ID: 1096352553

View in Genome Browser
Species Human (GRCh38)
Location 12:50912232-50912254
Sequence TGGAAAACAGCAGTGATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096352546_1096352553 19 Left 1096352546 12:50912190-50912212 CCAGATCCAGAGGGATGGAAGTC 0: 25
1: 61
2: 115
3: 90
4: 155
Right 1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG No data
1096352543_1096352553 24 Left 1096352543 12:50912185-50912207 CCCTGCCAGATCCAGAGGGATGG 0: 13
1: 43
2: 96
3: 162
4: 295
Right 1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG No data
1096352545_1096352553 23 Left 1096352545 12:50912186-50912208 CCTGCCAGATCCAGAGGGATGGA No data
Right 1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG No data
1096352547_1096352553 13 Left 1096352547 12:50912196-50912218 CCAGAGGGATGGAAGTCAGCAGT No data
Right 1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096352553 Original CRISPR TGGAAAACAGCAGTGATGGA CGG Intergenic
No off target data available for this crispr