ID: 1096335197

View in Genome Browser
Species Human (GRCh38)
Location 12:50749938-50749960
Sequence CCATTTTGGAAGTAGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 7, 2: 44, 3: 154, 4: 403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096335194_1096335197 1 Left 1096335194 12:50749914-50749936 CCAGAAGAAGCAGCATTTAAGGT 0: 1
1: 1
2: 5
3: 47
4: 231
Right 1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG 0: 1
1: 7
2: 44
3: 154
4: 403
1096335190_1096335197 30 Left 1096335190 12:50749885-50749907 CCCATGCGAGGACATGGTGTTCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG 0: 1
1: 7
2: 44
3: 154
4: 403
1096335192_1096335197 6 Left 1096335192 12:50749909-50749931 CCACTCCAGAAGAAGCAGCATTT 0: 1
1: 1
2: 3
3: 47
4: 306
Right 1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG 0: 1
1: 7
2: 44
3: 154
4: 403
1096335191_1096335197 29 Left 1096335191 12:50749886-50749908 CCATGCGAGGACATGGTGTTCGT 0: 1
1: 0
2: 3
3: 27
4: 149
Right 1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG 0: 1
1: 7
2: 44
3: 154
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096335197 Original CRISPR CCATTTTGGAAGTAGAGACC AGG Intergenic
900339969 1:2183672-2183694 CCATCTTGGAAGCAGAGATCAGG - Intronic
900627467 1:3615546-3615568 CCACTTAGGAAGTACAGACCCGG + Intergenic
900637951 1:3675008-3675030 CCATTGTGGGAGGAGACACCTGG - Intronic
900637958 1:3675032-3675054 CCATTGTGGGAGGAGACACCTGG - Intronic
900637965 1:3675056-3675078 CCATTGTGGGAGGAGACACCTGG - Intronic
900637972 1:3675080-3675102 CCATTGTGGGAGGAGACACCTGG - Intronic
900637979 1:3675104-3675126 CCATTGTGGGAGGAGACACCTGG - Intronic
900637986 1:3675128-3675150 CCATTGTGGGAGGAGACACCTGG - Intronic
900637993 1:3675152-3675174 CCATTGTGGGAGGAGACACCTGG - Intronic
900638000 1:3675176-3675198 CCATTGTGGGAGGAGACACCTGG - Intronic
900638007 1:3675200-3675222 CCATTGTGGGAGGAGACACCTGG - Intronic
900638014 1:3675224-3675246 CCATTGTGGGAGGAGACACCTGG - Intronic
900638021 1:3675248-3675270 CCATTGTGGGAGGAGACACCTGG - Intronic
900638028 1:3675272-3675294 CCATTGTGGGAGGAGACACCTGG - Intronic
900638035 1:3675296-3675318 CCATTGTGGGAGGAGACACCTGG - Intronic
900638042 1:3675320-3675342 CCATTGTGGGAGGAGACACCTGG - Intronic
901021111 1:6256246-6256268 CCATCTTTGAAGCACAGACCAGG + Intronic
901752719 1:11421278-11421300 ATATTTTGAAAGTAGAGGCCAGG - Intergenic
901863858 1:12091263-12091285 CCAATTTGGAAGTAGGGAAGTGG + Intronic
902966905 1:20011838-20011860 CCATCTTGGTAGCAGAGACCAGG - Intergenic
902967165 1:20013994-20014016 CCATCTTAGAAGCAAAGACCAGG - Intergenic
903050665 1:20598346-20598368 CCATCTTGGAAGCTGAGACTGGG + Intronic
903394155 1:22986483-22986505 CCATCTTGAAAGCAGACACCGGG + Intergenic
903406033 1:23097059-23097081 TCATCTTGGAAGCAGAGACTGGG - Intronic
903629600 1:24757393-24757415 TTATTTTGGAAGTAGAGAACAGG + Intronic
904275359 1:29380317-29380339 CCATTTTGGAACCAGAAGCCTGG + Intergenic
905000459 1:34664104-34664126 CCATCTTAGAAGCAGAGACCAGG + Intergenic
905020370 1:34806815-34806837 TCATCTTGGAAGCAGAGACTAGG - Intronic
905020772 1:34809787-34809809 CCATCTTGAAAGCAGAGACAGGG - Intronic
907531972 1:55108306-55108328 TCATATTGGAAGTTGAGACTTGG + Intronic
907761394 1:57364389-57364411 CCATACTGGAACAAGAGACCTGG + Intronic
907855057 1:58295146-58295168 ACATTTTGGAGGAGGAGACCAGG - Intronic
908171177 1:61506127-61506149 CCATATTGAAAGCAGAGTCCAGG + Intergenic
908499479 1:64728943-64728965 CCATCTTAGAAGCAGAGAGCAGG + Intergenic
908669222 1:66527519-66527541 CCATCTTGGAAGCAGAGACTAGG + Intergenic
908988869 1:70060143-70060165 ACATTTTTAAAGTAGAGACAGGG - Intronic
909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG + Intergenic
909983944 1:82137307-82137329 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
910218831 1:84868746-84868768 CCCTTCTGGAAGCAGAGACCAGG + Intronic
911024560 1:93423262-93423284 CTATTTTGGAAGCAGAGATCTGG + Intergenic
911164346 1:94711870-94711892 CCATTTTGGAAGCAGAGACTGGG - Intergenic
911317707 1:96375467-96375489 CCATCTTTGAAGCAGAGACTAGG + Intergenic
911844187 1:102728476-102728498 CCACCTTGGAAGTACAGACCAGG + Intergenic
912138100 1:106685728-106685750 CCATCTTGGAAGCAGAGACCAGG + Intergenic
915275777 1:154787311-154787333 CCATTTGGGAGGGAGGGACCAGG + Intronic
915887682 1:159740766-159740788 CCATCTTGGAGGTAGAGACTGGG - Intergenic
915934306 1:160081789-160081811 ATTTTTTGGAAGGAGAGACCTGG - Intronic
917015221 1:170522917-170522939 CCATCTTGGAAGTGAACACCAGG + Intergenic
917286202 1:173423934-173423956 CCTCCTTGGAAGCAGAGACCAGG - Intergenic
918331915 1:183469877-183469899 TCATTTTGGAAATAGAGAAACGG - Intergenic
918334209 1:183491851-183491873 CCATCTTGGAAGCAGAGACTGGG - Intronic
918790885 1:188826491-188826513 TCATCTTCGAAGTGGAGACCAGG + Intergenic
919001025 1:191831704-191831726 TCATCTTGGAAGGAGAGACTGGG - Intergenic
919159113 1:193805715-193805737 CCATCTTGGAAGCAGAGATTGGG - Intergenic
919703059 1:200651473-200651495 CCATCTTTGAAGTAGAGAGCAGG + Intronic
920000047 1:202790821-202790843 CCATCTTGAAAGTGGAGACCAGG + Intronic
920265896 1:204722457-204722479 TCATCTTGGAAGCAGAGAGCGGG - Intergenic
920954786 1:210608798-210608820 CCATCTTGGAGGGAGAGACTGGG - Intronic
922027402 1:221763646-221763668 CCATCTTGGAAGGAGAGACTGGG - Intergenic
922312587 1:224409686-224409708 TCATTTTTGAAGTAGAGACGGGG - Intronic
922441090 1:225655246-225655268 CCATATTGCAAGTAGAGACAGGG + Intergenic
922842877 1:228658474-228658496 ACATCTTGGAAGCAGAGACGGGG + Intergenic
923156142 1:231281131-231281153 CCACTTTAGAAGCAAAGACCAGG - Intergenic
