ID: 1096337058

View in Genome Browser
Species Human (GRCh38)
Location 12:50764411-50764433
Sequence GTCGCGCGCGGTGGTGGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096337047_1096337058 15 Left 1096337047 12:50764373-50764395 CCGGCGGGGACGCAGCGCGGGTC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1096337058 12:50764411-50764433 GTCGCGCGCGGTGGTGGCGGTGG 0: 1
1: 0
2: 2
3: 32
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096337058 Original CRISPR GTCGCGCGCGGTGGTGGCGG TGG Intronic
900091835 1:924108-924130 GGCGCGGGCGCTGGTGGCCGGGG + Intergenic
900309816 1:2028326-2028348 GGCGCGCGCGGAAGGGGCGGCGG - Intronic
900309823 1:2028348-2028370 GGCGCGCGCGGAAGGGGCGGTGG - Intronic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
900513127 1:3069584-3069606 GAGGCGCGCGGTGGGGGCCGGGG + Intronic
901433880 1:9234721-9234743 GGCGCGCGCGGCGGGGGCGGGGG - Intergenic
902600893 1:17539700-17539722 GTCGCGCACGGCGGCGGCGGCGG + Intergenic
902941024 1:19800108-19800130 GTCGCGATGGGTGGTGGAGGTGG - Intergenic
904005439 1:27360941-27360963 GGCGCCCGCGGAGGAGGCGGAGG - Exonic
904719958 1:32500485-32500507 GTAGCGGGCGGCGGCGGCGGCGG + Intronic
905553137 1:38859730-38859752 GGCGGTGGCGGTGGTGGCGGCGG - Exonic
906488160 1:46247487-46247509 GGCGGGGGCGGGGGTGGCGGGGG - Intergenic
906520970 1:46466709-46466731 ATCGCGCGCGGCGGCGACGGCGG + Intergenic
906640805 1:47439315-47439337 GACGCGGGCGGTGGTGCAGGCGG + Exonic
907442598 1:54488360-54488382 GGAGCGCGCGGTGGGGGTGGGGG + Intergenic
912568895 1:110607504-110607526 GACGAGCTCGGTGGCGGCGGAGG - Intronic
912806119 1:112758400-112758422 GTCCTGCCTGGTGGTGGCGGTGG + Intergenic
913462437 1:119102043-119102065 GTTGGAAGCGGTGGTGGCGGTGG + Intronic
915358882 1:155273546-155273568 GGCGCGCGCGGTCCTGGGGGCGG - Intronic
915463229 1:156081819-156081841 CTCGCCCGCCGTGGGGGCGGGGG + Exonic
918365649 1:183805129-183805151 GTCGCGCGCACCGGCGGCGGCGG + Intronic
920705006 1:208244293-208244315 GGCTCCCGCGGTGGCGGCGGCGG + Exonic
920827088 1:209432261-209432283 GGCGGCGGCGGTGGTGGCGGTGG - Intergenic
921166940 1:212514487-212514509 GGCGCCCGCGGTGGTGGGGAAGG - Intergenic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923744306 1:236686412-236686434 GCCGGGGGCGGTGGCGGCGGGGG + Intergenic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1063154954 10:3370613-3370635 GTGGGGCGGGGTGGGGGCGGGGG - Intergenic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064274261 10:13891976-13891998 GCGGCGGGCGGTGGCGGCGGCGG - Intronic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1070327958 10:75400241-75400263 GGCGCGGGCGGTGCCGGCGGCGG - Exonic
1070529788 10:77326510-77326532 GACGAGCGTGGTGGTGGTGGTGG + Intronic
1072263244 10:93702532-93702554 GTTGCGGGCGGCGGCGGCGGCGG - Exonic
1074815714 10:117139824-117139846 GTCCCGCGGGGTGGCGGCGGAGG - Intergenic
1075032100 10:119030313-119030335 CTCGCTGGTGGTGGTGGCGGCGG - Exonic
1075645442 10:124093261-124093283 TCCCGGCGCGGTGGTGGCGGTGG - Intronic
1075801882 10:125159480-125159502 GCCCCGCGCGGCAGTGGCGGCGG + Intronic
1076372496 10:129964393-129964415 GGCGAGCGCGGCGGCGGCGGCGG - Intergenic
