ID: 1096340024

View in Genome Browser
Species Human (GRCh38)
Location 12:50790021-50790043
Sequence CAGAAACCTTTGAGGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 1, 2: 5, 3: 36, 4: 413}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096340018_1096340024 8 Left 1096340018 12:50789990-50790012 CCCATAGCCTGCATTAAATCACA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG 0: 1
1: 1
2: 5
3: 36
4: 413
1096340016_1096340024 26 Left 1096340016 12:50789972-50789994 CCTTTTCAACCTGACAGACCCAT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG 0: 1
1: 1
2: 5
3: 36
4: 413
1096340019_1096340024 7 Left 1096340019 12:50789991-50790013 CCATAGCCTGCATTAAATCACAT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG 0: 1
1: 1
2: 5
3: 36
4: 413
1096340017_1096340024 17 Left 1096340017 12:50789981-50790003 CCTGACAGACCCATAGCCTGCAT 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG 0: 1
1: 1
2: 5
3: 36
4: 413
1096340021_1096340024 1 Left 1096340021 12:50789997-50790019 CCTGCATTAAATCACATGGATTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG 0: 1
1: 1
2: 5
3: 36
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096340024 Original CRISPR CAGAAACCTTTGAGGAATGA TGG Intronic
900282092 1:1876671-1876693 GAGAAGCATTTCAGGAATGAAGG + Intronic
900508529 1:3043849-3043871 CAGAAATCTTTCATGAAAGAAGG - Intergenic
901437648 1:9257797-9257819 CAGAAGCCTTTGAGAAATGATGG + Intronic
903768938 1:25751988-25752010 CACAAAGGTTTGTGGAATGAAGG + Intronic
904434820 1:30487576-30487598 CAGAAACCTTATGGGACTGAGGG + Intergenic
904891050 1:33779887-33779909 AATAAACTTTTGAGGCATGATGG + Intronic
906049868 1:42861597-42861619 CAGAAACCTTATAGGCAAGAGGG + Intergenic
906055616 1:42914466-42914488 CAGAAACCTTACAGGACAGAAGG + Intergenic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
907002226 1:50872943-50872965 CAGAAACCTCTCATGAAAGAAGG + Intronic
907886487 1:58596886-58596908 CAGTGACATTGGAGGAATGAAGG - Intergenic
908041215 1:60115840-60115862 CAAAAACCTTTTTGGAAGGATGG + Intergenic
908052578 1:60248612-60248634 CCCAGACCTTTCAGGAATGAAGG + Intergenic
908686656 1:66727909-66727931 AAGAAAACTTTCAGGGATGATGG + Intronic
909410022 1:75339516-75339538 CAGAAAGCTTTGGGGGATGGGGG - Intronic
910579735 1:88810021-88810043 TAGAGAAATTTGAGGAATGAAGG + Intronic
911246186 1:95520605-95520627 CAGAAAGCTTGGAGGAGAGAAGG + Intergenic
911669326 1:100590831-100590853 CAGAGACCTGTCAGGAGTGAGGG + Intergenic
911758566 1:101589415-101589437 CAGGATCCTTTCTGGAATGAGGG - Intergenic
912987469 1:114449036-114449058 AAAAAACCTTTGAGAGATGAAGG + Intronic
912991119 1:114487424-114487446 CAAATACCCTTCAGGAATGAAGG + Intronic
913310467 1:117485887-117485909 TAGAATACTTTGAGGAAGGATGG - Intronic
914944846 1:152054898-152054920 CATAAATATTTGTGGAATGAAGG + Intergenic
915458878 1:156057904-156057926 GAGAAGCCTTTGGGGAAGGAGGG + Intronic
916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG + Intronic
916668525 1:166989720-166989742 CAGAAGCTTTTGGGGATTGAAGG - Exonic
917313928 1:173705159-173705181 CAGACATCCTTCAGGAATGAGGG - Intergenic
918230397 1:182525136-182525158 CAGCAACCTTTGGTGGATGAGGG + Intronic
920176934 1:204107830-204107852 CAGACACCTGTGAGGATGGAAGG + Intronic
920879908 1:209870130-209870152 CAGAGATCATTTAGGAATGATGG + Intergenic
921330750 1:214033175-214033197 CAGAGAGCTTTGAGGGGTGAAGG - Intronic
921426369 1:215005853-215005875 AAGAAACCTTGGAGGAAGAACGG + Intronic
921544183 1:216454573-216454595 CAGAATCCTTGGAGGAAGTATGG - Intergenic
922376013 1:224967428-224967450 CAGAAACCTTTGGAAGATGATGG + Exonic
922865443 1:228857295-228857317 CAGAAAACTTTGAGGCCAGAAGG - Intergenic
923910002 1:238430970-238430992 CAGAAACTTTTGGGAATTGATGG + Intergenic
924005688 1:239608333-239608355 AAGCAACCTTTGAACAATGAGGG - Intronic
1063281423 10:4633428-4633450 CAGCGCCCTTTGAGGAATGAGGG + Intergenic
1063306477 10:4907166-4907188 CAGAAACCTTGGAGGCCAGAAGG - Intergenic
1064647214 10:17471944-17471966 CAAAAACCTTTGAAAAATGTAGG + Intergenic
1065790318 10:29254481-29254503 CAGAAATTTTTAAGGAAAGAAGG - Intergenic
1066169804 10:32829224-32829246 CACAGACCCTTCAGGAATGAAGG + Intronic