924550423 1:245070985-245071007 CCATCTTGGAAGCAGAGACCAGG + Intronic
924845230 1:247761942-247761964 ACACTTTGGAATTAGAAACCTGG + Intergenic
1064236956 10:13585129-13585151 CTATTTTTGTAGTAGAGACAGGG + Intergenic
1065060383 10:21894903-21894925 CCATCTTGGAAACAGAGACCAGG + Intronic
1065074198 10:22060656-22060678 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1065177079 10:23088139-23088161 GCATTTAGGAGGTGGAGACCAGG + Intergenic
1065259077 10:23906004-23906026 CCATTGTGGAATCAGAGACAGGG - Intronic
1065772170 10:29087636-29087658 CCATTTTGGAAGCAGGGAACAGG + Intergenic
1066578216 10:36849957-36849979 TCATCTTAGAAGTAGAGACCTGG + Intergenic
1067838554 10:49657199-49657221 CCATCTTGGAAGCACAGAGCAGG - Intronic
1068437765 10:57014691-57014713 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1068766783 10:60773350-60773372 CCATCTTGGAAACAGAGAGCAGG - Intergenic
1069096649 10:64267409-64267431 CCATTTGTGAATCAGAGACCAGG + Intergenic
1069375217 10:67786573-67786595 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1071704943 10:87987866-87987888 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1071836464 10:89423064-89423086 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1072483683 10:95833769-95833791 TCATCTTGGAAGCAGAGACCAGG - Intronic
1072753107 10:97998336-97998358 CAATTTGGGAAGCACAGACCAGG + Intronic
1074416037 10:113267611-113267633 CCATTTTGCAAGTGGAGAAATGG - Intergenic
1074765356 10:116696099-116696121 CCATCTTAGAAGCAGAGACTGGG + Intronic
1074829265 10:117237302-117237324 CTATTTAGGAAGTAGCCACCTGG - Intergenic
1077548890 11:3190669-3190691 CCATTTTGGAAGCAAAGATGGGG - Intergenic
1077622299 11:3737449-3737471 CTATTTTGTTAGTAGAGACAGGG - Intronic
1077719508 11:4613568-4613590 CCATCTTGGAAGCAGGTACCAGG - Intergenic
1077894641 11:6444530-6444552 CCATCATAGAAGCAGAGACCAGG + Intergenic
1078082344 11:8213290-8213312 CCAGTCTGGCAGTAGACACCAGG - Intergenic
1079547311 11:21647904-21647926 CCATTTTGGAAATGGAGACAGGG + Intergenic
1080368460 11:31607395-31607417 CCATCTTGGAAGCAGAGTGCTGG - Intronic
1080369456 11:31618363-31618385 CCGTGTTGGAAGTGGAGACTCGG - Intronic
1080498735 11:32848143-32848165 CCATCTTGGAAGCAGAGACTGGG - Intronic
1080828196 11:35865816-35865838 CCATAGTGAAAGTAGAGTCCTGG + Intergenic
1081848263 11:46256790-46256812 CCATCTTGGAAGCAGAGAGCAGG + Intergenic
1081876060 11:46409182-46409204 CCACTTTGGAAGGAAAGAACTGG + Intronic
1082003226 11:47405745-47405767 CAATTTTTGTAGTAGAGACAGGG - Intergenic
1084194726 11:67517966-67517988 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1084651327 11:70491054-70491076 CCACCTTGGAAGCAGAGTCCTGG + Intronic
1085839752 11:79998097-79998119 CCATTTTGAAAGCAGAGACTAGG - Intergenic
1086060845 11:82698501-82698523 ACATCTTGGAAGCAGAGACCAGG + Intergenic
1086074316 11:82834119-82834141 CCATCTTGAAAGCAGAGACTGGG + Intronic
1086466707 11:87061323-87061345 CCATTTAGAAAGTAGAGGGCAGG + Intronic
1086553634 11:88083785-88083807 CTATCTTGGAAGCAGAGAACAGG + Intergenic
1086680119 11:89660258-89660280 CCATTTAGGATATAGAGCCCAGG + Intergenic
1086754794 11:90546754-90546776 GCATTTATGAAGTAGGGACCTGG + Intergenic
1087564229 11:99833930-99833952 TCATTTAGGTAGTAGAGACCAGG + Intronic
1088117412 11:106328185-106328207 CAATCTTGGAAGTTGAGACAGGG - Intergenic
1088375238 11:109133580-109133602 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1088416439 11:109594538-109594560 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1088495485 11:110427763-110427785 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1088749012 11:112828130-112828152 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1089829571 11:121314913-121314935 CCATCTTGGAAGTAGGTACTGGG + Intergenic
1089878383 11:121747801-121747823 CCATCTTGAAAGCAGAGACTGGG + Intergenic
1090986679 11:131773164-131773186 CCACCTTGGAAGCAGAGACCAGG - Intronic
1091208416 11:133836073-133836095 CCATGTGGCAAGTGGAGACCTGG - Intergenic
1092390388 12:8072173-8072195 GCATTTTGGGAGTTGAGGCCAGG - Intergenic
1092577623 12:9805283-9805305 TCATCTTGGAAGCAGAGACCAGG - Intergenic
1092765763 12:11851194-11851216 CCATTTTGGAAGGGGAGGCCAGG - Intronic
1092936534 12:13369071-13369093 CCATCTTGGAAACAGAGATCAGG - Intergenic
1093407726 12:18825439-18825461 TCATTTAGGGAGTAGAGGCCAGG - Intergenic
1093480677 12:19601260-19601282 CCATATTGGAATGAGAAACCTGG + Intronic
1094256714 12:28438388-28438410 CCATCTTTGAAGCAGAGAACAGG + Intronic
1094554650 12:31486307-31486329 CCATCTTAGAAGCAGAGACTAGG + Intronic
1096310453 12:50516064-50516086 CCATCTTTGAAGTAGACAGCAGG - Intronic
1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG + Intergenic
1097119766 12:56722383-56722405 CTATTTTGGAAGAAGAGAATTGG + Intronic
1098190888 12:67947066-67947088 CCATCTTAGAAGCAGAGACTAGG + Intergenic
1098747911 12:74264153-74264175 TCATTTTGGAATTAGAGAATTGG + Intergenic
1098904847 12:76151452-76151474 CCTTTTTGAAAATAGAGACCTGG + Intergenic
1098914780 12:76246003-76246025 CCATTCTGGAAGCATAGACAGGG - Intergenic
1099084255 12:78225503-78225525 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1099432500 12:82604614-82604636 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1099705880 12:86152324-86152346 CCATCTTGGAAGCAGAGGTCAGG - Intronic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1100794930 12:98171835-98171857 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1101159838 12:101962310-101962332 CCATCCTGGAAGCAGAGACTGGG - Intronic
1101373432 12:104150979-104151001 CCTTTTTGGCACCAGAGACCAGG - Intergenic
1101735038 12:107457032-107457054 GCATTTTTTAAGTAGAGACAGGG + Intronic
