ID: 1096346967

View in Genome Browser
Species Human (GRCh38)
Location 12:50857308-50857330
Sequence GCTTCCTAGAATTTATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096346967_1096346968 15 Left 1096346967 12:50857308-50857330 CCTTGGGATAAATTCTAGGAAGC 0: 1
1: 0
2: 1
3: 23
4: 215
Right 1096346968 12:50857346-50857368 AATGCAAATGCAGCTTTTTTAGG 0: 1
1: 0
2: 3
3: 26
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096346967 Original CRISPR GCTTCCTAGAATTTATCCCA AGG (reversed) Intronic
903588871 1:24438920-24438942 ACTTACAAGAATTTGTCCCAAGG + Intronic
904329056 1:29746126-29746148 CCTTCCTAGAATTCCTCCAAGGG + Intergenic
904483995 1:30812722-30812744 TCTTCTTAGAATTTATTCAAAGG - Intergenic
905209534 1:36364208-36364230 GCTTCTTGGAATTTATCCAGAGG - Intronic
905540151 1:38754291-38754313 GCTTCCTAAAATTGAACCCATGG + Intergenic
906885440 1:49640648-49640670 CCTTCCAAGAATTTACTCCAGGG + Intronic
906918655 1:50039438-50039460 TCTTCCCAGAATTTGTCCTAAGG - Intergenic
907662777 1:56408346-56408368 ACTTCTAGGAATTTATCCCAAGG + Intergenic
907739888 1:57154886-57154908 GCTTACTAGATTTTTTCCTATGG + Intronic
908602492 1:65755919-65755941 GCTTCCATGAATTTGTTCCAAGG - Intergenic
909804827 1:79860901-79860923 GCATCCTAAAATTTATCTTAAGG - Intergenic
909843949 1:80366683-80366705 ACTTCCTTGAACTTATCCTAAGG + Intergenic
918318606 1:183344082-183344104 GCTTCTCAGCATTTAACCCAAGG - Intronic
921274210 1:213501985-213502007 TCCTCCTAGAATTTACCTCATGG + Intergenic
922055168 1:222035664-222035686 GCTCCTTAGTATTTACCCCAAGG + Intergenic
922968206 1:229710264-229710286 GCTTCCTGCAAATGATCCCATGG - Intergenic
924280534 1:242432656-242432678 GCCTCCTAGGCTTTATGCCAGGG - Intronic
1063435194 10:6023798-6023820 GCTTCCCAGTATTTCTTCCAGGG - Intronic
1063579307 10:7291367-7291389 GCTTCTTTGAATTCATTCCATGG + Intronic
1065433122 10:25680081-25680103 GCTTCCTGGGATTCAGCCCAGGG - Intergenic
1066036576 10:31493884-31493906 AGAGCCTAGAATTTATCCCAAGG + Intronic
1066524372 10:36260404-36260426 GCTGCATAGTATTTATTCCATGG - Intergenic
1069581696 10:69571068-69571090 GCATCCTAGGAATTTTCCCAAGG - Intergenic
1069698641 10:70405759-70405781 CCCTCCTAGATTTTATCCCTTGG - Intronic
1069788157 10:71002931-71002953 TCTTCCTAGCACTAATCCCAAGG - Intergenic
1071808104 10:89146369-89146391 ACTTCTAAGAATTTATCCTAAGG + Intergenic
1072178909 10:92960001-92960023 GCTTCTTGGTATTTATCCCAAGG + Intronic
1074488210 10:113910944-113910966 GGTTCCTAGAATTTATGACGAGG + Exonic
1075234349 10:120712919-120712941 GATTCCTAGACTCTAACCCATGG - Intergenic
1076115601 10:127895433-127895455 CCTTCTCAGAATTTATCTCAAGG - Intergenic
1078598305 11:12708606-12708628 ACTTCACAGAATTTATCCTAAGG + Intronic
1078814710 11:14808126-14808148 GTTTCCTAGAAGTCATCCCTGGG - Intronic
1079855861 11:25603278-25603300 GCTTCCTAGGATTTAGCTGAAGG - Intergenic
1080710652 11:34744586-34744608 TACTGCTAGAATTTATCCCAAGG - Intergenic
