ID: 1096342894

View in Genome Browser
Species Human (GRCh38)
Location 12:50817154-50817176
Sequence CTGTGTGACTGAGAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096342891_1096342894 -8 Left 1096342891 12:50817139-50817161 CCCAGCTGTTTTAGTCTGTGTGA 0: 1
1: 0
2: 1
3: 24
4: 465
Right 1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG 0: 1
1: 1
2: 0
3: 18
4: 318
1096342892_1096342894 -9 Left 1096342892 12:50817140-50817162 CCAGCTGTTTTAGTCTGTGTGAC 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG 0: 1
1: 1
2: 0
3: 18
4: 318
1096342888_1096342894 29 Left 1096342888 12:50817102-50817124 CCTTATCTTGTACAGTTGACGTG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG 0: 1
1: 1
2: 0
3: 18
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096342894 Original CRISPR CTGTGTGACTGAGAGGAACT TGG Intronic
900303363 1:1989124-1989146 CTGGGTGACTCAGTGGGACTGGG + Intronic
900348038 1:2220448-2220470 CTGTGTGACAGAGCGAGACTCGG + Intergenic
901280133 1:8027022-8027044 CTTTGGGACTGTGAGGGACTCGG + Intergenic
901686716 1:10947444-10947466 CTGGGTCACTGAGAGTCACTGGG - Intronic
903700234 1:25241527-25241549 CTGGGTGACAGAGAGAGACTCGG + Intergenic
903893191 1:26583914-26583936 CTGGGTGACAGAGAGAGACTAGG + Intergenic
904901523 1:33861553-33861575 CTGTGTGACTGCCAGGCACTTGG + Intronic
907226952 1:52956932-52956954 CTGGGTGACAGAGAGAGACTTGG - Intronic
907305475 1:53510599-53510621 TTGTGTGGCTGGGAGTAACTTGG - Intronic
907738210 1:57137215-57137237 ATGTGAGAATGAGAGGAACAAGG - Intronic
909764196 1:79334322-79334344 CTGTGTGACTGGGAGGAGACTGG + Intergenic
911906548 1:103576249-103576271 CTGTGTGACTCAGAGGAAGGAGG - Intronic
911913152 1:103661399-103661421 CTGTGTGACTCATAGGAAGGAGG - Intronic
911915302 1:103690549-103690571 CTGTGTGACTCATAGGAAGGAGG + Intronic
911920565 1:103755537-103755559 CTGTGTGACTCATAGGAAGGAGG - Intronic
914258339 1:145978275-145978297 TGGTGTGACTGAGAGGAAAGGGG + Intronic
915250175 1:154582462-154582484 CTGTGTGACTCAGAGGGGCATGG + Exonic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
918422506 1:184378287-184378309 CTGGGTGACAGAGTGAAACTCGG + Intergenic
918653211 1:186991526-186991548 GTCTGTCACTGAGAGGATCTGGG + Intergenic
918784048 1:188741646-188741668 CTGGGTGACAGAGAGAGACTCGG + Intergenic
919608209 1:199712561-199712583 CTGGGTGACTGAGTGAGACTTGG + Intergenic
921055905 1:211542290-211542312 CTGTGAGTGTGAGTGGAACTGGG - Intergenic
921254825 1:213329835-213329857 CTGTGTGACTGGGAGGGGTTGGG - Intergenic
921481090 1:215665324-215665346 CTGGGTGACTGAGAAGCAGTAGG - Intronic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
921808167 1:219479681-219479703 CTGTGTTATTTAGAGGAAATAGG - Intergenic
922890635 1:229059083-229059105 CTGTGAGATTCAGAGGACCTGGG + Intergenic
923017020 1:230134712-230134734 CTGTGTGACTGAGAGGAGCTGGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924866837 1:247991984-247992006 GTGAGTGACTGATAGGAAGTTGG + Intronic
1063148479 10:3317670-3317692 CTGGGTGACAGAGTGAAACTTGG + Intergenic