1101984125 12:109432302-109432324 CCTTTTTTTAAGTAGAGACGGGG + Intronic
1102783520 12:115585432-115585454 GCAGTTTGGATGTAGAAACCAGG - Intergenic
1104123313 12:125819869-125819891 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1105718996 13:23095329-23095351 CCATCTTGGGAGCAGAAACCAGG + Intergenic
1105822217 13:24089865-24089887 TCATCTTGGAAGTGGAGACTGGG - Intronic
1106884504 13:34169444-34169466 CCATCTTGGAAGCAGAGGCTGGG + Intergenic
1107535285 13:41323524-41323546 CTATTTTTTAAGTAGAGACAGGG + Intronic
1107876871 13:44798866-44798888 GCATTTTTTAAGTAGAGACGGGG + Intergenic
1108719380 13:53115436-53115458 CCATTTTAGAAGTGGATTCCCGG - Intergenic
1108972832 13:56399119-56399141 ACATTTTGTGAGTAGAGGCCAGG + Intergenic
1109279743 13:60342156-60342178 CCACCTTGGAAGCAGAGATCGGG + Intergenic
1109551446 13:63907075-63907097 CCATTCTGGAAATACAGAACTGG - Intergenic
1109985971 13:69984934-69984956 CTATTTTTTTAGTAGAGACCAGG - Intronic
1110006119 13:70272504-70272526 TCATCTTGGAAGCAGAGACCTGG - Intergenic
1110521500 13:76484350-76484372 CCATCTTAGCAGCAGAGACCAGG - Intergenic
1110868216 13:80421211-80421233 CAATTGTGGAAGTAGAGAAGTGG - Intergenic
1111058507 13:82981358-82981380 CATTTGTGGAACTAGAGACCAGG + Intergenic
1111312696 13:86510221-86510243 CCATCTTGGAAGTGGATACTGGG - Intergenic
1111553468 13:89848417-89848439 CCATATTCGAAGCAGAGACTGGG - Intergenic
1111809416 13:93080222-93080244 CCATCTTAGAAGTAGAGAGTGGG - Intergenic
1111874699 13:93878724-93878746 TCATCTTGGAAGCAGAGACTGGG + Intronic
1112788444 13:102977512-102977534 CCATTTTGGGAGCAGAGAGTTGG + Intergenic
1113674569 13:112198518-112198540 CCATCTTGGAAGCAGAGGCTGGG - Intergenic
1113754164 13:112797987-112798009 CCATCTTGGAAGCAGAGATGGGG - Intronic
1113810080 13:113135440-113135462 CCGTCTTGGAAGCAGAGACCAGG - Intronic
1114430991 14:22660438-22660460 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1114584938 14:23802682-23802704 CCATCTTTGAAGCAGAGACCAGG - Intergenic
1115046364 14:28999863-28999885 CCATTTCTGAAGTAGAGAATTGG - Intergenic
1115692485 14:35859114-35859136 CCTTTTTTGTAGTAGAGACTGGG + Intronic
1116526019 14:45906378-45906400 CCATTTGGGAAGTACAAATCAGG + Intergenic
1116748522 14:48851723-48851745 CCATCTTGGAAGCAGAAATCAGG + Intergenic
1117949889 14:61072097-61072119 CCATCTTGGGAGTGGAGACAAGG - Intronic
1118016425 14:61665792-61665814 CCATTTTTGATGTAGGGAACAGG + Intergenic
1118392671 14:65308795-65308817 CCCTTTAGCAAATAGAGACCAGG + Intergenic
1119080342 14:71686967-71686989 CCAGTTTGGAAGCAGAGAGCAGG + Intronic
1119178275 14:72585838-72585860 CAATATTGGAAGGAGAGAACAGG - Intergenic
1119547636 14:75484016-75484038 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119547644 14:75484064-75484086 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119915844 14:78401015-78401037 CCATCTTGGAAGCAGGGAACAGG - Intronic
1120402979 14:84055651-84055673 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1120609494 14:86622986-86623008 CCATCCTGGAAGCAGAGAGCAGG - Intergenic
1120721341 14:87892625-87892647 CCATCTTGGAGGCAGAGACCAGG - Intronic
1121146028 14:91583046-91583068 GCATTCTGGATGGAGAGACCAGG - Intronic
1121456886 14:94044065-94044087 CCAGTGTGGAAGGAGGGACCAGG - Intronic
1121851951 14:97229410-97229432 CCATTTTTGAAGCAGAGAGTGGG - Intergenic
1121954664 14:98203056-98203078 CCACCTTGGAAGTGGAGACCAGG - Intergenic
1122682371 14:103475532-103475554 TCATGTTGGAAGCAGAGAACAGG - Intronic
1123471502 15:20557550-20557572 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123646501 15:22442805-22442827 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1123731804 15:23152552-23152574 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123749941 15:23349934-23349956 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123997631 15:25729826-25729848 CCTGTTTGGAAGCAGAGACATGG - Intronic
1124022423 15:25936979-25937001 CCATCTTGGAAGCGGAGACCTGG + Intergenic
1124282309 15:28373830-28373852 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1124300392 15:28537785-28537807 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1125365126 15:38905373-38905395 CCATTTTGGAAGCAAAGTCTGGG - Intergenic
1125423629 15:39528806-39528828 CCACCTTGGAAGCAGAGACTGGG - Intergenic
1127552126 15:60050808-60050830 CCATCTTGGAATTGGAGACCAGG + Intronic
1128162271 15:65431434-65431456 CCCTTTAAGAAGTAGAGGCCAGG + Intergenic
1128195163 15:65746893-65746915 CCATTTTTTTAGTAGAGAACAGG - Intronic
1128220599 15:65965674-65965696 CCATTTTGGAAGCAGAGATTGGG + Intronic
1128300384 15:66563194-66563216 TCATCTTGGAAGCAGAGACTGGG + Intronic
1128420512 15:67487654-67487676 CATTTCTGGAAGTAGAGCCCAGG + Intronic
1128912330 15:71527163-71527185 CCACCTTGAAAGTAGAGACGGGG + Intronic
1129380272 15:75160667-75160689 CCATCTTGGAAGCAGAGAGCAGG - Intergenic
1129617672 15:77112508-77112530 GCATGCTGGAAGTAGAGGCCAGG - Exonic
1129827571 15:78644473-78644495 CCATCTTGGAAGCAGATACCAGG + Intronic
1130785786 15:87094479-87094501 CCATCTTGAAAGCAGAAACCAGG + Intergenic
1132347653 15:101118251-101118273 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1133129559 16:3668230-3668252 CTATTTTTTAAGTAGAGACGGGG + Intronic
1133517678 16:6525649-6525671 CCATCTAGGAAGTAGAGACGGGG - Intronic
1134437026 16:14269034-14269056 CCATCTTCCAAGCAGAGACCTGG - Intergenic
1134767819 16:16776743-16776765 ACATTGTGGAAATAGAGACAGGG + Intergenic
1135290937 16:21237513-21237535 CCATCTTGGAAGCGGAGACAGGG - Intronic
1136031476 16:27506384-27506406 GCATTTTGTAGGTAGAGGCCAGG - Intronic