1081538431 11:44012665-44012687 TCTTCCAAGAATCTATCTCATGG + Intergenic
1081604468 11:44518709-44518731 GCTTCCCAGACTTTTCCCCAAGG + Intergenic
1083542520 11:63523205-63523227 GCTCCCTATAATTTATATCATGG - Intergenic
1087092468 11:94288040-94288062 GCTTCTTACAATGTACCCCAAGG + Intergenic
1089148922 11:116349853-116349875 GCTTCCGAGGATTTCCCCCAAGG - Intergenic
1090326349 11:125889371-125889393 ACTTCCAGGAATTTATTCCAAGG - Intronic
1091598327 12:1896790-1896812 ACTACCTAGAATTTATCCAAAGG + Intronic
1093228928 12:16519109-16519131 GCTTACTAGACTTTTGCCCATGG + Intronic
1093400362 12:18739020-18739042 CCTTCGTAGAATTTTTCTCAGGG - Exonic
1093434023 12:19115003-19115025 GCTTCCTGGAGTTCATCCTAAGG - Intergenic
1095074461 12:37899731-37899753 TCTTCCTAGTTTTTATCCAAAGG + Intergenic
1096346967 12:50857308-50857330 GCTTCCTAGAATTTATCCCAAGG - Intronic
1100661492 12:96703871-96703893 GCTTCCAGGAATCTATCCTAAGG + Intronic
1100692675 12:97055756-97055778 ACTTCCAGGAATTTATCCTAAGG - Intergenic
1100763669 12:97838351-97838373 ACTGCTGAGAATTTATCCCAAGG - Intergenic
1100786498 12:98084228-98084250 GCTTCCTGGAATTTGTCTTAAGG - Intergenic
1105410196 13:20165121-20165143 ACTTCATAGAAATTATCCCATGG - Intergenic
1108726480 13:53188363-53188385 CCTTCTGGGAATTTATCCCAAGG + Intergenic
1108833721 13:54513517-54513539 GCTTCATAGAATTCATCCCTTGG - Intergenic
1108988280 13:56622557-56622579 GCTGCCTAGAAACTATGCCACGG + Intergenic
1109870489 13:68326552-68326574 TCTCCCTAGAATCTTTCCCAAGG + Intergenic
1110032902 13:70639397-70639419 GCTTCCTAGAAATTACTCCTGGG - Intergenic
1110450183 13:75631911-75631933 ACTTCTTGGAATTTATACCAAGG - Intronic
1111929051 13:94495050-94495072 GCTTCTTGGAATTTAACTCATGG - Intergenic
1114255948 14:21001467-21001489 CCTTCCTAGAAATTCTTCCACGG + Exonic
1115896675 14:38096229-38096251 GCTGCATAGTATTTATTCCATGG - Intergenic
1116216030 14:42018274-42018296 GCTTCCTGGCATTTCTCCCAAGG - Intergenic
1116890712 14:50265451-50265473 GCATCCCAGAATTTTTCCTATGG - Exonic
1118009717 14:61597691-61597713 ACATCTAAGAATTTATCCCAAGG - Intronic
1120837402 14:89053739-89053761 GCTCCTTAGTATTTATCCAAAGG + Intergenic
1120997442 14:90427400-90427422 GCTTCCTAGAACTTATTCTACGG + Intergenic
1121989434 14:98541438-98541460 GCTTCTGAGTATTTATCCAAAGG - Intergenic
1125258629 15:37796854-37796876 GCTTCTTAGAAGTTATCCCCCGG + Intergenic
1127760224 15:62132238-62132260 AATTCCCAGACTTTATCCCAGGG + Intergenic
1130970343 15:88727336-88727358 GCTTCCTATTATTTCTCCAAAGG - Intergenic
1133086524 16:3368394-3368416 GCTTCTTAGGATTTATCATACGG - Intronic
1135879212 16:26237749-26237771 ACTTCCAGGAATTTATCCAAAGG - Intergenic
1136024076 16:27458882-27458904 ACTCCCTAGTATTTAACCCAAGG + Intergenic
1136486422 16:30575200-30575222 ACTACCTGGAATTTATCCAAAGG - Intronic
1138999937 16:62497554-62497576 GTTACCTAGAATTGATCTCATGG + Intergenic
1140741419 16:77944963-77944985 GCTTTAAAGAAATTATCCCATGG - Intronic