1078538178 11:12192041-12192063 GTGGCGGGCGGGGGTGGGGGTGG - Intronic
1078556592 11:12332061-12332083 TTTGGGGGCGGTGGTGGCGGGGG - Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1081831913 11:46121544-46121566 GGCGCGCACGGCGGCGGCGGCGG - Intergenic
1082045260 11:47720831-47720853 GCCGGGGGCGGTGGCGGCGGCGG + Intronic
1083752098 11:64766450-64766472 GTGCCGTTCGGTGGTGGCGGCGG - Intronic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084385732 11:68841742-68841764 GTCGCCCGCGGTGGGGAGGGTGG - Intronic
1084891668 11:72239879-72239901 GTGGCGGGCGGTGGGGGCGGCGG - Exonic
1087672820 11:101127782-101127804 GTCGCTCGCGGCGGCAGCGGGGG + Exonic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1090086457 11:123654623-123654645 GTCCGGGGCGGTGGTGGTGGCGG - Intronic
1090327821 11:125904338-125904360 GTGGCGCGCGGAAGGGGCGGAGG - Intronic
1093125368 12:15322445-15322467 GGCAGCCGCGGTGGTGGCGGCGG + Exonic
1096337058 12:50764411-50764433 GTCGCGCGCGGTGGTGGCGGTGG + Intronic
1096502093 12:52070244-52070266 TTCGCGCGTAGTGGCGGCGGGGG + Intronic
1096503576 12:52079872-52079894 GCCGCGCGCGGTGCAGGCGGTGG + Intergenic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1096983677 12:55743250-55743272 GTCCCGCGGGGAGGGGGCGGAGG - Intergenic
1097664808 12:62466748-62466770 GTTGGCCGCGGCGGTGGCGGAGG + Intergenic
1098425845 12:70365763-70365785 CTGGCGCGCGGTGGTGCCGGAGG - Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1101131816 12:101697824-101697846 GCTGCGCTCGGTGGCGGCGGCGG + Exonic
1101504147 12:105330908-105330930 CGCGCCCGCGCTGGTGGCGGTGG - Exonic
1101592795 12:106138891-106138913 GTCGGGCGAGGTGGCGGCGGTGG + Exonic
1101910519 12:108857545-108857567 GGCCCGGGCGGCGGTGGCGGTGG - Exonic
1102006933 12:109595139-109595161 GGCGCAGGCGGTGGTGGCTGTGG + Exonic
1103779523 12:123389449-123389471 GCCCCGCGCGGTGGAGGCGGCGG + Exonic
1105217509 13:18297709-18297731 GCCCTGCGCGGTGGAGGCGGCGG + Intergenic
1107467545 13:40664819-40664841 GGCGCGGGCGGTGGCGGTGGCGG - Intronic
1107549035 13:41457951-41457973 GGCGCGCGCGGAGCTGGTGGTGG - Intronic
1111950816 13:94707703-94707725 GTCGCGCGAGGGGGTGGCTTTGG - Intergenic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112505032 13:99970402-99970424 GCCGGGGGCGGTGGCGGCGGCGG + Exonic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1113441252 13:110330390-110330412 GAGGCGCGGGGTGGAGGCGGGGG + Intronic
1113494022 13:110713929-110713951 GGCGCGGGCCGCGGTGGCGGTGG - Intronic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1114265349 14:21070166-21070188 GTCCCGCGCGGAGGCGGGGGCGG + Intronic
1114485169 14:23057653-23057675 GGCCCGCGCGGCGGGGGCGGGGG + Intergenic
1115028436 14:28767601-28767623 GCGGCGGCCGGTGGTGGCGGTGG - Exonic
1115851783 14:37595136-37595158 GGCGTGCGCGGCGGCGGCGGCGG + Intronic
1116003262 14:39266884-39266906 GGCGGCCGCGGTGGCGGCGGCGG - Intronic
1116928605 14:50668037-50668059 GGCGCCGGCGGAGGTGGCGGCGG - Exonic
1117092796 14:52267720-52267742 GCCGCGCGCGGAGCTGCCGGGGG + Exonic
1117141056 14:52791530-52791552 GGCGCGGGCGGTGGAGGAGGAGG - Exonic