1136370091 16:29830819-29830841 CCTCTTTGGTAGTGGAGACCTGG + Intronic
1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137406703 16:48194750-48194772 CCATCTTGGAAGTAGATACTGGG + Intronic
1138007495 16:53351524-53351546 CCATCTTGGAAGCAAAGACCAGG - Intergenic
1138695721 16:58811425-58811447 CCATCTTGGGAGTGGAGACTGGG - Intergenic
1139285591 16:65810776-65810798 CCATCTTGGAAGCAGAGTCCTGG - Intergenic
1139320492 16:66110002-66110024 TCATCTTGGAAGCAGAGACCAGG + Intergenic
1140396561 16:74632214-74632236 CTATTTTTGTAGTAGAGACGGGG - Intronic
1140463523 16:75160740-75160762 CCATCCTGGAAGAAGAGACCAGG - Intronic
1140524796 16:75613686-75613708 GCATTTAGTAGGTAGAGACCAGG - Intronic
1140891746 16:79290875-79290897 CCATTTTGGGGGTAGAGATTGGG - Intergenic
1141870727 16:86783777-86783799 CCTTTCTGGAAGTCGAGCCCTGG - Intergenic
1141879496 16:86848343-86848365 ACATTTTGGAAATTAAGACCAGG - Intergenic
1144064732 17:11614694-11614716 CCATCTTGGAAGCAGAGGCCAGG - Intronic
1145378417 17:22373111-22373133 CCATCTTGGATGTAGAGACCAGG + Intergenic
1146098115 17:29952098-29952120 CCATCTAGGAAGCAGAGACAAGG - Intronic
1152156595 17:78637739-78637761 CCACCTTGGAAGCAGAGGCCAGG + Intergenic
1153431994 18:5027889-5027911 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1153583040 18:6594626-6594648 CCATCTTGAAAGCAGAGAGCAGG - Intergenic
1154249854 18:12735321-12735343 GCATTTTTTAAGTAGAGACGGGG - Intergenic
1154296200 18:13151329-13151351 ACTTTTTAGAAGTAGATACCTGG - Intergenic
1155523461 18:26692280-26692302 CCATTTCTGAAGTAGAAATCTGG - Intergenic
1155921548 18:31608253-31608275 CCATCTTGGAAGCAGACACTGGG + Intergenic
1156687840 18:39671437-39671459 CTATACTGGAAGTAGAGACAAGG + Intergenic
1157060793 18:44287589-44287611 CAATGTTGGAAGTAGACACTAGG - Intergenic
1157786038 18:50483435-50483457 CCATCTTAGAAGCAGAGACCAGG + Intergenic
1157871660 18:51235113-51235135 CCATTTTGCAAGTTGAGAAGAGG - Intergenic
1159314704 18:66757127-66757149 GCATCCTGGAAGCAGAGACCTGG + Intergenic
1159332308 18:67012917-67012939 CCATCTTGGAAGTAGAGAGCTGG - Intergenic
1159356714 18:67345709-67345731 CCATTTTGGCACCAGGGACCAGG - Intergenic
1159437878 18:68441888-68441910 GCATTTGGGAAGAAGAGACATGG + Intergenic
1159809837 18:73004543-73004565 CCATCTTGTGAATAGAGACCAGG - Intergenic
1160669270 19:349284-349306 CCATTTTGGGAGCAGAGACCAGG - Intergenic
1161545715 19:4878715-4878737 TTATTTTGGGAGTAGGGACCAGG + Intergenic
1161939137 19:7391762-7391784 GCATCTAGGAGGTAGAGACCAGG + Intronic
1164042252 19:21504167-21504189 CTATTTTTTAAGTAGAGACAGGG + Intronic
1164613827 19:29652822-29652844 CCATCTTGGAAGCACAGACTGGG - Intergenic
1164672581 19:30081243-30081265 CCATCCTGGAAGCAGAGACTTGG - Intergenic
1167754667 19:51404697-51404719 ACATCTTGGAAGCAGAGATCAGG - Intergenic
1167782511 19:51608301-51608323 CCTTTTGGGAAGGAGAGGCCAGG + Intergenic
925066445 2:932080-932102 CCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066546 2:932386-932408 CCATTGTGGAGGCAGAGGCCTGG + Intergenic
925198643 2:1948391-1948413 CCACCATGGAAGTAGATACCAGG - Intronic
925468529 2:4134067-4134089 GCATTTGGGAGGTGGAGACCAGG + Intergenic
926659482 2:15447917-15447939 CTATCTTGGAAATAGAGACTGGG - Intronic
929139554 2:38655023-38655045 CCATCTTAGAAGGAGAGACCTGG - Intergenic
929812127 2:45199575-45199597 CCATCTTGGAAGTGGAAACCAGG + Intergenic
930683862 2:54287180-54287202 CCACCTTGGAAGAAGAGATCAGG - Intronic
931115384 2:59161239-59161261 CCATTTTGTAAGCAGAGAGATGG - Intergenic
931409831 2:62018900-62018922 CCCTCTTGGCAGCAGAGACCAGG - Intronic
932272457 2:70422835-70422857 CCATCTTAGAAGCAGAGACCAGG - Intergenic
932368513 2:71168554-71168576 CCATCTTGGAAGCAGAGACCAGG + Intergenic
932484128 2:72071259-72071281 TCATCTTGGAAGCAGAGGCCAGG - Intergenic
932598441 2:73108484-73108506 CCATTTTGGTTGGGGAGACCTGG - Intronic
932652298 2:73571429-73571451 CCATTTTGGAAGCAGAGACTGGG - Intronic
932914637 2:75843480-75843502 CCATCTTGGAAGCAGAGACTGGG - Intergenic
933352261 2:81169029-81169051 GCATTTTGTGAGTAAAGACCAGG - Intergenic
933354405 2:81195523-81195545 CCAACTGGGAAGCAGAGACCAGG - Intergenic
933817972 2:86083938-86083960 CCATTCAGGAGGTAGGGACCAGG + Intronic
933982392 2:87562377-87562399 CCATTTATGAAGCAGAGAGCAGG - Intergenic
935277036 2:101483986-101484008 CTATCTTGGAAGCAGAGACTGGG + Intergenic
935984149 2:108656001-108656023 GGATTATGGAAGTAGAGAACCGG - Intronic
936136585 2:109899655-109899677 GGATTATGGAAGTAGAGAACCGG - Intergenic
936208112 2:110471830-110471852 GGATTATGGAAGTAGAGAACCGG + Intronic
936247995 2:110845188-110845210 CCATCTTGGAAGCAGAGACCAGG - Intronic
936311449 2:111388416-111388438 CCATTTATGAAGCAGAGAGCAGG + Intergenic
936391456 2:112078328-112078350 CCATCTTGGAAGCAGACACCAGG - Intronic
936810607 2:116396236-116396258 ACATTTTGTATGTGGAGACCAGG + Intergenic
937480800 2:122256810-122256832 CCATCTTGGATGGAGAGACCAGG + Intergenic
938010759 2:127827095-127827117 CCATTTTGGAAATGGAGAACAGG + Intergenic
938461310 2:131499236-131499258 GCATCTAGGAAGTAGAGGCCAGG + Intergenic
938744888 2:134268068-134268090 TCATTCAGGGAGTAGAGACCAGG + Intronic
940326412 2:152430260-152430282 CCATTTTAGAACTTGCGACCAGG + Intronic
940478715 2:154200564-154200586 CCATCTTGAAAGTGGAGACCAGG - Intronic
941092775 2:161197622-161197644 CCATCTTGGAAACAGAGACTGGG - Intronic
941187185 2:162331612-162331634 CCATCTTGGAAGCAGAGGCTGGG + Intronic
941216791 2:162720660-162720682 CCATTTTGGCTATAGATACCAGG - Intronic
941456605 2:165717009-165717031 AAATTCTGGAAGTAGAGGCCAGG + Intergenic
941693596 2:168527596-168527618 CCATCTTGGAAGCAGAGACTTGG - Intronic