1063759145 10:9052521-9052543 ATGTTTGACTGAGAGGGACAGGG - Intergenic
1064076406 10:12272340-12272362 CTGGGTGACAGAGAGAGACTCGG - Intergenic
1064369334 10:14737587-14737609 CTGGGTGACAGAGAGAGACTCGG + Intronic
1065022894 10:21515644-21515666 CAGTGTGACTGAGAGTAAAGAGG - Exonic
1065943161 10:30583322-30583344 CTGGGTGACAGAGTGAAACTGGG - Intergenic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1070410072 10:76131338-76131360 CTGTTTGGCTGAGAGGAATTAGG - Intronic
1071094390 10:81956526-81956548 GTGTGTGAATGAGAGGAATCAGG - Intronic
1072691641 10:97575884-97575906 CTGGGTGACAGAGTGGGACTCGG + Intronic
1072712133 10:97722751-97722773 CTGGGTGACAGAGTGAAACTTGG - Intergenic
1073026211 10:100489048-100489070 CAGTGTGACTGTGAGTCACTGGG - Intronic
1077397870 11:2334322-2334344 CTGGGTGACAGAGCGAAACTCGG - Intergenic
1078788575 11:14520729-14520751 TTATGTGACTGAAAGGAACGAGG + Intronic
1081761068 11:45576714-45576736 CTTGGTGACTGATAGGAAGTGGG + Intergenic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1082236989 11:49830529-49830551 CTGGGGGACTGAGCGGAATTTGG - Intergenic
1082241706 11:49879176-49879198 CTGGGGGACTGAGCGGAATTTGG + Intergenic
1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG + Intergenic
1085287377 11:75372396-75372418 CTGTTTAACTGCAAGGAACTTGG - Intergenic
1085925523 11:81015473-81015495 ATGTGAGAGTGAGAGTAACTGGG - Intergenic
1087595341 11:100247043-100247065 CTGTATGAATGAGAGGGACATGG + Intronic
1087812288 11:102621337-102621359 TTGTGTGACTGTAAGGAACATGG - Intronic
1088129684 11:106472468-106472490 ATGTGTGACTGAGAGGTTGTAGG - Intergenic
1089238261 11:117051551-117051573 CTGGGTGACTGAGGGAGACTCGG - Intronic
1089276699 11:117341466-117341488 CTGAGTGACAGAGTGAAACTCGG - Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1090394333 11:126408777-126408799 GTGTTTGCCTGTGAGGAACTCGG + Intronic
1090552712 11:127840673-127840695 CTGGGTGAGAGAGAGGATCTGGG + Intergenic
1091132890 11:133161167-133161189 CTTTGGGACTGAGGGGAAGTTGG + Intronic
1091985124 12:4904742-4904764 CTGGGTGTCTGAGATTAACTTGG - Intergenic
1092842297 12:12554170-12554192 CTGGGTGACAGAGTGAAACTGGG + Intronic
1093746861 12:22752066-22752088 GTGTGTGACTGAACTGAACTGGG + Intergenic
1093954761 12:25202922-25202944 CTTTGTCACTTAGAGGACCTGGG + Intronic
1095297862 12:40547557-40547579 CTGGGTGACAGAGAGAGACTAGG + Intronic
1096028415 12:48388553-48388575 AAGTCTGGCTGAGAGGAACTGGG - Intergenic
1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG + Intronic
1096467071 12:51852481-51852503 CTGTGTGACTGTAAGGTACATGG - Intergenic
1096521877 12:52189112-52189134 CTGAGGAACTGAGAGGAACCTGG - Intronic
1096916658 12:55040240-55040262 CTGTGTCCCCGAGAGCAACTCGG + Intergenic
1097067125 12:56328750-56328772 CTTTGTGACTAGGAGCAACTGGG + Intronic
1097883744 12:64708815-64708837 CTGGTTTACTGAGAGAAACTGGG - Intergenic
1101217512 12:102599365-102599387 CTGAGTAACTGAGAGGGAATTGG - Intergenic
1102221131 12:111195117-111195139 TTGTCTGAATGAGAGGAACGTGG - Intronic
1102649001 12:114423586-114423608 CTGTGTGATTTAGATGAACCAGG - Intergenic