1066211799 10:33247492-33247514 GGGAAACCTTGGAGGACTGAAGG + Intronic
1066699490 10:38111883-38111905 CAGAAACCTTGGAGGTTAGAAGG - Intronic
1066787607 10:39022943-39022965 GTGAAACCTTTGAGGACTGTGGG - Intergenic
1066992902 10:42533336-42533358 CAGAAACCTTGGAGGTTAGAAGG + Intergenic
1067720553 10:48724637-48724659 CAGAAACCCTTGAGCAATGCAGG - Intronic
1068079333 10:52300271-52300293 GAGAAACATTTCAGGAATGGTGG + Intergenic
1068524627 10:58114088-58114110 CAGAAACCTATGAATAAAGAAGG + Intergenic
1069700384 10:70420548-70420570 AAGAAACCTTTGGGGGAGGAGGG - Intronic
1070583246 10:77740303-77740325 CAGAGACCTTTGAGGCAGGTGGG + Intergenic
1070939527 10:80331453-80331475 CAAAAACCTTGGAGGACAGAAGG + Intergenic
1071706958 10:88009522-88009544 CAGAAACCTTGGAGTCATGCTGG - Intergenic
1071946857 10:90655793-90655815 CCCACACCTTTCAGGAATGAAGG - Intergenic
1072146242 10:92641411-92641433 AAAATACCTTTCAGGAATGAAGG - Intronic
1072710970 10:97715202-97715224 CAGAAGCCTGTGAGGAAGGCTGG - Exonic
1072851652 10:98900447-98900469 GAGAAAACTTTGGGGGATGATGG + Intronic
1073622252 10:105061705-105061727 CCACCACCTTTGAGGAATGAGGG + Intronic
1073750173 10:106516671-106516693 CAGAAAGCTTTGAGCAAAGGTGG - Intergenic
1074896111 10:117778955-117778977 GGGCAACCTTTGAGCAATGAAGG - Intergenic
1075976280 10:126698420-126698442 AAGAAACTTTTGAGTAATTAGGG + Intergenic
1076059694 10:127404092-127404114 CAGATTCCCTTGCGGAATGATGG + Intronic
1076462264 10:130655463-130655485 CAGACACGTTTGAGGTCTGAGGG - Intergenic
1077459981 11:2704186-2704208 CAGAAACCTATGACCAGTGAAGG - Intronic
1078408889 11:11095265-11095287 CAGAGACCTTTGGGGATTGATGG + Intergenic
1080219481 11:29884512-29884534 CAGAATGCTTTGAGGAATTGAGG + Intergenic
1084230607 11:67750037-67750059 CAGATGCCTTTGAGGAGAGATGG + Intergenic
1084698227 11:70768940-70768962 CAGACACCTTTGGGGAAAGCTGG - Intronic
1085561999 11:77480231-77480253 CAGAAACCTGAAAGGAGTGAGGG - Intergenic
1086072308 11:82812858-82812880 CAGAAAACTTTAAGGATGGAAGG - Intergenic
1087375786 11:97337922-97337944 AAGAAACCTGTGAGTAATAATGG + Intergenic
1087931222 11:103980311-103980333 CAGAATTCTATGAGAAATGAAGG + Intronic
1088303697 11:108386056-108386078 CAGAAATCTTAGATTAATGATGG + Intronic
1088836916 11:113585266-113585288 CCCACACCTTTCAGGAATGAAGG + Intergenic
1089635894 11:119811609-119811631 AAGAAACTTTTGGGGAGTGATGG - Intergenic
1090220706 11:125021251-125021273 CAGAAAAGTTTCAGGAAGGAGGG + Intronic
1090284647 11:125489244-125489266 TTGAAACCTTAGAGGAATGAAGG - Intronic
1091000198 11:131904615-131904637 CAGGCACCTTGGAGCAATGAAGG + Intronic
1091088125 11:132743416-132743438 CAGAAACCCTCCAGGAAGGAAGG + Intronic
1091173293 11:133537580-133537602 CAGAGACCTTTGAGGGAGGATGG - Intergenic
1091249650 11:134132238-134132260 CAGAAACCTTGGAGGCCAGAAGG + Intronic
1091757190 12:3061692-3061714 CAGAGATCTTTGAAGAAGGAGGG - Intergenic
1093056290 12:14558990-14559012 GAGAAAACATTGAGGAATGGAGG - Intronic
1093409710 12:18849905-18849927 GGGAAACCTTTGGGGAATGCAGG - Intergenic
1093613488 12:21191702-21191724 CAGAAAGCTTTCAGGAACAAAGG - Intronic
1093618789 12:21262621-21262643 CAGAAACTTTGGAGGCAAGAAGG - Intergenic
1093843097 12:23930067-23930089 CACAAACCTTAGTGGAATGAAGG + Intronic
1094151127 12:27284831-27284853 CAAAAAACTTTGAGGCAGGAAGG - Intronic
1095479134 12:42615873-42615895 CAGACTGCTTTGAGGAATTAAGG - Intergenic
1095555427 12:43498177-43498199 CAGAAACCTTTAAGTAAGAAGGG + Intronic
1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG + Intronic
1096949205 12:55447258-55447280 CAGAAACTTTGGAGGAGTGATGG - Intergenic
1097294456 12:57947505-57947527 CAGGAACATGTGGGGAATGAGGG + Intronic
1097557677 12:61159913-61159935 CAGGACCCTTTCAGGAATGGGGG + Intergenic
1098356438 12:69616969-69616991 CAAAACCCTTTCTGGAATGAGGG - Intergenic
1099508958 12:83509859-83509881 CACAGACCCTTCAGGAATGAAGG + Intergenic
1099715818 12:86292068-86292090 CAGAGACATTTGAGGATTGTAGG + Intronic
1101207060 12:102499048-102499070 AAGAAATCTTTAATGAATGAAGG - Intergenic
1101867257 12:108529405-108529427 AAGGAACCTTGGAGAAATGATGG + Intronic
1104738598 12:131155491-131155513 CAGAAATCTTTGAGCAATCAGGG - Intergenic
1104973800 12:132543076-132543098 CAGATGCCTCTGAGGGATGAGGG + Intronic