1117417783 14:55513696-55513718 GTGGGGCGGGGTGGCGGCGGTGG - Intergenic
1118748537 14:68790865-68790887 GTCGCGGGCGGTGGCGGGGGCGG - Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1118911341 14:70064536-70064558 GTCGGGGGTGGTGGTGGCGGCGG + Intronic
1119326249 14:73761095-73761117 GGCGGCGGCGGTGGTGGCGGTGG + Intronic
1119425473 14:74532080-74532102 GTGGCGGGAGGTGGTGGGGGTGG - Intronic
1122130729 14:99603451-99603473 GCCGCAAGCGGTGGCGGCGGCGG - Exonic
1122903840 14:104792998-104793020 GTTGCGGGTGGTGGTGGCAGGGG - Exonic
1123025063 14:105420318-105420340 GGCGGCCGCGGGGGTGGCGGGGG + Intronic
1124640364 15:31392823-31392845 GTCGCGGGCGGGGGCGGGGGCGG - Intronic
1125042571 15:35208197-35208219 GTCCCTGGAGGTGGTGGCGGGGG + Intergenic
1125329049 15:38564687-38564709 GGCGGCGGCGGTGGTGGCGGGGG - Exonic
1125916578 15:43493131-43493153 TTCGCGGCCGGTGGCGGCGGTGG - Exonic
1128398681 15:67254798-67254820 GTCGCGCGCGGTGTTGCCATGGG + Intronic
1129146858 15:73656287-73656309 GCCGGGCGTGGTGGTGGTGGTGG - Intergenic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1132229160 15:100168996-100169018 GGCCAGCGCGGTGGTGGTGGGGG + Intronic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132696433 16:1204231-1204253 GTCGCACGGGGTGGTCGCGTGGG - Exonic
1132842307 16:1984106-1984128 GGCGCGCGCCGTGCTCGCGGGGG - Intronic
1133136806 16:3717748-3717770 CTTGCGCGCGGAGGTGGGGGAGG + Intergenic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134315713 16:13117117-13117139 GCCGGGCGTGGTGGTGGCGCAGG - Intronic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1136512762 16:30748994-30749016 TTCGCGGGTGGTGGTGGTGGTGG + Intronic
1139403005 16:66696845-66696867 CTCGAGCGAGGTGGAGGCGGCGG + Intergenic
1141720046 16:85750985-85751007 GGCGCTGGTGGTGGTGGCGGCGG + Exonic
1142049986 16:87951738-87951760 GCCGGGCGCGGTGGGGCCGGGGG - Intronic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1142855210 17:2725228-2725250 GCCGGGCGTGGTGGTGGTGGTGG + Intergenic
1143448643 17:7022988-7023010 GTCGGGGGCGGGGGTGGAGGTGG - Intergenic
1143746953 17:9002143-9002165 GTGGGGGGCGGTGGTGGCGCAGG - Intergenic
1144021220 17:11241262-11241284 GGCGCGGGCGGCAGTGGCGGCGG - Exonic
1144586799 17:16492108-16492130 GTTGCGCGCGGGCGTCGCGGGGG + Intronic
1146339566 17:32007541-32007563 GCCGGGCGCAGTGGCGGCGGTGG - Intergenic
1146773125 17:35587390-35587412 GGCGAGGGCGGGGGTGGCGGCGG - Exonic
1146909783 17:36641387-36641409 GAGGCGCGCTGTGGAGGCGGCGG - Intergenic
1148936333 17:51166725-51166747 GCCGCGCGTGGTGGGGGAGGAGG + Exonic
1150259141 17:63774202-63774224 GGCGGTGGCGGTGGTGGCGGTGG + Exonic
1152245468 17:79182825-79182847 GGGGCGCGCAGAGGTGGCGGCGG - Intronic
1152628593 17:81399615-81399637 GTCACAGGCGGTGGTGGCGGCGG - Exonic
1152634702 17:81426040-81426062 GTGGCTCGTGGTGGTGGTGGTGG + Intronic
1152773841 17:82187682-82187704 GTTGCGGGGGGTGCTGGCGGGGG + Intronic
1153900636 18:9614561-9614583 GACGCGCGCGGGAGGGGCGGCGG + Intronic
1155465791 18:26133880-26133902 GTAGCACGCTGTGTTGGCGGCGG + Exonic
1156099674 18:33578489-33578511 CGCGCGGGCGGTGGCGGCGGCGG - Intergenic
1160204511 18:76822314-76822336 CGCGGGCGCGGTGGGGGCGGGGG - Intergenic