941789343 2:169534347-169534369 CCATCTTGGAAGCAGAGGCTAGG + Intronic
942187202 2:173435203-173435225 CCCTTGTGGAAGTTGAGAACAGG - Intergenic
942757349 2:179357611-179357633 CGAACTAGGAAGTAGAGACCAGG + Intergenic
942875888 2:180797059-180797081 TCATCTTGAAAGGAGAGACCAGG + Intergenic
945512494 2:210719928-210719950 TTACTTTGGAAGCAGAGACCGGG - Intergenic
945765352 2:213969591-213969613 CCATCTTGGAAGCAGATACTAGG + Intronic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
946472840 2:219978714-219978736 CCATCTTGAAAGTTGAGACCAGG + Intergenic
946628470 2:221640993-221641015 CCATCTTGGAAGCAAAGACCAGG - Intergenic
946766547 2:223046015-223046037 GCATTTTTTAAGTAGAGACGGGG + Intergenic
946978282 2:225177573-225177595 CCATCTTGGAAGAGGACACCAGG - Intergenic
947402763 2:229744883-229744905 CCATCTTGGAAGCAGAAAGCTGG - Intergenic
947459590 2:230292293-230292315 CAAATTTGGAAGTAGAGGCCAGG - Intronic
947469890 2:230391734-230391756 GAATTCTGGGAGTAGAGACCAGG - Intronic
948654860 2:239470278-239470300 CCATCTTGGGAGCAGAGACCGGG + Intergenic
1169564722 20:6841428-6841450 GCATTTTTAAGGTAGAGACCAGG - Intergenic
1169770178 20:9191409-9191431 CCCTCTTAGAAGCAGAGACCAGG + Intronic
1170023480 20:11863075-11863097 CCATCTTGGAAGAAGAGATTGGG + Intergenic
1170534007 20:17322659-17322681 CCATCTTGGAAGGAGAGACTGGG - Intronic
1171534050 20:25870548-25870570 CCATCTTGGATGCAGAGACCAGG - Intergenic
1171793078 20:29546304-29546326 CCATCTTGGATGCAGAGACCAGG + Intergenic
1171855374 20:30338102-30338124 CTATCTTGGATGCAGAGACCAGG - Intergenic
1173428124 20:42960316-42960338 CCATCTTGGAAGCAGAGAACAGG - Intronic
1173641626 20:44606896-44606918 CCCTCTTGGAAGCAGAGAGCAGG + Intronic
1174688508 20:52479163-52479185 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1174856750 20:54052707-54052729 CCATCTTGGAAGTAGAGAACAGG + Intronic
1175359396 20:58396382-58396404 CCATCTGGGAAGTGGAGACTAGG + Intronic
1175671990 20:60911243-60911265 TAATTTTTTAAGTAGAGACCGGG - Intergenic
1176158464 20:63635851-63635873 CCATCGTGGAAGCAGAGACCAGG - Intergenic
1176691737 21:9919409-9919431 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1177000740 21:15609170-15609192 TCATTTTGGGAGCAGAAACCAGG + Intergenic
1178839066 21:36124077-36124099 TCATCTTGGAAGCACAGACCAGG + Intergenic
1178861523 21:36293680-36293702 CCATTTTGAAAGTAGATTTCAGG + Exonic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1178952693 21:36998256-36998278 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1179052472 21:37899751-37899773 CCATTTTGTAGGTAGGGAACTGG - Intronic
1179400623 21:41079897-41079919 CCATCTTGGAGGCAGAGACAGGG - Intergenic
1180146236 21:45920772-45920794 CCATATTGAAAGCAGAGACTTGG + Intronic
1181679505 22:24483668-24483690 CCATTTTTTTAGTAGAGACAGGG - Intergenic
1183099876 22:35577302-35577324 CCATTTTGCAAATAGAGACTTGG - Intergenic
949274392 3:2260901-2260923 GCATTTTTTAAGTAGAGACGAGG + Intronic
949494298 3:4617351-4617373 CCATCTTGAGAGCAGAGACCAGG - Intronic
950621281 3:14207524-14207546 AAACTTTGGAAGTAGAGCCCAGG + Intergenic
951241250 3:20288231-20288253 CCATGGTGGAAGGAGAGGCCTGG + Intergenic
951502415 3:23403646-23403668 CATTTTTGAAAATAGAGACCGGG - Intronic
951557331 3:23933867-23933889 CCATCTTGGAAGCAGAGACTGGG - Intronic
951727766 3:25779107-25779129 GCATTTTTTAAGTAGAGACAGGG + Intronic
951870479 3:27356124-27356146 CCATCTTGGAAGCAGGGACTGGG + Intronic
951927978 3:27930668-27930690 GCATCTTGGAGGTAGAGACCAGG - Intergenic
952615962 3:35274288-35274310 CCATCTTGGAAGCAGAGACTAGG + Intergenic
953140976 3:40228873-40228895 CCACTTTGGAATTAAAGAGCGGG - Intronic
953145365 3:40270044-40270066 CCATCTTGGAAGCAGAGAGTGGG - Intergenic
953899499 3:46831725-46831747 CCCTTTTGAAAGAACAGACCAGG + Intronic
955609262 3:60739615-60739637 CCATCTTGTAGGTAGAGGCCAGG - Intronic
955752459 3:62196626-62196648 CCAGCATGGAAGTAGGGACCAGG + Intronic
956048872 3:65225780-65225802 CCAGTTTGGAAGCAGAACCCTGG - Intergenic
956085410 3:65603800-65603822 CCATCTTGGAAGGAGAGACCAGG - Intronic
956764613 3:72473868-72473890 CCATCTTGGAAGTGGAGATAGGG + Intergenic
956765506 3:72481181-72481203 CCATCTTAGAAGCAGAGACTGGG + Intergenic
956773548 3:72547027-72547049 CCATCTTGGAAGCAGAGGCCAGG + Intergenic
958002679 3:87771585-87771607 CCATCTTGGAAGCAGAGCACAGG - Intergenic
959154785 3:102653559-102653581 CCATTTTGGAAGTGAAGACCTGG + Intergenic
960268539 3:115649183-115649205 CCATCTTGGAGACAGAGACCAGG - Intronic
960977874 3:123194024-123194046 CCGTCTTGGAAGCAGAGATCAGG - Intronic
962445839 3:135463860-135463882 TCATCTTGGAAGCAGAGAGCAGG + Intergenic
962742632 3:138373065-138373087 CCATCTTGGACGGTGAGACCTGG + Exonic
963533667 3:146501734-146501756 CCATCTTGGAAGTAGAGACCAGG - Intergenic
963713556 3:148776216-148776238 CCATCTTGGAAGCAGAGACCAGG + Intergenic
963840317 3:150098068-150098090 CCATCTTCGAAGTAAAGACTGGG + Intergenic
964434393 3:156636476-156636498 CCATCTTGGAAGCAGAGACCTGG - Intergenic
964593803 3:158398386-158398408 CCATCTTGGAAGCAGACACCTGG - Intronic
964663217 3:159143905-159143927 CCATCTTGGAAGCTGAGACCAGG - Intronic
965907251 3:173724446-173724468 CCATATTTGTAGTAGAGACGAGG + Intronic
966476987 3:180360498-180360520 CCATCTTGCAAGCAGTGACCAGG + Intergenic
966752532 3:183335985-183336007 CCATCTTGGAAGGAGAGACTGGG + Intronic
966787027 3:183631210-183631232 CCCTTTAAGAAGTAGAGATCAGG + Intergenic
967213948 3:187194287-187194309 CCATTTTTTATGTAGAGACGGGG - Intergenic
968044952 3:195618772-195618794 CCATTCCAGAAGCAGAGACCAGG + Intergenic
968060736 3:195724824-195724846 CCATTCCAGAAGCAGAGACCAGG + Exonic
968630118 4:1646023-1646045 CCATCTTGGAAGCAGAGGGCAGG + Intronic