1144075051 17:11710374-11710396 GCTTCTTGGAATCTATCCTAAGG - Intronic
1144598439 17:16591222-16591244 GCTTCTAAGAATTTATCCTTGGG - Intergenic
1144953956 17:19009903-19009925 CCTTCCCTGGATTTATCCCAGGG - Intronic
1146932473 17:36787228-36787250 ACTTCTTGGAATTTATCCTAGGG + Intergenic
1149166892 17:53762684-53762706 GCTTTCTAGAATTTCTCCTTAGG + Intergenic
1149409938 17:56394877-56394899 GCTTTCTAGAATTTCTCTCCAGG + Intronic
1149541245 17:57469845-57469867 GCTGTCTGGATTTTATCCCAGGG - Intronic
1149856138 17:60084504-60084526 ACATCTTAGAATTTGTCCCAAGG + Intergenic
1150970858 17:70026026-70026048 GTTGCCTAGATTTTCTCCCAGGG - Intergenic
1151587714 17:75020750-75020772 TCTTCCTAGAGTTTCTCCCAAGG - Intronic
1151959080 17:77395943-77395965 ACTTCTGGGAATTTATCCCAAGG - Intronic
1154456876 18:14537042-14537064 GCCTCCTAAAATTTATCTCTAGG + Intronic
1155916723 18:31564809-31564831 GCTTCCTAAATTTCATGCCAAGG - Intergenic
1156322748 18:36042933-36042955 ACTTCTAAGAATTTATCCTATGG + Intronic
1156981997 18:43300543-43300565 GACTCCTAGAATTTACCACACGG + Intergenic
1157788978 18:50513622-50513644 ACTTCCAGGAATTTATCCTAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1162717224 19:12641689-12641711 GCGTCCTGAAATTTTTCCCAAGG - Intergenic
1164936303 19:32217247-32217269 TCTTCTAGGAATTTATCCCAAGG - Intergenic
1165125519 19:33593626-33593648 GCTTCTTGGAATTTATCATAAGG - Intergenic
1167255023 19:48422123-48422145 GCATCCCAGAAAATATCCCAAGG - Intronic
1167617487 19:50543463-50543485 GCTTCTAGGAATTTATCCCAAGG + Intronic
1168013451 19:53553556-53553578 ACTTTTTAGAATTTATCCCAAGG - Intronic
931293864 2:60902982-60903004 ACTTCCAAAAATTTATCCTAGGG - Intronic
933476676 2:82800112-82800134 ATTTTCTAGAATTTATGCCATGG - Intergenic
934541469 2:95178700-95178722 GCTTCAGGGAATTTATCCTAAGG + Intronic
935388259 2:102523862-102523884 TCTTCCTGGAATTTATTCCCAGG + Intronic
935572309 2:104674613-104674635 AGTTCTTGGAATTTATCCCAAGG + Intergenic
937383657 2:121405661-121405683 GATTCCTAGAAATTATTCAATGG + Intronic
938892139 2:135716484-135716506 ATTTCCTAGAATTTATCCTAAGG + Intronic
940104444 2:150082459-150082481 GGTTCCTAGCATGCATCCCAGGG - Intergenic
941633955 2:167915195-167915217 GCTTCCTGGTCTTTATTCCAAGG - Intergenic
942224260 2:173801432-173801454 AGTTCCTGGAATTTATCCTAAGG + Intergenic
943686954 2:190828750-190828772 TCTTCTAAGAATTTATCCTAAGG + Intergenic
944183640 2:196925206-196925228 ATTTACTAGAATTTTTCCCATGG + Intronic
944688982 2:202142355-202142377 ACTTCCGGGAATTTATCCTAAGG + Intronic
945350307 2:208769992-208770014 GCTTTGTATAATTAATCCCAAGG + Intronic
945694673 2:213087846-213087868 GCTGCATAGTATTTATTCCATGG + Intronic
946115615 2:217459414-217459436 GCTTCCATGAATCAATCCCATGG - Intronic
946384195 2:219371988-219372010 ATTTTCTAGAATTTATCCCATGG + Intergenic
947975928 2:234366245-234366267 GCTCCTCAGAATTTATCCTATGG - Intergenic
