronic
1143078709 17:4366145-4366167 GTCCCCACCCTCGCAGGCCCGGG + Intronic
1143446518 17:7013177-7013199 GTCTCCACCTTTACCAGCCCTGG - Intronic
1147238055 17:39072117-39072139 GGCCCCACCTATACCTGCCCTGG + Intronic
1147888400 17:43699930-43699952 GTCCCCACCTGTCCATGCCCAGG + Intergenic
1151945792 17:77319284-77319306 GTCCCCACCAGCACATGGTCAGG - Intronic
1152526473 17:80890777-80890799 CACCCCAGCCTTACATGCCCCGG - Intronic
1152996806 18:415090-415112 GTCACCAGCATTACATACACTGG + Intronic
1154316860 18:13311192-13311214 GTCCCACCCATTACATGTCCTGG - Intronic
1156327140 18:36085107-36085129 GCCCCCACCCTTGCATGGCCAGG + Intergenic
1157806228 18:50659716-50659738 GTCCCCACGATTCCATGGCTGGG - Intronic
1159884404 18:73890677-73890699 TTCCCCACCATTGTATTCCCTGG - Intergenic
1161323370 19:3651597-3651619 GCCCCCACCATTGCAAGCCAAGG + Intronic
1162756156 19:12861362-12861384 GTCCTCACTATGAAATGCCCTGG - Intronic
1163233658 19:16019335-16019357 GCCCTCACCCTGACATGCCCTGG - Intergenic
1164369756 19:27634340-27634362 GTCTCCATCATTACATTGCCTGG + Intergenic
1165343957 19:35232053-35232075 GTCCCTAACATCACCTGCCCAGG + Intergenic
1165724237 19:38101298-38101320 GTCCCCACCGTGGCATCCCCAGG - Intronic
1167505139 19:49867304-49867326 TTCCCCACCATTAACTGCTCCGG + Intronic
925488799 2:4368951-4368973 GTCCCCACAGATACATGCCCTGG - Intergenic
926021215 2:9497106-9497128 CTGCTCACCATTACATGCACAGG + Exonic
928754804 2:34511229-34511251 CCCCCCACCATGACAGGCCCTGG - Intergenic
930626021 2:53698234-53698256 GTCCCTCCCATCACAGGCCCAGG - Intronic
931075788 2:58710128-58710150 GTCCCCACCATTCTCTGCTCAGG + Intergenic
931881257 2:66573879-66573901 CTCCTCTCCAGTACATGCCCGGG + Intergenic
937083911 2:119158358-119158380 CGCCCCACCATTACCTCCCCGGG - Exonic
942083765 2:172426257-172426279 GTCCCAACCTTTTCATGCCATGG + Intergenic
948588313 2:239035002-239035024 GTCCCCACCATGAAAGCCCCTGG + Intergenic
1174118361 20:48243427-48243449 GGCCCCAACATTAAATGCCTGGG + Intergenic
1174264815 20:49323661-49323683 CACCCCACCCTTACAGGCCCAGG - Intergenic
1174651539 20:52129840-52129862 GTCACCACCATGGTATGCCCCGG + Intronic
1175642163 20:60639878-60639900 TTACCAAACATTACATGCCCAGG + Intergenic
1175921763 20:62453488-62453510 CTCCCCACCCTCACATGCCCAGG - Intergenic
1177471343 21:21564066-21564088 GTCCCTCCCATCACCTGCCCAGG - Intergenic
1178488939 21:33035780-33035802 GTTCTCACCTTTGCATGCCCTGG + Intergenic
1178532231 21:33385423-33385445 GTCACCAGCATTAAGTGCCCAGG + Intergenic
1183648940 22:39142802-39142824 GGGTCCACCATTACATGCGCAGG - Intronic
1184032793 22:41904803-41904825 GTCCCCACCCATCTATGCCCAGG - Intronic
1185183024 22:49373881-49373903 GCACCCACCATGAGATGCCCGGG + Intergenic
951089307 3:18553732-18553754 GTCCCCACCTTTTCATAGCCTGG + Intergenic
958894474 3:99814495-99814517 CTCCCCACCATTACTAGTCCTGG - Intergenic
959528853 3:107408900-107408922 GTCCCCACCACTGCTTTCCCTGG + Intergenic
962672882 3:137726837-137726859 GTCCCTCCCATCACAGGCCCAGG - Intergenic
967138063 3:186529258-186529280 GTCCCCCCCATCACATGGCCTGG - Intergenic
970032386 4:11691364-11691386 TTCCCGACCATGACATGGCCAGG - Intergenic
971611462 4:28731437-28731459 GGCCTCTCCATTCCATGCCCAGG - Intergenic
971950015 4:33332660-33332682 GTCTCTTCCATTTCATGCCCAGG + Intergenic
973712802 4:53645855-53645877 ATCCTCACCAATGCATGCCCAGG - Intronic