1105058261 12:133123840-133123862 AAGAAAACTATGAGGAATGAAGG - Intronic
1105573506 13:21626613-21626635 AAGAAACCTTTGTGTAGTGAAGG - Intergenic
1105748831 13:23402638-23402660 CAGACAGTTTTAAGGAATGAAGG + Intronic
1105997217 13:25684294-25684316 TAGCAACATTTGAGGAATAAAGG - Intronic
1106767048 13:32923548-32923570 CAGAGACCTTTAAGGACGGAAGG + Intergenic
1107152254 13:37125415-37125437 CAGAAACCTTTGCAGAAGGTAGG + Intergenic
1108970213 13:56365430-56365452 CAGATACATTTTAGGACTGATGG - Intergenic
1109510379 13:63364547-63364569 CTGAAACCTTTTATAAATGAAGG + Intergenic
1109950769 13:69500330-69500352 CCCAGACCTTTCAGGAATGAAGG - Intergenic
1110780383 13:79458900-79458922 CACAAACATTTGAGGAGAGAGGG - Intergenic
1111016069 13:82383867-82383889 AAGAAACATTTTAGGAATTAAGG - Intergenic
1111441126 13:88283605-88283627 CCAAAACCCTTCAGGAATGAAGG + Intergenic
1111792838 13:92880420-92880442 CTGAAACCGTAGAGGAATGTGGG - Intergenic
1111933222 13:94532970-94532992 CTTACACCTTTGAGAAATGATGG - Intergenic
1111933247 13:94533272-94533294 CTTACACCTTTGAGAAATGATGG - Intergenic
1111941157 13:94608457-94608479 CAGGAATTTTAGAGGAATGAAGG + Intronic
1112640839 13:101273239-101273261 CAGCAGCCGCTGAGGAATGAGGG + Intronic
1112773391 13:102817389-102817411 GTGAAACCTTTGAAGTATGAGGG - Intronic
1113064213 13:106357510-106357532 TAGAGACCTTTGAGCAAAGAAGG + Intergenic
1113128318 13:107005877-107005899 AAGAAAGCTTTTAGGAATGTAGG - Intergenic
1114130819 14:19789609-19789631 AAGAAACCTTTCTGGAGTGATGG + Intronic
1114583333 14:23785594-23785616 GAAAATCCTATGAGGAATGAGGG - Intergenic
1115284684 14:31704060-31704082 CACAAATCTTTGAGGAAAAATGG + Intronic
1116158139 14:41234770-41234792 CCCAGACCTTTCAGGAATGAAGG - Intergenic
1116233155 14:42243669-42243691 CAGACTGCTTTGAGGAATGGAGG - Intergenic
1116323631 14:43501774-43501796 CAGAAAACTTGGTGGACTGATGG - Intergenic
1116477208 14:45354297-45354319 CATAAACCTTTGAAAAATAAAGG - Intergenic
1116623015 14:47230011-47230033 AAGAAACTTTTAAGGAAAGATGG - Intronic
1117521068 14:56551959-56551981 CAGCAACATTTCAGGAATAATGG + Intronic
1118155880 14:63241258-63241280 CAGAAAACTTAGAGGACAGATGG - Intronic
1118238628 14:64036007-64036029 CAAAAAAGTTTGAGGAATGTAGG + Intronic
1119671492 14:76522792-76522814 CAAAAACCCTTCAGGAATGAAGG - Intergenic
1120817058 14:88872256-88872278 GAGATACCTATGAGGAAAGAAGG + Intronic
1121641009 14:95484862-95484884 CAAAATCCTTTGAGGAACGGTGG + Intergenic
1122412361 14:101532165-101532187 CAGAACCTTTTGGGAAATGAAGG + Intergenic
1123573867 15:21645242-21645264 AAGAAACCTTTCTGGAGTGACGG + Intergenic
1123610485 15:22087827-22087849 AAGAAACCTTTCTGGAGTGACGG + Intergenic
1124586118 15:31009371-31009393 CAGAAACCTTGGAGGTCAGAAGG - Intronic
1127408326 15:58677729-58677751 GAAAACCTTTTGAGGAATGAAGG - Intronic
1127526869 15:59801783-59801805 CAAGAGCCTTTGAGGAATGCAGG + Intergenic
1127883441 15:63178296-63178318 CAGGAAGCTGTGAGGAAAGACGG - Intergenic
1128535873 15:68489836-68489858 TAAAAGCCTTTGTGGAATGATGG + Intergenic
1129413061 15:75360382-75360404 CAGAAACCCCTGAAGAAAGAAGG - Intronic
1129914983 15:79260892-79260914 CAGGAACCTGGGAGGGATGAGGG + Intergenic
1130090980 15:80821188-80821210 CAGACAACTCAGAGGAATGAGGG + Intronic
1130297768 15:82659323-82659345 CAGAAATCTGGGAGGACTGAAGG + Intronic
1202982732 15_KI270727v1_random:379581-379603 AAGAAACCTTTCTGGAGTGACGG + Intergenic
1133428365 16:5713272-5713294 CGGTAACCTTTGAGCGATGAGGG + Intergenic
1133880622 16:9778259-9778281 CAGAAACCTTGTAGGAATCCAGG + Intronic
1134648867 16:15892528-15892550 CAGAACCCTTTCTGGAATGAGGG - Intergenic
1135266856 16:21034150-21034172 CAGAAGTCAATGAGGAATGAGGG + Intronic
1135938378 16:26800021-26800043 CAGAAGTCTTTGAGGAGTGAGGG + Intergenic
1136015629 16:27398901-27398923 AAGGAACCTTTCAGGAGTGATGG + Intergenic
1136048651 16:27635165-27635187 CAGAAATCTATAAGGAATAATGG + Intronic
1136749868 16:32625002-32625024 CAGAAACCTTGGAGGCCAGAAGG - Intergenic
1137257271 16:46786683-46786705 CAGAAACCTTGCAGGACAGAAGG + Intronic
1137421462 16:48338441-48338463 GGGAAACATTTGGGGAATGAAGG + Intronic
1138912594 16:61420185-61420207 CAGAAAACATTGAGGTATAATGG + Intergenic
