ID: 1096335439

View in Genome Browser
Species Human (GRCh38)
Location 12:50751814-50751836
Sequence CTGAAAATACAAATTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33812
Summary {0: 1, 1: 8, 2: 560, 3: 9829, 4: 23414}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096335435_1096335439 2 Left 1096335435 12:50751789-50751811 CCAACATGGTGAAACCCAGTCTC 0: 1486
1: 69100
2: 142143
3: 132100
4: 79506
Right 1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG 0: 1
1: 8
2: 560
3: 9829
4: 23414
1096335433_1096335439 11 Left 1096335433 12:50751780-50751802 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG 0: 1
1: 8
2: 560
3: 9829
4: 23414
1096335434_1096335439 7 Left 1096335434 12:50751784-50751806 CCTGGCCAACATGGTGAAACCCA 0: 2297
1: 100011
2: 177508
3: 201539
4: 146890
Right 1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG 0: 1
1: 8
2: 560
3: 9829
4: 23414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096335439 Original CRISPR CTGAAAATACAAATTCAGCT GGG Intergenic
Too many off-targets to display for this crispr