977803381 4:101265844-101265866 TTCCCCTCTATTACATGACCAGG - Intronic
981654774 4:147100859-147100881 TTCCTCACAATTCCATGCCCCGG - Intergenic
983588826 4:169385057-169385079 CTCCCAACCATTACATTCCTAGG - Intergenic
985640025 5:1059226-1059248 GTGCCCACCCTGACCTGCCCGGG + Intronic
988853214 5:35199276-35199298 GTCCACAGCATTACACGGCCTGG - Intronic
990093466 5:52083443-52083465 GCCCCTCCCATTACAAGCCCAGG - Intergenic
990255820 5:53967767-53967789 TTCCCCAGCATTCCATCCCCTGG - Intronic
991097867 5:62758350-62758372 CGCCCCACCATGACAGGCCCCGG - Intergenic
993661117 5:90636159-90636181 GCCCCCACCCCGACATGCCCTGG + Intronic
994966744 5:106682389-106682411 TTTCCCACCATTATATGCACAGG + Intergenic
996347385 5:122501755-122501777 GTCCCCACCACCACAGGCCCCGG - Intergenic
1002046864 5:176546474-176546496 ATCCTCACCATCACCTGCCCAGG + Intronic
1002381234 5:178831480-178831502 GTGCCCACTATTCCATGCCCAGG + Intergenic
1005690907 6:28304497-28304519 GTACACACCAGTACCTGCCCAGG + Intergenic
1007570711 6:42888625-42888647 ATCCCCACCATTTCTTCCCCTGG + Exonic
1008330566 6:50240165-50240187 GGCTCCACCATCACATTCCCTGG - Intergenic
1011378196 6:86713592-86713614 GATCCCACCATTCCATGCCTAGG - Intergenic
1016429069 6:143964122-143964144 GTCCCCAGCAATAGAGGCCCTGG + Intronic
1020179844 7:5913738-5913760 TTCCCCACCTTTCCAGGCCCAGG - Intronic
1020303092 7:6811146-6811168 TTCCCCACCTTTCCAGGCCCAGG + Intronic
1022015058 7:26342426-26342448 CTCCCCACCAGTAAATGCCATGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1033833019 7:145276269-145276291 GTCCCTCCCATCACAGGCCCAGG + Intergenic
1037324390 8:17673952-17673974 GTCTCCACCAAAATATGCCCAGG - Intronic
1038386547 8:27153455-27153477 CTCCCAACCATTCCATCCCCAGG + Intergenic
1038663437 8:29517005-29517027 GTTCCCACCTTTAAATGCTCAGG - Intergenic
1041084450 8:54243899-54243921 GTCCACACCATCACAGGCCCCGG + Intergenic
1041208885 8:55526265-55526287 GTCCCCACGATGACATCCACAGG + Exonic
1043213134 8:77550769-77550791 GCCCTCTCCAATACATGCCCAGG - Intergenic
1044124195 8:88437589-88437611 GTCGCCACCAGGACTTGCCCGGG - Intergenic
1045630656 8:104117664-104117686 TTGCCCACAATTACATTCCCTGG - Intronic
1047607616 8:126490529-126490551 GTCCCCACCATTCCCTGCCAGGG - Intergenic
1047769903 8:128022220-128022242 GTCCCCACCTTAAAATGTCCTGG - Intergenic
1048878887 8:138857376-138857398 GACCACACCCTTCCATGCCCTGG + Intronic
1050406026 9:5309498-5309520 TTCCCCTACATTCCATGCCCTGG + Intergenic
1050750114 9:8927362-8927384 TTCCCCAACATGACAGGCCCTGG + Intronic
1053544408 9:39008511-39008533 ATCCCCACCATTAACTGTCCTGG + Intergenic
1053808840 9:41831990-41832012 ATCCCCACCATTAACTGTCCTGG + Intergenic
1054621752 9:67355438-67355460 ATCCCCACCATTAACTGTCCTGG - Intergenic
1057858997 9:98624963-98624985 CTCCCCTCCATCACCTGCCCTGG + Intronic
1060314821 9:122499584-122499606 GACCCCACTGCTACATGCCCAGG - Intergenic
1062030129 9:134358461-134358483 GACCTCCCCATTACAGGCCCCGG - Intronic
1185828676 X:3277306-3277328 GTCCACACCATTCCATGCCCTGG + Intronic
1187751534 X:22471005-22471027 ACCCCCACCATTACCTGCTCTGG - Intergenic
1189402874 X:40688672-40688694 ATCCCCATCATTAGATTCCCTGG + Intronic
1194024630 X:88736281-88736303 GTCTCCTCCACTGCATGCCCAGG - Intergenic
1200234634 X:154462325-154462347 GTCCCCACCCCCACATGCCCAGG - Intronic
1201304965 Y:12542265-12542287 GCCACCACCATTTGATGCCCAGG + Intergenic