1140171221 16:72607089-72607111 TAGTATCCTTTGAGGAATGAAGG - Intergenic
1141101916 16:81203648-81203670 CAGAAACCTCTGAGCAGAGATGG - Intergenic
1203052002 16_KI270728v1_random:884200-884222 CAGAAACCTTGGAGGCCAGAAGG - Intergenic
1143882626 17:10041228-10041250 CACAAACCTGTAAGGACTGAAGG - Intronic
1144019842 17:11230845-11230867 CTGAAACATTTGTGAAATGAAGG - Intergenic
1144258903 17:13498579-13498601 CAGGACCCTCTCAGGAATGAAGG - Intronic
1144694320 17:17291606-17291628 GGGGAACCTTTGAGGAGTGATGG - Intergenic
1146292501 17:31620141-31620163 CAGAAACCATGGAGGACAGAAGG - Intergenic
1146410504 17:32579610-32579632 AAGAAACCTTTGGGGAGTAATGG - Intronic
1146457381 17:33018246-33018268 CAGAAAACTTTGAATAATGGGGG - Intronic
1146491860 17:33289172-33289194 CACATACCTTTGGGGAATGGAGG + Intronic
1149789068 17:59461603-59461625 CAGACACCTTTGAGGTTGGATGG - Intergenic
1150598206 17:66626023-66626045 CAGCATCCTTTTAGGAAAGATGG + Intronic
1153105989 18:1527611-1527633 CAGAAACTTTTGAGAATTTAAGG + Intergenic
1153244621 18:3061635-3061657 CAGAAGCCTGTGAGCAAAGAGGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154068718 18:11132937-11132959 CCCAAACCCTTCAGGAATGAAGG + Intronic
1155734858 18:29209082-29209104 CAGATAACTTTGAGGAACTAAGG + Intergenic
1155865050 18:30954602-30954624 CAGTAGCCTTTGATGAATGGAGG - Intergenic
1156233423 18:35177782-35177804 AAGGAAACTTTGAGGGATGATGG + Intergenic
1156537881 18:37881148-37881170 CCCAGACCTTTCAGGAATGAAGG + Intergenic
1157277101 18:46318776-46318798 CAGCACCCTCTGTGGAATGAGGG + Intergenic
1157571518 18:48715515-48715537 CAGAAAGCTTTGAGAAAAGGGGG - Intronic
1157667415 18:49499372-49499394 CAGACACCTCCCAGGAATGAAGG - Intergenic
1158231340 18:55259036-55259058 CACAAAACTTTCAGAAATGATGG - Intronic
1159288035 18:66377353-66377375 CACAAGCCCTTCAGGAATGAAGG + Intergenic
1160369008 18:78355651-78355673 CAGAAAACTGGGAGGAAAGAGGG + Intergenic
1160444258 18:78914785-78914807 TAGAAATCTTCGATGAATGAGGG - Intergenic
1161554089 19:4930700-4930722 CATTGACCTGTGAGGAATGAGGG - Exonic
1164796549 19:31038276-31038298 CTGAAACTTGTGTGGAATGAGGG - Intergenic
1166578463 19:43867818-43867840 GAGAGAACTTTTAGGAATGATGG + Intergenic
1167516774 19:49928103-49928125 CAGACACTTTAGAGGGATGAGGG + Exonic
1168021615 19:53612916-53612938 CAGAAGCCTCTCTGGAATGAGGG + Intergenic
925354958 2:3234159-3234181 CAAAAAACTTGCAGGAATGAGGG + Intronic
925546760 2:5024726-5024748 CAGCACCCTGTGAGGAGTGAGGG - Intergenic
926378268 2:12257256-12257278 CAGAGCCCTTTGAGGCTTGATGG + Intergenic
926874527 2:17460183-17460205 CAGAAGCCTCAGATGAATGATGG + Intergenic
928471672 2:31581558-31581580 GAGAAACCGCTGAGGAATTAGGG - Intergenic
928572704 2:32625091-32625113 AAGGAAACTTTGAGGAGTGATGG + Intergenic
928645308 2:33346222-33346244 CATATTCCTTTGAGAAATGAAGG - Intronic
928772796 2:34721983-34722005 CAGAAACCTGTGAGGAACAAAGG - Intergenic
929110347 2:38401375-38401397 CAGAAATCTTTGAAGAAATATGG - Intergenic
930036803 2:47090964-47090986 GAGCAAACTTTGAGGAAGGAGGG + Intronic
930478676 2:51918821-51918843 CTGATAACTCTGAGGAATGATGG + Intergenic
931794314 2:65694786-65694808 CAGAGACCTGTGAAGAGTGAGGG + Intergenic
932293363 2:70603727-70603749 CAGAAACCACTGAGGCCTGAAGG - Intergenic
932296711 2:70630283-70630305 CTAAAATCTTTGAGGAATAAAGG + Intronic
932870428 2:75393201-75393223 CACAGACCTTTCAGGAATAAAGG - Intergenic
933481167 2:82858804-82858826 GAGATGCCTTTGAGAAATGAAGG + Intergenic
933988838 2:87617963-87617985 CAGATATCCTTGAGAAATGAAGG + Intergenic
934232603 2:90198835-90198857 TAGAAACGTTTGCAGAATGAGGG - Intergenic
935466436 2:103403778-103403800 GAGAAACCCTTGAATAATGAAGG + Intergenic
935551205 2:104457479-104457501 GAGAAATCTTTCAGGAATTAGGG - Intergenic
936305006 2:111332860-111332882 CAGATATCCTTGAGAAATGAAGG - Intergenic
937249977 2:120517486-120517508 CAAAAACCTTGGAGGAATCCTGG - Intergenic
939070979 2:137542265-137542287 CAGAAACCGTGGAGGCAAGAAGG + Intronic
939487416 2:142832194-142832216 TAGAAAACTTTTAGGGATGATGG + Intergenic
940571549 2:155442423-155442445 CAGAGAGCTTTGAGAATTGATGG + Intergenic
942488491 2:176465598-176465620 TAGAAAGCTTTAAAGAATGAAGG - Intergenic