1160578382 18:79869875-79869897 GTCCCGCGTGGTGGTGGCGGCGG - Intronic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160842890 19:1154362-1154384 TTCTCGCTCCGTGGTGGCGGCGG + Exonic
1161234797 19:3192498-3192520 GGCGCGCACGATGGCGGCGGAGG + Exonic
1161607895 19:5224992-5225014 GTGGGGCGTGGTGGTGGTGGTGG - Intronic
1162778651 19:12995607-12995629 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1162860018 19:13499436-13499458 GTCGCAGGGGGTGGTGGGGGGGG + Intronic
1162938437 19:13993734-13993756 GCCGCTGGGGGTGGTGGCGGTGG + Exonic
1163663003 19:18589572-18589594 CTCGCGGGAGGTGCTGGCGGTGG + Exonic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1163757882 19:19117515-19117537 GCCGGGCGCGGTGGGCGCGGTGG + Intergenic
1164594973 19:29526554-29526576 GGGGGGCGCGGTGGCGGCGGGGG - Exonic
1164834508 19:31349104-31349126 GTCGCGCCCGCTGGAGGCGCGGG + Intronic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165939487 19:39408008-39408030 GTAGCGCGAGGGGGTGGTGGAGG - Exonic
1166803693 19:45472767-45472789 GGCAGGGGCGGTGGTGGCGGGGG - Exonic
1167001200 19:46746508-46746530 CGCGCGCGCGGTGGTTGCGGCGG - Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167506385 19:49873171-49873193 CCCGGGCGGGGTGGTGGCGGCGG + Exonic
1167657897 19:50778222-50778244 GCCAGGCGCGGTGGTGGAGGTGG + Intergenic
1167709946 19:51104401-51104423 GCCCGGCGCGGTGGTGGCCGTGG - Exonic
1168556988 19:57351598-57351620 GTCCAGCGCGGTGGAGGCGTGGG + Exonic
925393822 2:3518613-3518635 GTAGCGCTCGGTGGTGGGGTGGG - Intronic
925959769 2:9003789-9003811 GGCGCGGGAGGAGGTGGCGGCGG - Exonic
926216950 2:10911788-10911810 GCGGTGCGCGGTGGTGGCGGCGG + Intergenic
928508334 2:31977673-31977695 GCCAGGCGTGGTGGTGGCGGTGG - Intronic
931881693 2:66576323-66576345 GTCGCGGGGGGTGGCGGGGGTGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934296797 2:91748941-91748963 GCCCCGCGCGCTGGAGGCGGCGG - Intergenic
934763940 2:96870046-96870068 GGCGCCCGCCGTGGTGGCGCGGG - Intronic
935592513 2:104855465-104855487 GGCGGCGGCGGTGGTGGCGGCGG + Intergenic
935592758 2:104856326-104856348 GATGCGCGTGGTGGTGGTGGTGG - Exonic
935775268 2:106466899-106466921 GGCGCGCTCTGTGGAGGCGGCGG - Intronic
935775549 2:106468078-106468100 GGCGCGCTCTGTGGAGGCGGCGG - Intronic
936221995 2:110611037-110611059 GCCGGGGGCGGTGGCGGCGGCGG - Intergenic
937550465 2:123082690-123082712 GTCGGTGGCGGTGGTGGTGGTGG - Intergenic
938817570 2:134919244-134919266 GCAGCGCGTGGTGGTGGCGGCGG + Intronic
941906048 2:170716700-170716722 GGCGGGGGCGGTGGCGGCGGCGG - Exonic
943333895 2:186590554-186590576 GGTGCGCGCGGTGGGGGAGGGGG - Intronic
944675752 2:202033622-202033644 GGCGGGCGCGGGAGTGGCGGAGG - Intergenic
945158302 2:206862116-206862138 GGGGCGGGCGGTGGTGGTGGTGG + Intergenic
946325281 2:218981748-218981770 GTAGAGCGCGGCGGTGGCGGCGG + Exonic
946354885 2:219178353-219178375 ATGGCGAGCGGCGGTGGCGGGGG + Exonic
947593079 2:231395969-231395991 GGCGGGCGCGGCGGCGGCGGCGG + Intronic
1169113223 20:3046306-3046328 CCCGCGCGCGCTGGTGACGGTGG + Intronic
1170890040 20:20368700-20368722 GGCGCGAGCGGAGCTGGCGGAGG + Exonic