948162760 2:235838441-235838463 CCTCCTTAGAATTTTTCCCAGGG + Intronic
1169612753 20:7400998-7401020 ATTTCCTAGAATTTATTCCACGG - Intergenic
1172181361 20:33005679-33005701 ACTTCCTTGATTTTAGCCCAGGG + Intergenic
1172757474 20:37296684-37296706 ACTTCCTAGAATTTATAGTAAGG - Intronic
1173160826 20:40651350-40651372 GCTTCTGGGAATTTATCCTAAGG + Intergenic
1174054948 20:47792163-47792185 ACTTCCAAGAAGTTCTCCCAGGG - Intergenic
1175408848 20:58752838-58752860 GCCTCCTAGAATTTCTCGCCAGG + Intergenic
1175973960 20:62701067-62701089 GTTTCCTAGAAATTATTCCTGGG - Intergenic
1176817284 21:13616284-13616306 GCCTCCTAAAATTTATCTCTAGG - Intronic
1178425478 21:32475795-32475817 ACTTCCGGGAATTTATTCCAAGG - Intronic
1179228447 21:39477552-39477574 GCTACCGGGAATTTATCCTAAGG - Intronic
1181549308 22:23627876-23627898 GCGACCTAGAACTCATCCCAGGG + Intronic
1181799304 22:25334004-25334026 GCGACCTAGAACTCATCCCAGGG - Intergenic
1182935355 22:34216947-34216969 GCTTCCTTAAATTTAGCCCTAGG - Intergenic
1183515551 22:38263656-38263678 GCCTCCCAGAATTTATTCTACGG - Intronic
1184388606 22:44190341-44190363 ACTTCTTAGAATATAGCCCAGGG - Intronic
950931983 3:16799200-16799222 ACTTCCTAGAACTAATCACATGG + Intergenic
951512084 3:23513557-23513579 ACTTCTAGGAATTTATCCCACGG - Intronic
953527284 3:43703062-43703084 ACTTCATAGCATATATCCCAGGG + Intronic
953813382 3:46133283-46133305 GCTTCCTAGACCTTGGCCCAGGG + Intergenic
955702362 3:61694549-61694571 ACTTCTGAGAAATTATCCCATGG + Intronic
956018817 3:64912226-64912248 GTTTCCTAGGATGTATTCCATGG - Intergenic
958700349 3:97581152-97581174 CCTTCCCAACATTTATCCCAGGG - Intronic
959775421 3:110154852-110154874 GCTTACTTAAATTTACCCCAGGG + Intergenic
959980849 3:112515709-112515731 ACTTCCAAGAATTTACTCCATGG + Intergenic
960224678 3:115156060-115156082 GCTTCATAGAATATCCCCCAGGG + Intergenic
960723970 3:120651616-120651638 GTTTCCAACAATTTATCCTATGG + Intronic
960941774 3:122939639-122939661 GCTTCCTGGATTTCCTCCCAGGG - Intronic
963292978 3:143512287-143512309 ACTTACTAGAATTTATCCTAAGG + Intronic
966526565 3:180925446-180925468 GCTTTCTAGATTTTATCAGAAGG + Intronic
967371592 3:188752705-188752727 GTTTCCTAGAATATATCTCCTGG + Intronic
968240104 3:197072277-197072299 TCTTCAAAGAATTTATCCTAAGG - Intronic
969464706 4:7349451-7349473 GCTGCCTAGACTTTATCCCCAGG + Intronic
971242207 4:24899111-24899133 TCTTCCTAGAAGATATTCCAGGG + Intronic
972151558 4:36097692-36097714 GCATCCTAGGATTTATCTCTGGG - Intronic
973598716 4:52519694-52519716 ATTTCCTAGACTTTATCTCAAGG - Intergenic
973832511 4:54775787-54775809 GCAGCCTAGAACTTTTCCCAGGG - Intergenic
978226510 4:106341347-106341369 ATTTCCTAGAATTTTTGCCAAGG + Intronic
978643120 4:110895185-110895207 GATTCTTAGAATTCATCCCTTGG + Intergenic
978653176 4:111032814-111032836 GGTTCCTAGTATTTATCACAAGG + Intergenic
982087599 4:151852109-151852131 GCTTCCTAATATTTAGACCACGG + Intergenic
984660169 4:182364915-182364937 ACTTCCAAGAATTTATCCTAAGG - Intronic