943442366 2:187941841-187941863 CAGAAACTGTTGAGTAATGTGGG - Intergenic
943747364 2:191476209-191476231 CAGAAAGCTGTGGGAAATGATGG + Intergenic
947060240 2:226156367-226156389 CACAAACCCTGAAGGAATGAGGG - Intergenic
947122188 2:226828081-226828103 GAGAAAACTTTTTGGAATGATGG - Intergenic
947310005 2:228791311-228791333 CAGAAAGCTTTTAGTCATGATGG + Intergenic
948719072 2:239885121-239885143 CAGAAACAATGGAGGACTGAAGG + Intergenic
1168885732 20:1252910-1252932 CAGAAACCCTTCTGAAATGAAGG - Intronic
1169420610 20:5455987-5456009 CAGAAAGTTTTGAGGAATGGAGG - Intergenic
1169680200 20:8203645-8203667 CAGAAACATTTAATGCATGATGG + Intronic
1170174980 20:13459065-13459087 CATAAATCTTTGAGGGGTGATGG - Intronic
1170718488 20:18853124-18853146 CAGAAACTTTGGAGGACAGAAGG - Intergenic
1171058102 20:21927574-21927596 GAGATGCCTTTGAGAAATGAAGG - Intergenic
1173777950 20:45727063-45727085 AAGAATCCTCTGAGGAAAGAAGG + Intergenic
1177464861 21:21463650-21463672 CAGAAACATGTGAGGAAACAGGG + Intronic
1177491370 21:21830275-21830297 CAAATATCTTTGAGAAATGATGG - Intergenic
1178429054 21:32503015-32503037 CAGATGCCTTTGAGGAGAGACGG - Intronic
1179223001 21:39426122-39426144 CAGACACGTTTGGGGAATAAGGG - Intronic
1179241362 21:39596002-39596024 CAGAGACCTTTGAGGCATGAAGG + Intronic
1179258450 21:39737861-39737883 CAGGACCCTTTCTGGAATGAGGG + Intergenic
1179440253 21:41388435-41388457 CAGAAACCCGCGAGGAATGAAGG - Intronic
1179457839 21:41511724-41511746 CCCAGACCCTTGAGGAATGAAGG - Intronic
1179897706 21:44371785-44371807 CAGAAATCTTTGAGGTCAGAGGG - Intronic
1181086133 22:20440248-20440270 CAGAAACCTCTGAGGTCTGCAGG + Intronic
1181913745 22:26262381-26262403 CAGAAATCTTTGAGGGAAAAAGG + Intronic
1182714851 22:32349608-32349630 CAGTAATCTTTGGGGAATAAAGG - Intergenic
1183130643 22:35831881-35831903 CAGTAACCTTTGAGGGATCAGGG + Intronic
1183364120 22:37398273-37398295 CAGGGGCCTTTGAGGAATAAAGG - Intronic
1183420229 22:37707550-37707572 CAGAATCCTTGGAGGAAAAATGG - Intronic
1184195950 22:42928157-42928179 CATAAACCCTTGAGAAAGGACGG + Intronic
1184542908 22:45141461-45141483 CAGTTACCTCTGAGGAAGGAAGG + Intergenic
949090858 3:27364-27386 AAGAAACCTGTCAGTAATGATGG + Intergenic
949417331 3:3829026-3829048 CCCAGACCTTTCAGGAATGAAGG - Intronic
950153015 3:10703100-10703122 GAGAGACCTTTGAAGAATGACGG - Intronic
950806149 3:15604451-15604473 CAGAAACCTAGGAGGAAAAATGG - Intronic
950930611 3:16785173-16785195 CAGGACCCTTTCTGGAATGAGGG + Intergenic
951173384 3:19569372-19569394 CAGAAAAGTGTGAAGAATGATGG - Intergenic
952617927 3:35297728-35297750 CAGAAGTGTTAGAGGAATGAAGG - Intergenic
952982109 3:38745109-38745131 CAGCCACCTGTGAGGCATGATGG + Intronic
953361917 3:42304939-42304961 CAGAAAACTTTGAGGGGAGATGG - Intergenic
953381580 3:42476535-42476557 CAGGAGCCTTTGAAGAAGGAGGG - Intergenic
955542411 3:59991643-59991665 CAGAAAGCATTCAGGACTGATGG - Intronic
956703639 3:71981016-71981038 CCCAGACCTTTCAGGAATGAAGG - Intergenic
957047168 3:75385057-75385079 CAGATGCCTTTGAGGAGAGATGG + Intergenic
957460699 3:80515366-80515388 AATAAACATTTGATGAATGAAGG + Intergenic
958057998 3:88438549-88438571 CAGAACCCCTTCTGGAATGAGGG - Intergenic
959419888 3:106116478-106116500 CAGAAACCTTGGAGGTCAGAGGG - Intergenic
961879239 3:130049153-130049175 CAGATGCCTTTGAGGAGAGATGG + Intergenic
963079035 3:141374354-141374376 CTGAAACCTTTGAGGAATGATGG + Intronic
963837463 3:150071531-150071553 CAGGAACCTGTGAGGAATTCAGG + Intergenic
965545482 3:169911292-169911314 CTGAAACATTTGATGAAAGATGG - Intergenic
966706546 3:182922663-182922685 AAGGGACCCTTGAGGAATGACGG - Intergenic
966744213 3:183260213-183260235 CAACAACCTTTGAGGAAGAAAGG - Intronic
967068772 3:185943764-185943786 CAGAAACCTTTAAGGTGTCAGGG - Intergenic
967750749 3:193113637-193113659 CAGATACCTTTAAGGAACTAAGG + Intergenic
968991469 4:3916177-3916199 CAGATGCCTTTGAGGAAAGATGG + Intergenic
969123953 4:4932080-4932102 CCTAAAGCTTTGAGGAGTGAAGG + Intergenic
969607690 4:8210788-8210810 CAGGAACCATTGTGGAATGATGG + Intronic
969823881 4:9741344-9741366 CAGATGCCTTTGAGGAGAGATGG - Intergenic
970643910 4:18097779-18097801 CAGACACCTGTAAGAAATGAGGG + Intergenic
970644817 4:18108088-18108110 CCCAAACCCTTCAGGAATGAAGG - Intergenic