1102876482 12:116453114-116453136 CTGGGTGACAGAGTGAAACTTGG + Intergenic
1103156266 12:118687607-118687629 CTGTGTGCCTGAGATGACCGGGG + Intergenic
1103192108 12:119010075-119010097 CTGGGTGACAGAGAGAGACTCGG - Intronic
1104450755 12:128866643-128866665 CTGGGTGACAGAGAGAGACTTGG - Intronic
1105457790 13:20557421-20557443 TTGTTTGTCAGAGAGGAACTAGG - Intergenic
1105625002 13:22104271-22104293 CTGGGTGACAGAGCGAAACTCGG - Intergenic
1106028741 13:25979182-25979204 CCTTGTGGTTGAGAGGAACTTGG + Intronic
1108086505 13:46798710-46798732 ATGTGTGGCTGAGAGGATATAGG + Intergenic
1108418520 13:50225431-50225453 GTGTCTGCCTGAGAAGAACTGGG - Intronic
1108560611 13:51640531-51640553 CTGTGTGATAAAGAGGCACTAGG - Intronic
1110426406 13:75372291-75372313 CTGGGTGACAGAGAGAGACTTGG - Intronic
1110839536 13:80126157-80126179 CTGGGTGACAGAGAGAGACTCGG - Intergenic
1112459678 13:99592510-99592532 GTGTGAGACTGAGAGGAAATGGG + Intergenic
1113482227 13:110629479-110629501 CTGAGTGGCTGCCAGGAACTGGG - Intronic
1113838619 13:113346274-113346296 CTCTGTGGCTGAGCGGATCTGGG + Intronic
1113838709 13:113346660-113346682 CTCTGTGGCTGAGCGGATCTGGG + Intronic
1113838773 13:113346928-113346950 CTCTGTGGCTGAGCGGATCTGGG + Intronic
1113838801 13:113347046-113347068 CTCTGTGGCTGAGCGGATCTGGG + Intronic
1113838855 13:113347284-113347306 CTCTGTGGCTGAGCGGATCTGGG + Intronic
1113838969 13:113347788-113347810 CTCTGTGGCTGAGCGGATCTGGG + Intronic
1113839020 13:113347996-113348018 CTGTGTGGCTGAGCGGACCTGGG + Intronic
1115265286 14:31494224-31494246 CAGTCTGAATGAGATGAACTGGG - Intronic
1115694218 14:35879045-35879067 CTCTGTGACCGTGAGGAAGTGGG + Intronic
1119380635 14:74226001-74226023 CAGTGAGACTGAGAGGACCCAGG - Intergenic
1119552745 14:75527054-75527076 CTGTGTGACAGAGACGTTCTTGG + Intronic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1122852589 14:104545113-104545135 CTGTGTGTCTGTGAGCACCTGGG + Intronic
1122920843 14:104879527-104879549 CGGAGAGACTGACAGGAACTCGG - Intronic
1123412410 15:20071642-20071664 CTGGGTGACAGAGCGAAACTCGG + Intergenic
1123521752 15:21078755-21078777 CTGGGTGACAGAGCGAAACTCGG + Intergenic
1125207219 15:37167377-37167399 CTGTGAGCCTGTTAGGAACTGGG + Intergenic
1127715034 15:61641743-61641765 ATGTGAGACTGAGAAGAACCAGG + Intergenic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1130328627 15:82902220-82902242 CTGGGTGACAGAGAGAGACTCGG - Intronic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1131876555 15:96813081-96813103 CTGTCTCACTGTGAGGAAGTTGG + Intergenic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1133615551 16:7473351-7473373 CTGGGTGACAGAGAGAGACTTGG + Intronic
1135139737 16:19911325-19911347 CTCAGTGACTGCGAGGCACTGGG + Intergenic
1135201636 16:20442482-20442504 CTGAGGTACTGGGAGGAACTGGG + Intergenic
1135217472 16:20585384-20585406 CTGAGGTACTGGGAGGAACTGGG - Intergenic
1136286717 16:29248459-29248481 CGGTGTCACTGTGAGGCACTGGG + Intergenic
1136892084 16:33977590-33977612 CTGGGTGGCAGAGAGGCACTAGG - Intergenic