970464717 4:16310968-16310990 CCATCTTGGAAGCAGATACTGGG + Intergenic
970568921 4:17360413-17360435 CCATATTGGAAGCACAGAGCAGG - Intergenic
970645543 4:18116263-18116285 CCATTTTTGAAGTGGAGTCTTGG + Intergenic
970694980 4:18666661-18666683 CCATACTGGAAGCAAAGACCAGG - Intergenic
971090319 4:23335675-23335697 CCATCTTGGAGGCAGAGACCAGG + Intergenic
971815873 4:31488062-31488084 TCATTGTGGAAGTAGAGCACTGG - Intergenic
971913932 4:32842207-32842229 GTATTTTGAAAGTAGAGTCCAGG - Intergenic
971991287 4:33898239-33898261 CCATCTTGGAAGTGAAGATCAGG + Intergenic
972371373 4:38426649-38426671 TCATCTTGGAAGCAAAGACCAGG + Intergenic
972732998 4:41813662-41813684 CCATCTTGGAAGTAGAGAGATGG - Intergenic
972987734 4:44785271-44785293 CCATCTTGGAAGAAGAGACCAGG - Intergenic
973854748 4:55000075-55000097 CCATCTTGGAAGAAGAGACGGGG + Intergenic
974525657 4:63047057-63047079 CGATCTTGGAAGTTGAGATCAGG - Intergenic
976872343 4:89810513-89810535 CCATCTTGGGAGTAGAGAACCGG + Intronic
976950306 4:90820412-90820434 CCATCTTGGAAGCAGAGAGATGG - Intronic
977149904 4:93498232-93498254 CCATCTTGGAAGCAGAAACCTGG - Intronic
977603771 4:98961508-98961530 CCCTATTGGAAGCAGAGACGAGG + Intergenic
977700957 4:100022285-100022307 CCATCTTGGAAGCAGGGAGCAGG - Intergenic
977775540 4:100915180-100915202 CCATTTTGGAAGCAGAGACTAGG + Intergenic
978723646 4:111945003-111945025 CAACTTTGTAAGTAGAGAACTGG - Intergenic
978827878 4:113046589-113046611 CCATCTGGGAAGAAGAGACCTGG + Intronic
979277622 4:118831199-118831221 CTATTTTTTTAGTAGAGACCGGG + Intronic
979526360 4:121721511-121721533 CCATCTTGGAAGCAGAGAGAAGG + Intergenic
979748141 4:124242782-124242804 CCATCTTGGAAGCAGAGACCAGG + Intergenic
979776055 4:124589788-124589810 TCACTGTTGAAGTAGAGACCTGG - Intergenic
980364317 4:131779615-131779637 CCATTTTAGAAGCAGAAACTGGG + Intergenic
980731495 4:136830378-136830400 TCATTTTGGAAGCTGAGACTGGG - Intergenic
981064796 4:140471062-140471084 CCATTTTTTCAGTAGAGACGGGG + Intronic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981613953 4:146626522-146626544 CTATCTTGGAAGCAGAGACTGGG + Intergenic
981911845 4:149991093-149991115 CCATCTTGGAAGTAGAGACCAGG - Intergenic
982524345 4:156458547-156458569 TCATCTTAGAAGTGGAGACCAGG + Intergenic
983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG + Intergenic
984851031 4:184152529-184152551 CCATTATGGAGGAAGATACCAGG - Intronic
984900658 4:184583287-184583309 CCATCTTGGATGCAGAGACCAGG + Intergenic
986179793 5:5382936-5382958 CCATCTTGGAAGCAGAGACTGGG + Intergenic
986503037 5:8420555-8420577 ACATTTTGGAAGTGGAGAACAGG + Intergenic
986752053 5:10796063-10796085 CTATCTTGGAAGCAGAGAACAGG - Intergenic
986839050 5:11674898-11674920 GCATTTTTTAAGTAGAGACAGGG + Intronic
987238160 5:15964680-15964702 CCATCTTGGAAGCAGTGAACAGG + Intergenic
987270898 5:16307923-16307945 ACATTTAAGAAGTAGAGACATGG - Intergenic
987559247 5:19496908-19496930 TCATCTTGGAAGCAGAGCCCAGG + Intronic
987647570 5:20694167-20694189 CAATCTTGGAAGTGGAGACCAGG + Intergenic
987953708 5:24710138-24710160 CCATCTTGGATATGGAGACCAGG + Intergenic
988673305 5:33405503-33405525 CCATCTTGGAAGCAGAGAACAGG + Intergenic
989542090 5:42629318-42629340 CAATGTTGGAAGTGGAGACTGGG + Intronic
990022366 5:51143245-51143267 CCATCTTGAAAGCAGAGACCAGG + Intergenic
990428024 5:55707948-55707970 CCATCTTGGAAGCAGAGACCGGG + Intronic
991929040 5:71733566-71733588 CCATCTTGGAAGCAGAGACCAGG - Intergenic
992272260 5:75077241-75077263 CCATTTTTAAAATAGAGACCGGG + Intronic
993106210 5:83603972-83603994 TCATCTTGGAAATAGAAACCAGG - Intergenic
993108186 5:83623891-83623913 CCATTCTGGAAACAGAGACTGGG + Intergenic
993212506 5:84970800-84970822 CCATCTTGGAAGTACAGATCAGG + Intergenic
993601001 5:89924821-89924843 TCATCTTGGAAGCAGAGACTGGG - Intergenic
994335601 5:98561878-98561900 CCATCTTGGAAGTGGAGACCAGG + Intergenic
994727599 5:103454589-103454611 TCATTTTGAAAGGAGTGACCTGG + Intergenic
994773761 5:104017509-104017531 CCATCTTGGAAGCAGAGACCAGG - Intergenic
994804186 5:104421901-104421923 CTATCTTGGAAGTAGGGAACAGG + Intergenic
994863911 5:105238702-105238724 ACATTTTGAAAGTAGAAACACGG - Intergenic
994868107 5:105305328-105305350 CAATTTGGGAAGTAGAGAGCTGG + Intergenic
996871996 5:128202172-128202194 CCATCTTGGAAGCAGAGATGGGG - Intergenic
996976204 5:129438289-129438311 TCATTTTAAGAGTAGAGACCTGG + Intergenic
997052151 5:130395562-130395584 CAATTTTGGAATACGAGACCTGG - Intergenic
997100947 5:130968869-130968891 CCATCTTAAAAGCAGAGACCAGG + Intergenic
997107412 5:131035990-131036012 CCATATTGGAAGCAGATAACAGG - Intergenic
997171154 5:131722478-131722500 CCATTTTACAACTGGAGACCAGG + Intronic
997644193 5:135469233-135469255 CCAGTTTGGAAGAAGAGAAGAGG + Intergenic
998458442 5:142291789-142291811 CCATCTTGGAGGCAAAGACCGGG - Intergenic
998871224 5:146554531-146554553 CCAACTTGCAAGCAGAGACCAGG - Intergenic
998932322 5:147194879-147194901 CTATCTTGAAAGTAGAGACCAGG - Intergenic
998971315 5:147595459-147595481 CCATCTTGGAAGTAGACACCAGG + Intronic
999575540 5:152972595-152972617 CCATTTTGGATTAAGAAACCAGG - Intergenic
999734220 5:154500558-154500580 CCACCTTAGAAGCAGAGACCAGG - Intergenic
999895439 5:156027873-156027895 GCATCTTGGAAGCAAAGACCAGG - Intronic
1000201101 5:159011976-159011998 GCATTTTCTAAGCAGAGACCAGG - Intronic
1000484068 5:161817166-161817188 CCCTTTTGGAAATACAGAACTGG - Intergenic
1001359322 5:171065247-171065269 CCTTTTTGGCACTAGGGACCAGG + Intronic
1001923760 5:175621109-175621131 CCATCTTAGAAGTGGAGACTGGG + Intergenic