984858605 4:184217374-184217396 GTTTCCCAAAAGTTATCCCAAGG - Intronic
985304576 4:188524338-188524360 GCTTCTAGGAATTTATCCTATGG - Intergenic
987106318 5:14643269-14643291 ATTACATAGAATTTATCCCAGGG - Intergenic
989034103 5:37151483-37151505 TATTCCTAGAATTTAGCACAGGG + Intronic
990051294 5:51505037-51505059 GATTCCTGGAATTTATAACATGG + Intergenic
990610528 5:57452420-57452442 GGTCCCTAGAATTTCTCACAAGG + Intergenic
990814274 5:59765879-59765901 GTTTCCAATAATTTATACCATGG - Intronic
991440019 5:66637319-66637341 ACTTCCAGGAATTTATCCTAAGG - Intronic
993061902 5:83048814-83048836 CCTTCCTAGAAATTACGCCAGGG - Intergenic
994151355 5:96451230-96451252 ACTTCCAAGAATCTAACCCAGGG + Intergenic
994322630 5:98410921-98410943 GCTTCTTAGGATTTATCGTATGG - Intergenic
996861767 5:128074996-128075018 ACTTCTAAGAATTTATCCTAAGG + Intergenic
997574466 5:134963398-134963420 GTTTCTTAGAATTCTTCCCAAGG + Intronic
998031802 5:138876866-138876888 TCCTCCTAGAAGTGATCCCAAGG + Intronic
998241387 5:140448381-140448403 ACTTCCAGGAATTTATCCTAAGG - Intronic
998845496 5:146305160-146305182 GCTCCTGAGGATTTATCCCAAGG + Intronic
999429325 5:151512347-151512369 TCTTCCTCGAATGTCTCCCAGGG - Exonic
999956551 5:156709474-156709496 TCTTCCCAGATTTTCTCCCAAGG - Intronic
1000129878 5:158286479-158286501 ACTTCTAAGAATTTATCCTATGG + Intergenic
1000405290 5:160881432-160881454 GCTTCTTGGTATTTATCCAAAGG + Intergenic
1000480328 5:161766146-161766168 GATTCCTAGAGTATTTCCCATGG + Intergenic
1001808484 5:174609164-174609186 GCCTTCAAGAAGTTATCCCAGGG + Intergenic
1002846697 6:952819-952841 ACTTCTAAGAATTTATCCTAAGG - Intergenic
1003415259 6:5901800-5901822 GCTTCTAAGGTTTTATCCCAAGG - Intergenic
1003850046 6:10212496-10212518 ATTTCTGAGAATTTATCCCAAGG + Intergenic
1006624450 6:35387329-35387351 GCTTCCTAGAGTTCATCCTGAGG - Intronic
1006675445 6:35759422-35759444 GATTCCTAAAATTTGACCCATGG + Intergenic
1008653206 6:53584750-53584772 GCTTCCTAGAATATATCCCTTGG - Intronic
1008740434 6:54600349-54600371 TATTCTGAGAATTTATCCCAAGG + Intergenic
1011874114 6:91935361-91935383 GCTACCTAAAATTTTTCACAAGG + Intergenic
1014770920 6:125457492-125457514 GCTTCTTGGTATTTATCCAAAGG - Intergenic
1015232126 6:130927248-130927270 TATTTTTAGAATTTATCCCAAGG - Intronic
1016533034 6:145079059-145079081 ACTTCCAAGAATGTCTCCCATGG + Intergenic
1017224657 6:152006947-152006969 TCTTCATAGACTGTATCCCATGG + Intronic
1017287292 6:152690584-152690606 GTTTCTTAGAATTTATCTCTGGG + Intergenic
1021410473 7:20324916-20324938 GCTTCCTTCAAGTCATCCCATGG + Intergenic
1022408508 7:30117243-30117265 ATTTCCTAGAAGTTACCCCATGG + Intronic
1022625246 7:32029335-32029357 ACTTCCTAGTATTTATCCAAAGG + Intronic
1024232222 7:47371227-47371249 GTTACCTTGAATTAATCCCATGG - Intronic
1027000687 7:74651899-74651921 GGTTCTTAGAATTCATCCAAAGG - Intergenic
1027626573 7:80552348-80552370 ACTTCCAAGTATTTCTCCCATGG + Intronic