1138268042 16:55674447-55674469 CTGAGTGACAGAGAGAGACTCGG - Intronic
1138392035 16:56676941-56676963 CCGTGTGCCTGAGTGGAACAAGG + Intronic
1139047338 16:63077637-63077659 CTGTGAGACTGAGATGAGATCGG + Intergenic
1139667965 16:68471556-68471578 CTGAGAGACTGAAGGGAACTAGG - Intergenic
1142092314 16:88221094-88221116 CGGTGTCACTGTGAGGTACTGGG + Intergenic
1144666742 17:17107279-17107301 CTTTGTCACTGGGAGGAATTGGG - Intronic
1144761329 17:17709225-17709247 CTGTGAGGCTGAGAGTACCTAGG + Intronic
1146239828 17:31209672-31209694 CTGGGTGACAGAGTGGGACTCGG - Intronic
1147251228 17:39153623-39153645 GTGAGGGACTGAAAGGAACTGGG - Intronic
1148442446 17:47718481-47718503 CTGAGTGACAGAGAGGAAGGAGG - Intergenic
1148496196 17:48054783-48054805 CTGGGCGCCTGAGTGGAACTGGG + Intronic
1150306202 17:64087461-64087483 TTGTGTGACTGGGTGGAAGTGGG - Intronic
1151001266 17:70379723-70379745 TTCTGTGACTGACTGGAACTTGG + Intergenic
1151614538 17:75200502-75200524 CTGTGTAACTGACAGGCATTTGG - Intergenic
1152232987 17:79124282-79124304 CTGTGTGATTGAAGGGAGCTGGG - Intronic
1152496905 17:80679790-80679812 CTGTGTAACTGACAAGATCTGGG - Intronic
1153560799 18:6370107-6370129 CTGTGTGACAGAGTGAGACTCGG + Intronic
1156550838 18:38014740-38014762 ATGTGGGACTGGGAGGCACTAGG + Intergenic
1156613433 18:38753814-38753836 CTGTGTTTCTGAGGGGAACATGG + Intergenic
1158177853 18:54677604-54677626 CTGGGTGACAGAGCGAAACTCGG + Intergenic
1158612280 18:58952203-58952225 CTCTGTGACCCAGGGGAACTCGG + Intronic
1158718874 18:59905749-59905771 CTCCGTGATTGAGAGGAAGTGGG - Intergenic
1159768153 18:72515377-72515399 CTGGGTGACAGAGAGAAACTCGG + Intergenic
1162020691 19:7867127-7867149 GTCTGTGACTGACAGGAACCTGG + Intergenic
1162527797 19:11216779-11216801 CTGTGGGACTGAGAGGAAAGGGG - Intronic
1163378925 19:16951670-16951692 GTGTGTGAGTGAGAGGGACTTGG - Intronic
1163475232 19:17522001-17522023 CTGTGTGACAGAGCGAGACTCGG + Intergenic
1163806467 19:19401874-19401896 CTGAGGGACTGAGAAGAAATTGG - Intronic
1165654283 19:37519939-37519961 CTGACTGACTGAGAGAATCTGGG - Intronic
1166275332 19:41749667-41749689 CAGGGGGACTGAGAGGGACTTGG - Intronic
1166396385 19:42444280-42444302 CAGGGGGACTGAGAGGGACTTGG + Intergenic
1166697161 19:44858665-44858687 CTGGGTGACAGAGAGAGACTCGG - Intronic
1167478888 19:49716993-49717015 CTGGGTGACAGAGTGAAACTCGG - Intergenic
925085237 2:1102485-1102507 CTGCGTGTCTGAGAGGAAGGAGG + Intronic
925112426 2:1347525-1347547 CAGAGTGACAGAGAGGAACAGGG - Intronic
925465196 2:4101615-4101637 CTGTGTGACTGAGGGAGCCTGGG + Intergenic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
925983130 2:9192957-9192979 CTGTGTGACTGCAGGGACCTGGG + Intergenic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
929504552 2:42518154-42518176 CTGGGTGACAGAGTGAAACTCGG + Intronic
929685214 2:44027373-44027395 CTGGGTGACAGAGGGAAACTTGG + Intergenic
930779735 2:55212251-55212273 CTGGGTGACGGAGAGAGACTAGG + Intronic
931512436 2:63015280-63015302 CTGTGTTAATGGGAGTAACTTGG + Intronic
936003023 2:108852942-108852964 ATGTGTCACTGAGAGGATATAGG + Intronic