1002357639 5:178643655-178643677 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1002427452 5:179184726-179184748 CCAGTGGGGAAGGAGAGACCAGG - Intronic
1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG + Intronic
1003833456 6:10040784-10040806 CCATCTTGGAAGCAGAGAGCAGG - Intronic
1004019532 6:11764214-11764236 TAATTTTGGAAGCAGAGAGCTGG - Intronic
1004090874 6:12499659-12499681 CAATTTTGGACATAGAGAACTGG + Intergenic
1005214532 6:23509645-23509667 CCATCTTGGAAGCAGAGATGGGG + Intergenic
1005353519 6:24960307-24960329 CCATCTTGGAAGCAGAGACCAGG - Intronic
1005376794 6:25190847-25190869 CCAATTTGGAAGCAGAGATTGGG + Intergenic
1005443118 6:25893210-25893232 CTATCTTGGAAGCAGAGACCTGG - Intergenic
1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG + Intergenic
1006814821 6:36843027-36843049 CCATCTTGGAAGCAGAGACCTGG - Intergenic
1007836547 6:44678362-44678384 CCCTTTTGGAAGTGGAGTCATGG - Intergenic
1007948243 6:45845032-45845054 CCTTCTGTGAAGTAGAGACCAGG + Intergenic
1008908699 6:56709352-56709374 CCATTTAGGTAATACAGACCTGG - Intronic
1010234732 6:73565954-73565976 CCATACTGGCAGTAGAGACGGGG - Intergenic
1010473484 6:76259033-76259055 CCATTTTGGAGGCAGAAACCAGG - Intergenic
1010891647 6:81319918-81319940 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1012352379 6:98268562-98268584 CCATCTTGGGAGTGGAGACTGGG - Intergenic
1013785220 6:113772045-113772067 CCATCTAGTAAGTAGAGTCCAGG + Intergenic
1014771425 6:125462085-125462107 CCATCTTAGGAGTAGAGACCAGG - Intergenic
1015655942 6:135519265-135519287 CCATCTTGGAAATGAAGACCAGG - Intergenic
1015840985 6:137477021-137477043 CCATCCTGAAAGCAGAGACCAGG + Intergenic
1016806851 6:148220224-148220246 CCATTGAGGAAGCAGAGACGGGG - Intergenic
1017173016 6:151475691-151475713 CCATCTTGGAAGCTGAGACCAGG - Intergenic
1017681985 6:156873486-156873508 CAATTTTTGAAGGAGAGAACTGG + Intronic
1017832521 6:158143885-158143907 GCATCTTGGGAGTAGAGTCCAGG + Intronic
1018644555 6:165935470-165935492 ACATTTTGAAAGTAGAGAGGAGG + Intronic
1020068789 7:5211780-5211802 CCATTCAGGAAGTAGATATCAGG + Intronic
1020565752 7:9793509-9793531 CCATTTTGAAAGCAGAGAGATGG - Intergenic
1020590025 7:10124004-10124026 TCATCTTGGAAGCAGAGACCAGG - Intergenic
1020597300 7:10223771-10223793 CCACTTTGGAAGTGGAGACCAGG - Intergenic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1021943841 7:25705602-25705624 CCATCTTGGAAGCGGAGACAGGG + Intergenic
1022477469 7:30721067-30721089 CCATCTTAGAAGCAGAGACTGGG - Intronic
1023028177 7:36070792-36070814 ACATTTTGGGAGCAGAGACTGGG + Intergenic
1023358590 7:39392951-39392973 ACATTTAGGAAGAAGAGAGCAGG - Intronic
1024265421 7:47602583-47602605 CCATTTTGGAAGAGCAGACCAGG + Intergenic
1024673211 7:51615504-51615526 CTATTAAGGAAGTAGAGACTCGG - Intergenic
1025285521 7:57657479-57657501 CCATCTTGGATGCAGAGACCAGG - Intergenic
1026211537 7:68310260-68310282 CCATTTTGGAAATGGAGGCTTGG - Intergenic
1026965428 7:74436269-74436291 CCATCTTGGAAGCAGAGACTAGG - Intergenic
1027561310 7:79734256-79734278 GCATTTTGCAAGTAGGGACTTGG + Intergenic
1028624085 7:92858060-92858082 CCAGCTTGGAAGCAGAGACTGGG + Intergenic
1030408844 7:109148524-109148546 CTATCTTGCAAGCAGAGACCAGG - Intergenic
1030481515 7:110110623-110110645 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1030671675 7:112345119-112345141 CCATCTTGGAAATAGAGACTGGG - Intergenic
1030817172 7:114052544-114052566 CCATCTTGGAAGGAGAGACTGGG + Intronic
1030867896 7:114721823-114721845 CTATCTTGGAAGTAGAGACAGGG + Intergenic
1031634863 7:124090455-124090477 TCATCTTGGAAGCAGAGACAGGG + Intergenic
1032445069 7:131975141-131975163 CCATCTTGGGAGCAGAGACTGGG + Intergenic
1032876846 7:136047045-136047067 CCATCTTGGAAGCAGAGACGAGG - Intergenic
1033148270 7:138890458-138890480 CCATTTAGGAAGTGGAGACAAGG + Intronic
1034278733 7:149837252-149837274 CCCTCCTGGAAGCAGAGACCAGG - Intergenic
1034555564 7:151848340-151848362 CCACCTTGGAAGCAGAGACCAGG + Intronic
1037087842 8:14875158-14875180 TCATTTTGGAAGTGGAGATGAGG - Intronic
1039429408 8:37513987-37514009 TCATTTTCTAAGTAGAGACCTGG + Intergenic
1039429540 8:37515128-37515150 CCATTTTACAAGTAAAGACACGG + Intergenic
1039883476 8:41641899-41641921 CCAACTTGGAAGCAGAGACCAGG - Intergenic
1040455148 8:47589997-47590019 ATATTTTTAAAGTAGAGACCAGG - Intronic
1040818097 8:51529903-51529925 GCATCTTGTAAGTAGAGGCCAGG - Intronic
1040889193 8:52298019-52298041 TCAGTTTAGAAGTAGAGAGCTGG - Intronic
1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG + Intergenic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1042387718 8:68197044-68197066 CTATCTTGGAAGCAGAAACCAGG - Intronic
1042851154 8:73217230-73217252 CCATCTTGGAAGCAAAGACCAGG + Intergenic
1043199866 8:77353334-77353356 CCATCTTGGAAGCAGAAACCAGG + Intergenic
1043514042 8:80979525-80979547 CCATTCTGGAGGTAGAAACATGG + Intronic
1043538119 8:81228445-81228467 CGGTCTTGGAAGCAGAGACCAGG - Intergenic
1043716437 8:83492934-83492956 CCACCTTGGAAGCAGAGACTGGG - Intergenic
1044423213 8:92022619-92022641 CCATCTTGAGAGCAGAGACCAGG + Intronic
1044794976 8:95887498-95887520 CCATCTTGGAAGCACAGACTGGG - Intergenic
1044928674 8:97231308-97231330 CCATGTTGGAAATGGAGACCAGG + Intergenic
1045136956 8:99231966-99231988 GCATTTTGGAAGAAGAAAACAGG - Intronic
1045142034 8:99296808-99296830 CCATCTTGGAAACAGAGACCAGG + Intronic
1045483198 8:102609407-102609429 CTATTTTTGTAGTAGAGACGGGG + Intergenic
1045904451 8:107326604-107326626 CCATTTTGGAAGTAATGACAAGG - Intronic
1046268553 8:111862485-111862507 CCATTTTGGAAATGCAGACCAGG - Intergenic
1046292568 8:112181873-112181895 CCATTTTGGAAGCAGTGACCTGG + Intergenic