1029055341 7:97734184-97734206 GTTTCCTTGAATTCATCGCACGG + Intronic
1031630272 7:124035343-124035365 CCAACCTAGAATTCATCCCAGGG + Intergenic
1032779441 7:135151923-135151945 GCTTCCTAGAGTTCATCTCTGGG + Intronic
1035458718 7:159026100-159026122 CTTTCCTAGACTTTATCCCATGG + Intergenic
1036858537 8:12323073-12323095 GCTTCTGAGAATATATTCCAGGG - Intergenic
1038088220 8:24223465-24223487 GTTTCCTAGAATGTATCTAAAGG - Intergenic
1040346258 8:46500108-46500130 TCTTTCTAGTTTTTATCCCAAGG + Intergenic
1040346315 8:46501315-46501337 TCTTTCTAGTTTTTATCCCAAGG + Intergenic
1043244763 8:77983563-77983585 GAGTTCTAGAATTTATGCCATGG + Intergenic
1043319979 8:78972533-78972555 TCTTCCAAGAAGTTATCCAAAGG + Intergenic
1045555647 8:103212506-103212528 ACTTCTAGGAATTTATCCCAAGG + Intronic
1046005173 8:108471779-108471801 ACTTCAAAGAATTTAACCCAAGG - Intronic
1046821611 8:118639779-118639801 TCTTCCTAGAATCTTCCCCAAGG + Intergenic
1046848611 8:118947461-118947483 GATTCCTAGAACTTCTCCTAAGG - Intronic
1047338517 8:123958175-123958197 GATTCCCAGAATTTAGCCCAGGG - Intronic
1050344187 9:4669949-4669971 TCTGCTAAGAATTTATCCCATGG + Intergenic
1051819998 9:21153533-21153555 GCTTCCTAAATTTTACCCAATGG + Intergenic
1053188536 9:36039208-36039230 GCTTCCTAGAATTTAGTATAAGG - Intronic
1055535568 9:77239792-77239814 GTATCCTAGAATTTATCCAAAGG - Intronic
1057772140 9:97977745-97977767 ACTTCTAAGAATTTATTCCAAGG + Intergenic
1058988144 9:110228634-110228656 GCTTCCCAGCCTGTATCCCAGGG + Intergenic
1060650647 9:125323624-125323646 GCTTCTAGGAATTTATCCTAAGG - Intronic
1203530079 Un_GL000213v1:133213-133235 GCCTCCTAAAATTTATCTCTAGG + Intergenic
1185744299 X:2559637-2559659 CTTTCCTTGAATTTATTCCATGG + Intergenic
1189839026 X:45052026-45052048 ACTCCCTAGTATTTAACCCAAGG + Intronic
1191979776 X:66912864-66912886 CATTCCTAGAATTTATGACATGG + Intergenic
1192437033 X:71149195-71149217 GCTTCCTAGAGTTTCTCCTGAGG - Intronic
1192590780 X:72357693-72357715 GAGTCTTAGAATCTATCCCACGG - Intronic
1193781056 X:85701724-85701746 GCTTCATAGAATGTAGCCCAAGG - Intergenic
1194252303 X:91590876-91590898 ACTGCCTAGATTTTTTCCCAAGG - Intergenic
1194661448 X:96632537-96632559 ACTCCTTAGAATTTACCCCAAGG + Intergenic
1195390252 X:104354232-104354254 ACTTCTAAGAATTTATCCAATGG - Intergenic
1197071348 X:122301654-122301676 GCTTCTTGGTATTTATCCAAAGG - Intergenic
1198946519 X:142021508-142021530 GGGTCCTGGGATTTATCCCATGG - Intergenic
1199305015 X:146257682-146257704 ACTTCTTAGAATATACCCCAAGG + Intergenic
1200571232 Y:4832119-4832141 ACTGCCTAGATTTTTTCCCAAGG - Intergenic
1201343452 Y:12957879-12957901 GCTTCCTACTAATCATCCCAAGG - Intergenic
1201792474 Y:17857514-17857536 TGTTCCTAGAAGTTATACCAAGG + Intergenic
1201809080 Y:18048472-18048494 TGTTCCTAGAAGTTATACCAAGG - Intergenic
1202354011 Y:24026762-24026784 TGTTCCTAGAAGTTATACCAAGG + Intergenic
1202516768 Y:25643350-25643372 TGTTCCTAGAAGTTATACCAAGG - Intergenic