936506412 2:113111371-113111393 CTGTGTGACTCTGAGCCACTTGG - Intronic
937310140 2:120897031-120897053 CTGTGTGAGGGAGAGGGGCTGGG + Intronic
937695937 2:124808561-124808583 CTGGGTGACAGAGAGAGACTTGG + Intronic
938139123 2:128782212-128782234 CTGTGAGCCTGAGAGGAGCCTGG + Intergenic
938393243 2:130921714-130921736 CTGGGTGACAGAGGGGGACTTGG - Intronic
938749364 2:134314169-134314191 ATCTGTGACTGGGAGAAACTGGG - Intronic
938965257 2:136382410-136382432 CGTTTTGACTGAGAGGAAATGGG + Intergenic
939147616 2:138434892-138434914 CTGTGTCACTGAGAGAAGCTGGG + Intergenic
939699309 2:145370370-145370392 TTGTGTAAATGAGTGGAACTGGG - Intergenic
939723373 2:145682654-145682676 ATGTGTCATTGGGAGGAACTTGG + Intergenic
941767929 2:169318340-169318362 CTTTTTGACTGAGTGGAAGTAGG - Intronic
942010226 2:171754890-171754912 CTTTGTGAGAGAGAGGAACTAGG + Intergenic
944036231 2:195297810-195297832 CTCTGAGCCTGAGAAGAACTTGG + Intergenic
945250903 2:207766122-207766144 CTTTGTGCCTGAGAGGTAGTGGG - Exonic
945305213 2:208253913-208253935 CTGCAAGACTGGGAGGAACTGGG - Exonic
945859769 2:215107438-215107460 CTGTTTGAATGAGAAGAATTAGG + Intronic
946259254 2:218472003-218472025 CTGGGTGACAGAGAGAGACTTGG + Intronic
946655441 2:221940866-221940888 CTGGGTGACAGAGTGAAACTCGG + Intergenic
947350493 2:229238875-229238897 CTGTGTTACTGTGAGGAAACAGG - Intronic
947370514 2:229440745-229440767 CTGGGTGATTCAGAGGAAATGGG - Intronic
948626043 2:239268659-239268681 CTGTGTCCCTGACAGGAAATGGG - Intronic
1170441768 20:16386472-16386494 ATGAGTGAGTGAGAGGAACCTGG + Intronic
1170857783 20:20073377-20073399 GTGTGTGACTCAGAAGCACTCGG - Intronic
1171472421 20:25382772-25382794 CACTGTGGCTGAAAGGAACTAGG + Intronic
1172075836 20:32296571-32296593 CTGGGTGACAGAGTGAAACTCGG + Intronic
1172348824 20:34225064-34225086 CTGGGTGACAGAGCGAAACTCGG - Intronic
1172408811 20:34707820-34707842 CTGGGTGACAGAGCGAAACTTGG - Intronic
1172778745 20:37423311-37423333 CAGTGTGGCTGAGAGGCCCTGGG + Intergenic
1174425993 20:50431838-50431860 CTGTGTGACTGAGTGGTGTTGGG - Intergenic
1174788378 20:53454535-53454557 CTGGGTGACAGAGTGAAACTTGG + Intronic
1176154511 20:63611588-63611610 CTGTGTGACGGAGTGAGACTTGG + Intronic
1178366051 21:31989687-31989709 CTGTGTGACAGAGCGAGACTCGG + Intronic
1178784940 21:35644820-35644842 CAGTGTGCCAGAGAGGATCTGGG - Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1181887925 22:26036363-26036385 CTGTGTGTCTGTGAGGAGATAGG + Intergenic
1185000753 22:48244222-48244244 CCATGTCACTGAGAGGAGCTGGG + Intergenic
952043677 3:29291437-29291459 CTTTGGCACTGAGAGCAACTGGG + Intronic
952223461 3:31349269-31349291 CTGGGTGACAGAGAGAGACTTGG + Intergenic
952407892 3:33021342-33021364 CTGTATGAGTGAGAAGAAGTGGG + Intronic
953416935 3:42727345-42727367 CTGGGTGACAGAGAGAGACTCGG + Intronic
954353734 3:50067254-50067276 CTGTTTTAATGATAGGAACTGGG - Intronic
954971118 3:54652531-54652553 ATGTGTGAGGGAGAGGAGCTGGG + Intronic
955096018 3:55799107-55799129 CTGTGTGACTGAGCTGTACATGG - Intronic
957011409 3:75009860-75009882 CTGAGTGACAGAGTGAAACTTGG + Intergenic