1172691521 20:36793639-36793661 GTCCCGCGTGGTGGTGGAGCGGG + Exonic
1173548167 20:43914869-43914891 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1173672892 20:44810365-44810387 GGCGCGCGGCGTGGTGGCGGCGG + Intergenic
1175108277 20:56629422-56629444 CCCGCGCGCGGCGGGGGCGGCGG + Exonic
1175429751 20:58892393-58892415 GGGGGGCGCCGTGGTGGCGGAGG + Intronic
1175847115 20:62065019-62065041 GGCGGGCGCGGGGGCGGCGGGGG + Exonic
1175847346 20:62065675-62065697 GCGGCGCGAGGTGGTGGTGGTGG + Exonic
1175847530 20:62066301-62066323 GCCGTGCGCGGTGGCAGCGGCGG + Intergenic
1176418920 21:6499018-6499040 GGCCGGCGCGGCGGTGGCGGGGG - Intergenic
1178922554 21:36748016-36748038 GCCGGGCGGGGAGGTGGCGGCGG - Exonic
1179694413 21:43107340-43107362 GGCCGGCGCGGCGGTGGCGGGGG - Intronic
1180736810 22:18023737-18023759 GCGGCGCGCGGTGGTGGCCCAGG - Intronic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181478093 22:23180835-23180857 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1181528142 22:23501832-23501854 GTGGCGGGTGGTGGAGGCGGTGG - Intergenic
1181639276 22:24188262-24188284 GGGCCTCGCGGTGGTGGCGGCGG + Exonic
1183752213 22:39728039-39728061 GTGGCGGGGGGTGGCGGCGGGGG - Intergenic
1183752220 22:39728052-39728074 GCGGCGGGGGGTGGTGGCGGGGG - Intergenic
1184136572 22:42553645-42553667 GTCCCGCGCGGACGTGGGGGCGG + Intronic
1184663708 22:45976937-45976959 GGCTCACGCGGCGGTGGCGGCGG - Exonic
949969972 3:9396654-9396676 GAAGCGCGCGCTGGAGGCGGGGG - Intergenic
951611362 3:24495211-24495233 GACTTGCGCGGCGGTGGCGGCGG + Intronic
952045111 3:29309610-29309632 GGGGGGGGCGGTGGTGGCGGTGG + Intronic
955687410 3:61561490-61561512 GGGGCGCGCGGTGGCGGCGGGGG - Intergenic
955911537 3:63863791-63863813 GGCGTGCGCGGCGGCGGCGGCGG + Exonic
960465919 3:117996782-117996804 TTTGCGCGAGGTGGTGGCGACGG - Intergenic
963556530 3:146796000-146796022 GTGGCGGGGGGTGGTGGGGGAGG + Intergenic
965166224 3:165196485-165196507 GACGCTCGCGGCGGCGGCGGCGG + Intronic
967284258 3:187853375-187853397 GTCGGGTGCGGTGGGGGTGGGGG - Intergenic
968831446 4:2934565-2934587 GGCGCGCGGGGTGGGGGCGGTGG - Intronic
969413354 4:7043477-7043499 CTCGTGCGCGGCGGCGGCGGCGG + Exonic
970967882 4:21948857-21948879 GGCGCGCGGGGTGGCGGGGGAGG + Intergenic
971321828 4:25611916-25611938 GGGGGGCGGGGTGGTGGCGGAGG + Intergenic
972960548 4:44447931-44447953 GGAGCGCACGGTGGTGGCGGCGG - Exonic
973236899 4:47914822-47914844 GGGGCGCGTGGTGGTGGAGGCGG + Intronic
973954425 4:56049101-56049123 GTGCCGCGCGGTGGCGGCAGTGG + Intergenic
974047137 4:56907864-56907886 CCCGCGGGCGGTGGCGGCGGCGG + Intronic
974385662 4:61200577-61200599 GTCACAGGCGGCGGTGGCGGCGG - Intergenic
976002179 4:80386498-80386520 CTCGCGGGCGGTGGTGGGGGGGG + Intronic
977810073 4:101347547-101347569 GGCGGGCGCGGTGTTGGCGGCGG - Intronic
981081837 4:140644433-140644455 GACGCGCGGGGCGATGGCGGCGG + Intronic
981366663 4:143912135-143912157 GGCGCCGGCGGAGGTGGCGGCGG - Intergenic
984668099 4:182449195-182449217 GGCGGTGGCGGTGGTGGCGGCGG + Intronic
985696699 5:1344956-1344978 TTCCCCCGCGGCGGTGGCGGTGG - Exonic
986297115 5:6448803-6448825 GCCGGGCCCGGCGGTGGCGGCGG + Exonic