971061904 4:22980948-22980970 CAGAAACCTTACAGGCAAGAAGG + Intergenic
971773910 4:30934959-30934981 CATAAACCTTTGAGGAAGATAGG - Intronic
971817474 4:31506947-31506969 CCCAGACCTTTCAGGAATGAAGG + Intergenic
971890547 4:32515386-32515408 CAGAAAACTTTCAATAATGAGGG - Intergenic
972192699 4:36613647-36613669 CCAAACCCTTTCAGGAATGAAGG + Intergenic
972420813 4:38884467-38884489 CAGAAACCTTCCAGGGCTGAGGG - Intronic
972690808 4:41395986-41396008 CAGAGACCTGAAAGGAATGAGGG + Intronic
973110030 4:46387521-46387543 CAGAAACTTTTGAGGCTAGAGGG - Intronic
973304287 4:48627488-48627510 CAGAAATCTTTCAGGAAGTATGG - Intronic
974296152 4:60000927-60000949 CAGAAGAATTTAAGGAATGAGGG - Intergenic
974361794 4:60890366-60890388 CAGAGACATTAGAGGAATAAGGG + Intergenic
975088233 4:70368999-70369021 CAGAAATCTTTGATGAAGTACGG + Intergenic
975375121 4:73634203-73634225 CAGAAACCTTAGAAGACAGAAGG + Intergenic
975736468 4:77386024-77386046 CAGGACCCCTTGTGGAATGAGGG - Intronic
976036288 4:80825558-80825580 CAGAAACTTTTGAGGTCAGAAGG + Intronic
976651664 4:87441393-87441415 CAGAAACCATTGAGGAAAAAGGG + Intronic
976960191 4:90961248-90961270 AAGAAACATTTGATGAATGCTGG - Intronic
977752923 4:100631467-100631489 CACAGACCTTTCAAGAATGAAGG - Intronic
978038962 4:104034444-104034466 TAGAAACCTATGAGTAATAAAGG - Intergenic
978133671 4:105231245-105231267 CAGAATATTTTGAGGAATTAAGG - Intronic
979090734 4:116478774-116478796 CAGAAATCATTGAGTGATGAAGG + Intergenic
979100677 4:116608975-116608997 TAGAAACCATAGAGGTATGAAGG + Intergenic
979427768 4:120588948-120588970 TAGAAACCTTTTTGGAATGGAGG + Intergenic
979994087 4:127410024-127410046 CAGAAACCAGTGTGGACTGAGGG - Intergenic
980382120 4:132035676-132035698 AAGAATACTTTGAGAAATGAAGG - Intergenic
980629769 4:135416150-135416172 CCGAGACCCTTCAGGAATGAAGG + Intergenic
982150430 4:152449342-152449364 TACAAATCTTTGAGGACTGATGG + Intronic
983569140 4:169185773-169185795 AATAAAGCTTTGAGAAATGAAGG + Intronic
986525376 5:8668453-8668475 CCTAGACCTTTCAGGAATGAAGG + Intergenic
987186734 5:15429010-15429032 AAAATATCTTTGAGGAATGAAGG - Intergenic
987882692 5:23769833-23769855 CAGAAAACTTTTGGGGATGATGG + Intergenic
988108058 5:26774655-26774677 CCCAGACCCTTGAGGAATGAAGG + Intergenic
988233053 5:28505208-28505230 CCCAGACCTTTCAGGAATGAAGG - Intergenic
988366915 5:30311367-30311389 CAGGAAACTTTCAGTAATGATGG - Intergenic
989539551 5:42603187-42603209 CAGAAACCTTGCAGGCCTGAAGG - Intronic
990292985 5:54373667-54373689 CAGAAACTTTGGAGGTAAGAAGG - Intergenic
990625026 5:57600873-57600895 CAGAATCCTTTGAGAAGGGAGGG + Intergenic
991203909 5:64027355-64027377 CAAAAACCTTTAAGAAAAGATGG + Intergenic
992099899 5:73396904-73396926 CCCAGACCTTTCAGGAATGAAGG + Intergenic
992477572 5:77118508-77118530 ATGAAACCTGTGAGGTATGAAGG + Intergenic
993167246 5:84373178-84373200 CAGAAATCTTTAAGGAATGACGG - Intronic
994426041 5:99588185-99588207 CAGAAACATTAGAGCAATGAAGG + Intergenic
994428033 5:99620411-99620433 TAGAAACATTTGAAAAATGAAGG + Intergenic
995345848 5:111116410-111116432 CAGAAATCTTTAAGGAAGAAGGG - Intronic
995850576 5:116541300-116541322 CAGAAACCCTAGAGGTAAGAGGG + Intronic
996318965 5:122192559-122192581 CATATACCTTTTAGCAATGAAGG + Intergenic
996357145 5:122608300-122608322 GAGAAAACTTTTAGGAGTGATGG + Intergenic
997737444 5:136224460-136224482 CAGAAACCTGTGAGCCATGCTGG + Intronic
998312199 5:141144723-141144745 CAGAAACCATGGAGGACAGAAGG + Intronic
998744932 5:145247544-145247566 GAGCAACCTTTGAGTAATGTAGG - Intergenic
999364508 5:151013296-151013318 CACAAACCATTGAGGACTGGCGG - Intergenic
999550339 5:152679552-152679574 CCAAAATCTTTAAGGAATGAGGG - Intergenic
999904534 5:156125192-156125214 CAGAAACCTTTGGGTTATGAAGG - Intronic
999925593 5:156372655-156372677 CAGAATACTTTGAGGAAACATGG + Intronic
1000324558 5:160162403-160162425 AAAAAGCCTTTGAGGAAAGAAGG - Intergenic
1000579877 5:163023070-163023092 CTGAATCCTTTTCGGAATGAGGG - Intergenic
1001012139 5:168108164-168108186 CAGCCACCTTTGAGGCATGGAGG + Intronic
1001190783 5:169629046-169629068 CATAGACGTTTGTGGAATGAAGG + Intergenic
1002391788 5:178919462-178919484 CAAAAATCTTTCAGGAATGAAGG - Intronic
1003576989 6:7306541-7306563 AAAAAACCTTTCAGGAATGATGG + Intronic