957338229 3:78859692-78859714 CTGCATGAGGGAGAGGAACTGGG + Intronic
959068588 3:101681894-101681916 ATGTGTTACTGTTAGGAACTGGG - Intronic
960375616 3:116897804-116897826 TTGAGAGACTTAGAGGAACTCGG + Intronic
964942675 3:162178416-162178438 CTGTGAGTCTGAGAAGATCTGGG - Intergenic
965250573 3:166338454-166338476 CTGGGTGACAGAGTGAAACTCGG + Intergenic
966396147 3:179505356-179505378 CTGTGTGACAGATAGTACCTCGG + Intergenic
966995701 3:185278152-185278174 CTGGGTGACAGAGCGAAACTCGG - Intronic
967306035 3:188060472-188060494 CTGAGTGACGGGGAAGAACTGGG - Intergenic
968019110 3:195368172-195368194 CTGGGTGACAGAGAGAGACTTGG - Intronic
968498057 4:929391-929413 CTGTGTGGCTGACTTGAACTCGG - Intronic
968833665 4:2947198-2947220 CTGGGTGACTGAGCGGTATTTGG - Intronic
969126491 4:4952017-4952039 CTGTGTTTCTCAGAGGAACTTGG + Intergenic
972373686 4:38450232-38450254 TTGTGTTACTGACAGGAAGTTGG + Intergenic
974453654 4:62098039-62098061 CAGTGTGGCTGAGAGGAATGTGG - Intergenic
974731583 4:65873401-65873423 CTGGGTGACGGAGAGAGACTCGG + Intergenic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
978304622 4:107312551-107312573 CTTTGTGACTGAGCTGCACTGGG - Intergenic
979842249 4:125457108-125457130 GTGTGTGTATGAGAGAAACTGGG - Intronic
980750879 4:137086378-137086400 CTGGGTGACAGAGTGAAACTCGG - Intergenic
980931105 4:139183901-139183923 CTGGGCGACAGAGAGAAACTCGG + Intergenic
982182514 4:152762858-152762880 CTGGGTGACAGAGCGAAACTCGG - Intronic
982337565 4:154257508-154257530 CTGTGTGACTGAGAGAAGCAAGG + Intronic
983888607 4:173007779-173007801 CTGGGTGACAGAGTGAAACTTGG + Intronic
984612801 4:181859216-181859238 CTGTGTGACAGAGTGAGACTCGG + Intergenic
984957842 4:185063445-185063467 CTGTGTGAGTAAAAGAAACTTGG - Intergenic
985890527 5:2711960-2711982 CTTTGTGACTGTGAGGCACAGGG - Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
986822515 5:11482954-11482976 TTGGGGCACTGAGAGGAACTGGG + Intronic
988070774 5:26285410-26285432 CTGTGTGACTCCTAGGGACTTGG - Intergenic
988595088 5:32583800-32583822 CTGTGTCACTGAGGGAACCTGGG - Intronic
988646843 5:33104519-33104541 GTGTGTGACTGTGAAGAAGTTGG + Intergenic
990132721 5:52607422-52607444 CTGTTGAACTGAGAGGAAGTAGG - Intergenic
991070252 5:62470486-62470508 TTGTGTGAAGGAGAGGAAATAGG + Intronic
992927353 5:81602450-81602472 TTGTTTAACAGAGAGGAACTAGG + Intronic
993331248 5:86603090-86603112 CTGTGTGCTTGAGAGGAAATTGG - Intergenic
993736137 5:91478480-91478502 ATATGCCACTGAGAGGAACTTGG - Intergenic
996185928 5:120475254-120475276 CTGTGTGGCTGCCAGGAATTGGG - Intronic
996531261 5:124529801-124529823 CTGGGTGACAGAGAGAGACTTGG - Intergenic
996947823 5:129091973-129091995 TGGTGTGAATGAGAGGAATTTGG + Intergenic
997396102 5:133561062-133561084 CTGGGTGACTGAGTGACACTCGG + Intronic
997590873 5:135071438-135071460 CTGTGTGACTGACAGGTCATAGG - Intronic
997619371 5:135274946-135274968 CTGGGTGACAGAGAGAGACTCGG + Intronic
997695455 5:135857642-135857664 CTGAGAGCCAGAGAGGAACTGGG + Intronic
998346270 5:141467075-141467097 CTGTGTGACAGAGTGAGACTTGG - Intronic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