986402789 5:7396047-7396069 CTCCCGCGCGGTGGCGGTGGCGG + Intergenic
986813638 5:11385083-11385105 GTAGAGCGCGGCGGCGGCGGCGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
991467058 5:66924547-66924569 GCCGGGCGCGGTGGTGGACGCGG - Intronic
991587317 5:68214940-68214962 GTCGGGGGCGGGGTTGGCGGGGG - Intergenic
991972396 5:72153596-72153618 GTGGCGTGTGGTGGTGGTGGTGG + Intronic
994043624 5:95284668-95284690 GGCGCTGGCGGTGGCGGCGGCGG + Intergenic
994361528 5:98855130-98855152 GTAGGGGGCGGTGGTGGTGGTGG + Exonic
996404256 5:123090456-123090478 GTCAAGTGCGGTGGTGGTGGCGG + Exonic
997869972 5:137498531-137498553 GGCGATCGCGGTGTTGGCGGCGG - Exonic
998143230 5:139711334-139711356 GACGCGCTCGGCGGCGGCGGCGG - Intergenic
998200474 5:140114272-140114294 GGCGGGGGCGGTGGTGGCGGCGG + Exonic
1001094846 5:168768110-168768132 GTGTCCAGCGGTGGTGGCGGCGG + Intronic
1001556603 5:172641378-172641400 GTCGGGCGCGGCGTTGGCGGCGG - Exonic
1002352053 5:178590166-178590188 GGCGAGCGCGCCGGTGGCGGCGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002691372 5:181053005-181053027 GGCGCGCGCGGCGGAGGGGGCGG - Intronic
1002927344 6:1611900-1611922 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1004663347 6:17729032-17729054 GGAGCCGGCGGTGGTGGCGGCGG - Intergenic
1005826138 6:29632787-29632809 GGCGCGCGGCGTGGTGGGGGAGG - Intronic
1006337436 6:33427992-33428014 GCCCGGCGCGGTGGGGGCGGCGG - Intronic
1007665353 6:43510142-43510164 GTCCCTCGCGGTCGCGGCGGCGG + Exonic
1007737696 6:43991805-43991827 GTCGGGGGCGGCGGGGGCGGGGG + Intergenic
1008598404 6:53065555-53065577 GGGGCGCGCTGGGGTGGCGGCGG - Intronic
1009622432 6:66094755-66094777 GACGTAAGCGGTGGTGGCGGTGG + Intergenic
1010141957 6:72622385-72622407 GCCACGCTCGGTGGCGGCGGCGG + Exonic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1012400003 6:98835084-98835106 GGCGGGGGCGGTGGCGGCGGCGG + Exonic
1013155874 6:107490552-107490574 GCCGCCGGCGGTGGTGGTGGCGG - Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013441924 6:110179678-110179700 CTCGCGCGGGGAGGGGGCGGGGG - Exonic
1013482637 6:110565617-110565639 GTCGGGCGTGGTGGTGGTGGGGG - Intergenic
1017073965 6:150600522-150600544 GGGACGCGCGGTGGGGGCGGCGG + Intronic
1017174986 6:151494204-151494226 GCCGCGCGCGGGGGTGGCCCTGG + Intronic
1017672120 6:156778226-156778248 GTAGTGCGTGGTGGTGGTGGAGG - Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1019111927 6:169724009-169724031 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1019399387 7:843383-843405 GTTGTGCGCGGTGGCGGCGGCGG - Exonic
1022960181 7:35418896-35418918 GGCGGTGGCGGTGGTGGCGGCGG + Intergenic
1023881935 7:44325662-44325684 GGCGGGCGCGGCGGCGGCGGCGG - Intronic
1024520948 7:50304035-50304057 GGTGCGCGCGGGGGTGGCGGCGG + Intergenic
1025916891 7:65873246-65873268 GGCGGCGGCGGTGGTGGCGGCGG + Intronic
1027035446 7:74922023-74922045 GTAGCGGGGGGTGGTGGCGCAGG - Intergenic
1029297379 7:99551943-99551965 GTCCCGGGCGGTCGTGGCGAGGG + Exonic
1029364361 7:100107501-100107523 GGGGGGTGCGGTGGTGGCGGTGG + Exonic
1029372491 7:100158427-100158449 GCCGCGCGCGGAGCTGGCAGGGG - Exonic
1029538781 7:101171189-101171211 GCCGGGCGGGGTGGTGGTGGTGG - Exonic