1003893955 6:10589516-10589538 CAGAAGCCTTTGAGGGATGGTGG - Intronic
1004433929 6:15571804-15571826 GAATAAACTTTGAGGAATGAGGG + Intronic
1004944997 6:20602693-20602715 AAGTAACCTCTGAGGAATCATGG - Intronic
1005592143 6:27339638-27339660 CAGAAACCTCTGGAGGATGAAGG - Intergenic
1005806150 6:29476065-29476087 CAGGAACCTCTGAGGACAGAGGG - Intergenic
1006022582 6:31126158-31126180 CAGTCACCCGTGAGGAATGAGGG - Intronic
1006861898 6:37177338-37177360 CAGAACCCAATGAGGAGTGAGGG - Intergenic
1007264030 6:40584059-40584081 CAGAAAACTTTGAGAATTGATGG - Intronic
1007805620 6:44443187-44443209 CAGAAACCTTTCAGGCCAGAAGG - Intronic
1008666007 6:53717163-53717185 GAGGAACCTTTGTGGAGTGATGG - Intergenic
1010110313 6:72220297-72220319 CAGAGGCCTTTGAGAAATAAAGG + Intronic
1010715950 6:79230307-79230329 GAGGGACCTTTGTGGAATGATGG + Intronic
1010761375 6:79727081-79727103 CAGAAAACTTTCTGCAATGATGG + Intergenic
1010871334 6:81045707-81045729 GAGAAAACTTTTGGGAATGATGG - Intergenic
1010923005 6:81707851-81707873 CAGAAGCTTTTGAGGAGTGGTGG - Intronic
1011594463 6:89003258-89003280 CAGATTGCTTTGAGGAATCAAGG + Intergenic
1011854753 6:91675807-91675829 GAGATAGCTGTGAGGAATGAAGG - Intergenic
1012002802 6:93675002-93675024 CCCAGACCTTTCAGGAATGAAGG + Intergenic
1012047442 6:94295917-94295939 CAGAAACCATGGAGGCATGAAGG + Intergenic
1012702732 6:102482224-102482246 CAGAAAGCTTTGAGGACATAAGG + Intergenic
1013023222 6:106241370-106241392 CAGAAACCTTTGTGCACTGTTGG + Intronic
1013051036 6:106535473-106535495 CTGAATCCTATGTGGAATGAAGG - Intronic
1013350055 6:109297420-109297442 CAGAAACCATTGAGATATGTGGG + Intergenic
1014306756 6:119752643-119752665 CAGAAAACTGTGAGGAGTGCAGG + Intergenic
1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG + Intronic
1014988834 6:128048469-128048491 CAGAAACCTGAAGGGAATGAGGG - Intronic
1015259391 6:131218116-131218138 CAGAACCCTTTGAGGTAAGGGGG + Intronic
1015344356 6:132138407-132138429 CTGTAACCTTTGAGGAATTCAGG + Intergenic
1015746811 6:136518646-136518668 CAGAAACTTAAGAGCAATGAAGG - Intronic
1015750368 6:136552641-136552663 CAGAAACTCTAGGGGAATGATGG - Intergenic
1016119688 6:140330801-140330823 CCCAAACCCTTCAGGAATGAAGG - Intergenic
1017134683 6:151137739-151137761 CAGAACCCTTTGTGGAATGAGGG + Intergenic
1019566682 7:1685150-1685172 CAGAAACTATGGAGGAAAGAAGG - Intergenic
1020314301 7:6894066-6894088 CAGATGCCTTTGAGGAGAGATGG + Intergenic
1022739227 7:33105643-33105665 CAGGACCCTTTCTGGAATGAGGG - Intronic
1022850909 7:34261003-34261025 CATAAACATTTGTGGAATGAAGG + Intergenic
1022966208 7:35475117-35475139 CAGAAACCTTGGAGGCCTGAAGG + Intergenic
1023005439 7:35860675-35860697 CAGAAACCTTGGAGGCCTGAAGG - Intronic
1023137666 7:37069068-37069090 CTGCAATCTTAGAGGAATGAAGG - Intronic
1023211109 7:37805784-37805806 ACAAAACCTTTGAGGAATGTGGG + Intronic
1024482533 7:49879081-49879103 CAGAGACCTTTGAGGATTGAGGG - Intronic
1024813509 7:53241014-53241036 TTGAAACTTTTGAGGAGTGATGG + Intergenic
1025862405 7:65343530-65343552 CAAAATCGTTTGAGGAATAATGG + Intergenic
1026814956 7:73503674-73503696 AAGAAATGTTTGAGGAAAGATGG - Intronic
1026856745 7:73760110-73760132 CAGAAATATCTGTGGAATGAAGG - Intergenic
1027406799 7:77871153-77871175 CCGAGACCATTCAGGAATGAAGG - Intronic
1027906855 7:84196080-84196102 CAGAATCATTTGGGGAATAAAGG - Intronic
1027949208 7:84791940-84791962 CAGAATTATTTGAGAAATGAAGG + Intergenic
1028141987 7:87283900-87283922 CACAGACCCTTCAGGAATGAAGG + Intergenic
1028491217 7:91414261-91414283 CAGGATCCCTTGAGGAAGGACGG + Intergenic
1028938235 7:96489688-96489710 CAGGAGCCTTTGAGGGATGGTGG - Intronic
1029014652 7:97303033-97303055 TGGTTACCTTTGAGGAATGACGG - Intergenic
1029129340 7:98318242-98318264 AAAAAGCCTTTGAGGAAAGAAGG - Intronic
1030241682 7:107332941-107332963 CAGACACCTTTGAGGCAAAAGGG + Intronic
1031119388 7:117703923-117703945 CAGATACAATTGAGGAATGGGGG - Intronic
1031539331 7:122974633-122974655 CAGGAGTCTTTGAGAAATGATGG + Intergenic
1031543210 7:123021395-123021417 CAGAAACTTTGGAGGCAGGAAGG - Intergenic
1031901533 7:127416651-127416673 CAGAAATCGGTGAGGAAGGAAGG + Intronic
1034366080 7:150549490-150549512 CAGATTACTTTGAGGAATTAAGG - Intergenic