1046623165 8:116549452-116549474 CTATCTTGGAAGCGGAGACCAGG + Intergenic
1047554226 8:125911392-125911414 CCATTTTTTAAGTAGACAACCGG - Intergenic
1047870304 8:129075039-129075061 CCATCTTAGAAGTGGAGACTGGG - Intergenic
1048234649 8:132677781-132677803 CCATCTTGGAAGTGGAGACCAGG - Intergenic
1048274941 8:133058996-133059018 CCATTTTGGAAGCAGTGAGAAGG + Intronic
1048507650 8:135035315-135035337 CCATTTTGGTAGAAGAGAAAAGG + Intergenic
1049945879 9:595239-595261 ACATTTTAAAAGTAGAGACAGGG - Intronic
1050854184 9:10330671-10330693 CGATTTTGTAAGTAGAGAAGTGG + Intronic
1050930435 9:11316371-11316393 CCATATTGGAATAAGAGAACTGG + Intergenic
1051290247 9:15538285-15538307 GCATTTTTCAAGTAGAGACAGGG - Intergenic
1051831489 9:21283898-21283920 CCACATTGGCAGTAGATACCAGG - Intergenic
1051851903 9:21519073-21519095 CCATCTTTGAAGTGAAGACCTGG + Intergenic
1052005318 9:23340717-23340739 CCAGCTTGGAAGCAGAGACAAGG + Intergenic
1052732257 9:32302310-32302332 CTATCTTGGAAGCAGAAACCAGG + Intergenic
1053033903 9:34808629-34808651 CCATCTTGGAAGTAGAGACCAGG - Intergenic
1053038045 9:34842615-34842637 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1053628672 9:39905502-39905524 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1053777394 9:41560838-41560860 CCATTTTAGAAGCAGAAACTGGG - Intergenic
1053793201 9:41701387-41701409 CCATCTTGGATGCAGAGACCAGG - Intergenic
1054181610 9:61913399-61913421 CCATCTTGGATGCAGAGACCAGG - Intergenic
1054215215 9:62345200-62345222 CCATTTTAGAAGCAGAAACTGGG - Intergenic
1054471748 9:65544582-65544604 CCATCTTGGATGCAGAGACCAGG + Intergenic
1054672266 9:67810149-67810171 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1054716600 9:68563266-68563288 CAATTTTGGAAGGAGAAACTTGG + Intergenic
1055209036 9:73766871-73766893 GCATTTAGTAAGTAGAAACCAGG + Intergenic
1055436636 9:76298228-76298250 GCATTTTGCAAGCAGAAACCAGG + Intronic
1056593878 9:87989220-87989242 CTATTTTTTAAGTAGAGACAGGG + Intergenic
1056744291 9:89286718-89286740 CCATCTTGTAAGCGGAGACCAGG + Intergenic
1057882572 9:98803618-98803640 ACATATTGGAAGGAGAGAGCAGG + Intergenic
1058162182 9:101581581-101581603 CCATCTTGGAAGCAGAGACTGGG + Intronic
1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG + Intergenic
1059247874 9:112863824-112863846 CCATATTGGAACTAGAGAAGAGG - Intronic
1059261721 9:112983517-112983539 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1060841733 9:126799039-126799061 CCATCTTGGAAGTAGAGGCTGGG - Intergenic
1060929054 9:127476847-127476869 GCATTTTGTTAGTAGAGACGGGG + Intronic
1061476748 9:130872731-130872753 CCATGTTGGAAGTTGGGCCCAGG + Intronic
1061711331 9:132490044-132490066 CCATCTTGGAAGCAAAGACTAGG - Intronic
1062145538 9:134987726-134987748 CCATTTTAGAAGCAAAGTCCTGG - Intergenic
1062366055 9:136209580-136209602 CCGTTTTGGAAGTGGAGTGCTGG - Intronic
1185671649 X:1814554-1814576 TCATTTTTCAAGTAGAGACAAGG - Intergenic
1186727515 X:12372960-12372982 CCATTGTGGCACTAGAAACCAGG - Intronic
1186870810 X:13769807-13769829 CCATCTTGGAAGCCGAGACCGGG + Intergenic
1187462848 X:19503085-19503107 ACATTTTGGAAGTAACTACCTGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189274498 X:39775547-39775569 TCATTTTGGAAGAAGAGACAGGG + Intergenic
1189302616 X:39963267-39963289 CCATCTTGGAAGTGGAGACTGGG + Intergenic
1189387413 X:40548717-40548739 GCATTTTGGAAGAAGAGAATGGG + Intergenic
1189452303 X:41148026-41148048 GCATTTAGTGAGTAGAGACCAGG - Intronic
1190124646 X:47693118-47693140 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1192094699 X:68198337-68198359 CCATCTTGGAAACAGAGACCAGG + Intronic
1192597693 X:72428739-72428761 CCATTTTGAAACTAGAGAACTGG - Intronic
1193084116 X:77433421-77433443 CCATTTTGGAAGCAGACGCTGGG - Intergenic
1193299947 X:79878179-79878201 CCATCTTTGAAGCAGAGAGCAGG + Intergenic
1193550710 X:82889113-82889135 CCATTTTTGAAGGGGAGGCCAGG + Intergenic
1196470672 X:116021414-116021436 CCATTTTAGAAGTGGATACCAGG + Intergenic
1196593951 X:117521627-117521649 CCATCTTGGAAGCAGACACCGGG + Intergenic
1196941018 X:120775877-120775899 CTATCTTGGACGTAGAGACCAGG + Intergenic
1197034883 X:121861276-121861298 CCATCTTGGAAGCAAAGACCAGG - Intergenic
1197060428 X:122173127-122173149 TCATCCTGGAAGTAGAGACTGGG + Intergenic
1197515961 X:127429306-127429328 CCATTTTGCAAATAGAGAAAAGG + Intergenic
1198263089 X:134983912-134983934 CCGTCTTGGAAGCAGACACCAGG + Intergenic
1198556877 X:137804053-137804075 CAATTTTAGAAGTTGTGACCAGG + Intergenic
1198693113 X:139306121-139306143 CCATTTTGGAAGCAGAGAGTAGG - Intergenic
1200159887 X:154001179-154001201 GTATTTTGTAAGTAGAGACGTGG + Intergenic
1200367195 X:155679394-155679416 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
1200736844 Y:6808501-6808523 GCATTTAGTATGTAGAGACCAGG - Intergenic
1201647656 Y:16253188-16253210 ACATATTTGAAGTAGAGGCCGGG + Intergenic
1201655155 Y:16332113-16332135 ACATATTTGAAGTAGAGGCCGGG - Intergenic
1201693788 Y:16800263-16800285 CCAATTTGGAAGTAGGGAGTTGG + Intergenic
1202051211 Y:20782631-20782653 CCATTTTGGCAGTTGCAACCGGG - Intergenic
1202167508 Y:22006056-22006078 CCGTCTTGGAAGCAGAGACCAGG + Intergenic
1202169381 Y:22024986-22025008 CCATCTTGGAAGCAGAAACTAGG + Intergenic
1202221984 Y:22561379-22561401 CCATCTTGGAAGCAGAAACTAGG - Intergenic
1202223852 Y:22580313-22580335 CCGTCTTGGAAGCAGAGACCAGG - Intergenic
1202319263 Y:23615348-23615370 CCGTCTTGGAAGCAGAGACCAGG + Intergenic
1202321134 Y:23634288-23634310 CCATCTTGGAAGCAGAAACTAGG + Intergenic
1202549633 Y:26035768-26035790 CCATCTTGGAAGCAGAAACTAGG - Intergenic
1202551506 Y:26054709-26054731 CCGTCTTGGAAGCAGAGACCAGG - Intergenic