999387746 5:151167150-151167172 CTGGGGGACGGAGAGGAACAGGG + Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1002282033 5:178136652-178136674 CTGTGAAACTGGGAGGATCTTGG + Intronic
1002304004 5:178272891-178272913 CTGTGTGACTGAGACTGAGTGGG - Intronic
1003524542 6:6886804-6886826 CTGTGTGACTGTGAAGCACATGG - Intergenic
1003844480 6:10158836-10158858 CTGTGGGTCTGACAGGCACTGGG - Intronic
1004315735 6:14585766-14585788 CTCTCTGACACAGAGGAACTAGG - Intergenic
1004487593 6:16082033-16082055 CATTGTGACTGAGAGCATCTAGG + Intergenic
1006966505 6:37991375-37991397 CTGGGTGACAGAGTGAAACTAGG - Intronic
1008747171 6:54686027-54686049 CTGAGTGACTGAGACCAAATGGG + Intergenic
1008867265 6:56227865-56227887 CTGGCTGGCTGAGAGGAAATGGG + Intronic
1011183996 6:84653860-84653882 CTTTGTGACTGAAATCAACTTGG + Intergenic
1012272040 6:97225595-97225617 CTGTGTGACAGAGCGAGACTGGG - Intronic
1014163973 6:118202776-118202798 CTGAGTGACAGAGAGTAGCTGGG + Intronic
1015571346 6:134624487-134624509 CTGGGTGACAGAGTGAAACTCGG - Intergenic
1015664217 6:135609608-135609630 CTGGGTGACAGAGTGAAACTCGG - Intergenic
1017750396 6:157485986-157486008 CTGGGTGACAGAGTGAAACTCGG + Intronic
1018207161 6:161446346-161446368 AAGTGTGACTTAGAGGAACTGGG + Intronic
1019102707 6:169644662-169644684 CAGTGTGACTCATATGAACTAGG - Intronic
1019102808 6:169645651-169645673 CAGTGTGACTCATATGAACTAGG - Intronic
1019102812 6:169645712-169645734 CAGTGTGACTCATATGAACTAGG - Intronic
1019679078 7:2334673-2334695 CTGGGTGACAGAGAGAGACTCGG + Intronic
1020241074 7:6395623-6395645 CTGTGTGACTGTGCTGAAATAGG - Intronic
1020979923 7:15054301-15054323 CTGTGTGTCTGGGAGAGACTTGG - Intergenic
1021875933 7:25049086-25049108 CTGGGTGACAGAGAGAGACTCGG + Intergenic
1022191300 7:28019104-28019126 CTGTGTCAGTGTGAAGAACTTGG - Intronic
1022572096 7:31464855-31464877 TTGTGTGACTGAGAAGGGCTGGG + Intergenic
1023546212 7:41320094-41320116 CTGGGTGACTGAGTGAGACTTGG - Intergenic
1023658304 7:42448403-42448425 TTGTGTGACTGTGTGGAATTAGG + Intergenic
1023870729 7:44261846-44261868 CTGGGTTACTAAGAGGAACCAGG + Intronic
1024754685 7:52516024-52516046 CTGTGTGCATGGGAGGAATTTGG - Intergenic
1027695865 7:81409588-81409610 ATGAATGACTGAGATGAACTTGG + Intergenic
1028010024 7:85630146-85630168 CTGGGTGACAGAGAGAGACTTGG + Intergenic
1028425132 7:90677940-90677962 CTGTGTGGCTGACAGGAGCTGGG + Intronic
1030523744 7:110629349-110629371 CTCAGTGACTCAGAGAAACTGGG + Intergenic
1031447610 7:121873554-121873576 CTGGGTGAGTGAGAAGAGCTCGG + Exonic
1033047843 7:137978692-137978714 CTGGGTGAATGAGAGGAAGGGGG + Intronic
1034495648 7:151420378-151420400 GTGTGTGACTGGGAGGGACGAGG + Intergenic
1034655250 7:152723943-152723965 CTGGGTGACAGAGTGAAACTGGG + Intergenic
1034975687 7:155448251-155448273 CTGGGTGACTGGGAGAAACTGGG + Intergenic
1035172289 7:157023664-157023686 CTGTGGGACTGAGAGGGAAAGGG + Intergenic
1035192054 7:157178608-157178630 CATTGTCACTGAGAGTAACTTGG + Intronic
1035698915 8:1623006-1623028 ATCTGTGACTGTGAGGAACCTGG + Intronic