1032230629 7:130070692-130070714 GCCGCCGGCGCTGGTGGCGGAGG + Exonic
1033120736 7:138664800-138664822 GTCGAGCGCCGGGGTGGCGGAGG - Intronic
1033300073 7:140177274-140177296 GACACGCGCGGTGGTGGCGGTGG + Intergenic
1034182215 7:149147676-149147698 GCCGGGCGCGGTGGCAGCGGCGG + Exonic
1034223003 7:149460194-149460216 GCCGCGCGCAGTAGCGGCGGCGG - Intronic
1034494146 7:151410101-151410123 GGCGCGCGGGGTGGGGGCTGGGG - Intronic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1037535223 8:19817432-19817454 CTCCCCCGCGGTGGCGGCGGCGG + Exonic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1039784986 8:40826707-40826729 GTGGTGTGCGGTGGTGGAGGTGG - Intronic
1041690391 8:60680394-60680416 GTCGCGGGGGGGGGGGGCGGGGG + Intronic
1043335388 8:79170079-79170101 GTGGGGCGGGGTGGGGGCGGGGG - Intergenic
1045489101 8:102655763-102655785 GCCGCGGGCGGGGGTGGGGGCGG + Exonic
1047931133 8:129728927-129728949 GAGGCCCGAGGTGGTGGCGGTGG + Intergenic
1048345535 8:133572068-133572090 GCCGCGCGCAGGGGAGGCGGTGG - Intergenic
1048981173 8:139703923-139703945 GGCGGGCGCGGCGGCGGCGGCGG + Intergenic
1049114769 8:140676596-140676618 GCCGCGGTCGGTGGGGGCGGGGG + Intronic
1049405323 8:142449724-142449746 GGCGGGCGCGGCGTTGGCGGCGG + Exonic
1049548538 8:143246100-143246122 CGCGCACGCGGTGGCGGCGGCGG + Intergenic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1053003210 9:34589323-34589345 GTTGGGCGTGGTGGTGGTGGTGG - Intronic
1055266309 9:74498812-74498834 GTCGCAGGCGGTGGCGGCGGCGG + Intronic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1060311220 9:122464300-122464322 CTGGCGGGCGGTGGGGGCGGGGG - Intergenic
1061050295 9:128191315-128191337 GGGGCGCGAGGAGGTGGCGGTGG - Intronic
1061453502 9:130681626-130681648 GTGGTGCGCGGCGGCGGCGGCGG - Exonic
1061453670 9:130682125-130682147 GTCGGGCGCGGGGGTTGTGGGGG + Exonic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062441408 9:136571359-136571381 GTGGCGCGGTGTGGTGGCTGAGG - Intergenic
1062461953 9:136665919-136665941 GCCGCGCGCGGAGCTGGGGGCGG + Intronic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062653544 9:137590476-137590498 GGTGCGCGCGGTGGCGGTGGCGG - Exonic
1186426070 X:9465133-9465155 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1187181400 X:16946739-16946761 GGCGGCGGCGGTGGTGGCGGCGG + Exonic
1187226038 X:17375965-17375987 GGCGCGGGCAGTGGCGGCGGCGG - Exonic
1187547389 X:20267065-20267087 GGTGCGCGCGGCGGTGGTGGCGG - Intronic
1187688435 X:21839746-21839768 GTCGCTGGTGGTGGTGGTGGTGG + Exonic
1189325633 X:40109267-40109289 GGAGCGCGCGGGGGTGGGGGTGG - Intronic
1189407120 X:40735357-40735379 GTCCCGCCCGGAGGCGGCGGCGG - Exonic
1190245703 X:48688914-48688936 GGCGGTGGCGGTGGTGGCGGTGG - Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192361757 X:70445121-70445143 GGCGGCGGCGGTGGTGGCGGCGG + Exonic
1194688910 X:96957897-96957919 GGCGCGGGTGGTGGTGGAGGCGG - Exonic
1195688348 X:107604553-107604575 GTTGGCAGCGGTGGTGGCGGTGG - Exonic
1198807277 X:140504663-140504685 GGTGCGAGCGGAGGTGGCGGGGG - Exonic
1200229537 X:154437161-154437183 GTCCAGTGCGGTGGCGGCGGCGG + Exonic