ID: 1096340694

View in Genome Browser
Species Human (GRCh38)
Location 12:50796287-50796309
Sequence TAGAGGCTAAGGCGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2831
Summary {0: 1, 1: 1, 2: 16, 3: 246, 4: 2567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096340687_1096340694 -5 Left 1096340687 12:50796269-50796291 CCTGTAGTCCCATCTACTTAGAG 0: 1
1: 25
2: 1183
3: 11924
4: 117779
Right 1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG 0: 1
1: 1
2: 16
3: 246
4: 2567
1096340686_1096340694 20 Left 1096340686 12:50796244-50796266 CCTTAGCTGGACATAGTGGCGCA 0: 1
1: 0
2: 6
3: 98
4: 766
Right 1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG 0: 1
1: 1
2: 16
3: 246
4: 2567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096340694 Original CRISPR TAGAGGCTAAGGCGGGAAGA TGG Intronic
Too many off-targets to display for this crispr