1035308316 7:157947866-157947888 CAGAAACCATGGAGGCCTGAAGG + Intronic
1036630831 8:10513716-10513738 CAGTGACATTTGAGGAAAGATGG + Intergenic
1037696855 8:21230958-21230980 CAGAATCCAGTGAGGAGTGAGGG + Intergenic
1038361718 8:26886094-26886116 CAGAAACCATTGAGGAAAGCAGG + Intergenic
1040642829 8:49359637-49359659 CAGAAACCTTGGAGGCCAGAAGG - Intergenic
1040872714 8:52117293-52117315 CACAAAGACTTGAGGAATGAGGG - Intronic
1041226141 8:55700697-55700719 CAGACTGCTTTGAGGAATTAAGG + Intronic
1041777798 8:61542902-61542924 CAGAAACCATAGAGGAGAGAAGG - Intronic
1041802841 8:61818642-61818664 CCCAAACCCTTTAGGAATGAAGG - Intergenic
1042284927 8:67098265-67098287 AAGAAAACTTAGAAGAATGAAGG - Intronic
1042328458 8:67553548-67553570 CATAAGCCCTTGAGAAATGAAGG - Intronic
1044030928 8:87236225-87236247 CTGAAGCCTTTGAAGAATAAGGG - Intronic
1044486912 8:92765299-92765321 CCCAGACCTTTCAGGAATGAAGG - Intergenic
1045905629 8:107341271-107341293 CAGAAACCATAGGGGATTGAAGG + Intronic
1048505271 8:135015100-135015122 CAGCCACCTCTGAGGAATCAGGG - Intergenic
1049532682 8:143162561-143162583 CAGAAACCTTGAAAGAATTACGG + Intergenic
1049949097 9:627211-627233 CAGAAACCTGTGATGGATGAGGG + Intronic
1051063686 9:13075275-13075297 CACATACCTTTCAAGAATGAAGG + Intergenic
1051603336 9:18896375-18896397 CAGAAACCTTGCAGGACAGAAGG + Intronic
1051607810 9:18933709-18933731 CAGAAACAATGGAGGACTGAAGG - Intronic
1051894028 9:21970098-21970120 CAGAAACAATTGAGTAATGTTGG + Intronic
1051897360 9:22001782-22001804 TAGAAACTTTTCAGGTATGAAGG + Intronic
1052809915 9:33048576-33048598 CAGAAAGCTTTGAGAAATACTGG - Intronic
1053559928 9:39181415-39181437 CTGAAAACTTTGAGGAACGTTGG - Intronic
1053824037 9:42001636-42001658 CTGAAAACTTTGAGGAACGTTGG - Intronic
1054137188 9:61437540-61437562 CTGAAAACTTTGAGGAACGTTGG + Intergenic
1054606537 9:67185728-67185750 CTGAAAACTTTGAGGAACGTTGG + Intergenic
1055780482 9:79815757-79815779 CAGAGAACTGTGAAGAATGAAGG + Intergenic
1056403644 9:86253234-86253256 CAGACTGCTTTGAGGAATCATGG + Intronic
1058109623 9:101018058-101018080 CAGAAACATTTTCTGAATGAGGG + Intergenic
1059063076 9:111053730-111053752 CACAGATCTGTGAGGAATGAGGG + Intergenic
1059183371 9:112241766-112241788 GAGAAAATTTTCAGGAATGATGG - Intronic
1059729161 9:117039747-117039769 CAGAAACCTTTGACCAGTCAGGG + Intronic
1062653835 9:137591734-137591756 CAGACACCCTAGAGGACTGAAGG + Intergenic
1186803797 X:13119328-13119350 CATATACCTTTGAGGAAAGCGGG - Intergenic
1187224911 X:17366689-17366711 GAGAAACCTGTGAAGTATGAAGG + Intergenic
1187263717 X:17711157-17711179 TAGCAACCTTTGAGGGTTGATGG + Intronic
1187728088 X:22224373-22224395 CAGAATCCTCTGTGGAATCAGGG - Intronic
1190938520 X:55018236-55018258 CAGAAAGATTTGAAGAATGCAGG + Intronic
1190993562 X:55580402-55580424 CAGAAGCCTTAGAGGACAGAAGG + Intergenic
1191113270 X:56825075-56825097 CCGAAACCCTTCAGGAATGAAGG - Intergenic
1191946600 X:66540901-66540923 CACAGACCCTTCAGGAATGAAGG + Intergenic
1193876230 X:86865804-86865826 CACAAAACCTTCAGGAATGAAGG + Intergenic
1194343558 X:92732964-92732986 CCCAGACCTTTCAGGAATGAAGG + Intergenic
1194937981 X:99974082-99974104 CATAAACCTTTTGGGAGTGAAGG - Intergenic
1195197337 X:102512118-102512140 GAGAAGACTTTGAGGTATGAGGG + Intergenic
1195451945 X:105024528-105024550 CAGAAACAGGTGAGGACTGATGG + Intronic
1195557547 X:106244116-106244138 CAGAACCCTTTCAGAAGTGAAGG - Intergenic
1196084150 X:111666144-111666166 CAGAAAGTTTTGATGAATGATGG + Intronic
1196670824 X:118365965-118365987 CTAAAACCTTTGAAGAATCAGGG - Intronic
1197904289 X:131407637-131407659 CAGAAACATTTGAGTAATCGAGG + Intergenic
1198395817 X:136218404-136218426 CAGAAAAATTTGAGGACTGATGG + Exonic
1198497197 X:137204414-137204436 CAGACACCTATGAGGAAGAATGG - Intergenic
1199917859 X:152363614-152363636 CAGAAACCTGTAAGGAAGTAAGG - Intronic
1200651913 Y:5849629-5849651 CCCAGACCTTTCAGGAATGAAGG + Intergenic
1201349650 Y:13025569-13025591 CAGAAAACTTGGAGGCAAGAAGG - Intergenic
1202250712 Y:22869326-22869348 CATAAACCTTTCAGGAAAAAAGG + Intergenic
1202403701 Y:24503075-24503097 CATAAACCTTTCAGGAAAAAAGG + Intergenic
1202467078 Y:25167007-25167029 CATAAACCTTTCAGGAAAAAAGG - Intergenic