1036185687 8:6620759-6620781 CTGTTTGACTCAGAGGACCGCGG - Intronic
1036518912 8:9472280-9472302 CTCTGTGACTGAGTAAAACTAGG - Intergenic
1036923428 8:12880504-12880526 CTGAGTGACTGATAGAAAGTAGG - Intergenic
1038747030 8:30263499-30263521 ATGTGTGCCTGAGAGGAAGAGGG - Intergenic
1039717727 8:40128342-40128364 TTGTGGTTCTGAGAGGAACTGGG - Intergenic
1043987195 8:86707778-86707800 CTATGTGAGAGAGATGAACTAGG + Intronic
1044021089 8:87106852-87106874 CTGGGTGACAGAGAGAAACCTGG - Intronic
1045810123 8:106211379-106211401 GTTTGAGAGTGAGAGGAACTGGG + Intergenic
1046118055 8:109808352-109808374 CAGTCTGAATGAGAGGAACAAGG + Intergenic
1046177882 8:110603101-110603123 CTGTGGGGCGGGGAGGAACTTGG - Intergenic
1046660598 8:116944406-116944428 CTGGGTGACAGAGGGGGACTTGG + Exonic
1048134665 8:131736963-131736985 CTTTGTCAATGAGATGAACTTGG - Intergenic
1049588336 8:143442047-143442069 CTGTGTGGCTGGGAGGATGTGGG - Intronic
1049760374 8:144329439-144329461 GTCTGTGGCTGGGAGGAACTGGG + Intergenic
1050402635 9:5272032-5272054 CTGCCTGACTGAGAGGCTCTCGG - Intergenic
1051657316 9:19395516-19395538 CTGTGTGGCTCAGAGACACTAGG + Intergenic
1053014521 9:34654405-34654427 ATGAGAGGCTGAGAGGAACTGGG - Intronic
1056266806 9:84905300-84905322 GTGTGTGACTGACAGAAACCAGG + Intronic
1056374440 9:85993195-85993217 CTGGGTGACAGAGTGAAACTCGG - Intronic
1056561500 9:87733866-87733888 CTGTGTGACTGAGAGGTGCATGG - Intergenic
1057575770 9:96241148-96241170 CAGTGTGAATGGGAAGAACTCGG + Intronic
1057988828 9:99745796-99745818 CACTGTTACTGAGAGGAAGTAGG - Intergenic
1061491177 9:130945083-130945105 CTTGTTGAATGAGAGGAACTGGG + Intergenic
1062114364 9:134799994-134800016 CTGTGTCTCTGAGAGCCACTTGG + Intronic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1062644099 9:137537979-137538001 CTGTGGGCCTGAGAAAAACTGGG - Intronic
1062723095 9:138054593-138054615 CCGTGTGACTGATGGGCACTTGG + Intronic
1187494345 X:19781591-19781613 CTGGGTGACAGAGTGGGACTCGG + Intronic
1190877972 X:54473047-54473069 CTTTGTGACTGTGTGTAACTAGG - Intronic
1191666990 X:63713649-63713671 GTGAGGGACTGAGAGGAACCTGG + Intronic
1191766814 X:64706392-64706414 CGGTGTCAATGAGATGAACTGGG + Intergenic
1192234964 X:69289833-69289855 CTGTGGGAGTGTGAGGGACTTGG + Intergenic
1194335027 X:92635093-92635115 CTGTGTGACAGAGTGAAACCTGG + Intergenic
1195652551 X:107300339-107300361 CTGGGTGACAGAGTGGGACTTGG + Intergenic
1196658160 X:118241607-118241629 ATGAGTGAATGAGAGGAATTAGG - Intergenic
1196999540 X:121423249-121423271 CTGTGTGGCTGAGCGAGACTCGG + Intergenic
1197854768 X:130902987-130903009 CTGTGGGACTGAGGGGGCCTAGG - Intronic
1197986391 X:132270286-132270308 CTGTATGACTGACAGGACTTGGG + Intergenic
1198097840 X:133398037-133398059 CTGGGTGACAGAGAGAGACTCGG + Intronic
1199222157 X:145329570-145329592 CTGTGTGACAGAGTGAGACTCGG + Intergenic
1199856148 X:151760253-151760275 CTGTGGCACTGAATGGAACTGGG - Intergenic
1200643502 Y:5752142-5752164 CTGTGTGACAGAGTGAAACCTGG + Intergenic
1202094290 Y:21229635-21229657 CTGGGTGACAGAGAGAGACTTGG - Intergenic