ID: 1096354474

View in Genome Browser
Species Human (GRCh38)
Location 12:50928637-50928659
Sequence CTTTAGGCAGACAGTAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 2, 2: 1, 3: 22, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096354474_1096354479 2 Left 1096354474 12:50928637-50928659 CCTTCCCTACTGTCTGCCTAAAG 0: 1
1: 2
2: 1
3: 22
4: 191
Right 1096354479 12:50928662-50928684 AGCTGGCTAACTCCTTTCATTGG 0: 1
1: 1
2: 5
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096354474 Original CRISPR CTTTAGGCAGACAGTAGGGA AGG (reversed) Intronic
900809227 1:4788592-4788614 TTTCAGGCAGAGAGTAGGGTGGG - Exonic
900951359 1:5859859-5859881 CTGTGGGCAGACAGTAGGGTGGG - Intergenic
902912458 1:19610232-19610254 CTTTAGATAGACAGTATGAAAGG + Intronic
903582836 1:24385112-24385134 CCTAAGGAAGGCAGTAGGGATGG - Intronic
907283874 1:53368085-53368107 CTTTTGGGAGACAGAAGGGAGGG - Intergenic
908806544 1:67938345-67938367 CTTTAGCAAGACAGGAGTGAAGG + Intergenic
912691827 1:111810424-111810446 CTTTGGGCAAACTGGAGGGATGG - Intronic
912760214 1:112359769-112359791 ATTTGGGCAGAGAGGAGGGATGG - Intergenic
913080304 1:115378581-115378603 CTTCGGGCAGACAGAAGAGAAGG - Intergenic
916058948 1:161086070-161086092 GTCTAGGCAGAGAGAAGGGATGG - Intronic
916638485 1:166700183-166700205 CTCTAGGCAGAAAGTAGAGAAGG - Intergenic
917119482 1:171633198-171633220 CTTTATTCAGACTGTAGAGATGG - Intergenic
922852853 1:228748535-228748557 GTTTAGGGAGTCAGTAGGCAAGG + Intergenic
923245799 1:232130914-232130936 CTTTAGGCAAACAGTAGGGAAGG + Intergenic
923714542 1:236413777-236413799 CTTTGTGCAGTCAGTAGGGAAGG + Intronic
923900381 1:238320079-238320101 CTTTAGGCAAATAGGAAGGAAGG + Intergenic
1062973883 10:1669089-1669111 CATTAGGCAGGCAGTAGGCTAGG - Intronic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1070161334 10:73868354-73868376 CTCTAGGAAGACAGGTGGGAGGG + Intronic
1070540247 10:77410419-77410441 CTCTAGGCAGGCAGCAGGGAGGG - Intronic
1071797243 10:89019978-89020000 GGTTAGGCAGACAGTTAGGAGGG + Intergenic
1073994107 10:109295700-109295722 CTTTTGGGGGACAGTTGGGAAGG + Intergenic
1074344308 10:112667407-112667429 CTTTTAGAAGACAGTAGGTATGG - Intronic
1074872540 10:117588378-117588400 CTTGAGGCCGTCAGTGGGGATGG - Intergenic
1075821520 10:125316974-125316996 CTTCAGGCAGACAGTTCAGAAGG - Intergenic
1076470062 10:130712250-130712272 TTTGAGGAAGACAGAAGGGAAGG - Intergenic
1077612066 11:3649432-3649454 CATTGGGCAGAGACTAGGGAGGG - Intronic
1077705254 11:4478908-4478930 CTTTAGGGAGCCAGAAGGCAGGG + Intergenic
1077793701 11:5468867-5468889 CTGCATGCAGACAGTAGGAATGG + Intronic
1077902116 11:6497934-6497956 CTTTGGGGAAGCAGTAGGGAGGG + Exonic
1078076870 11:8170023-8170045 TTATAGGCAGACAGGTGGGAGGG + Intergenic
1079725025 11:23870040-23870062 CTACAGGCAGAAAGTAGAGAAGG + Intergenic
1080109489 11:28549343-28549365 ATTTAGGCACACAGTAGGAGAGG + Intergenic
1080652074 11:34230671-34230693 CTTCAGGCAGACACCATGGAAGG - Intronic
1081678024 11:44982326-44982348 CCTTAGACAAACAGGAGGGATGG - Intergenic
1082916093 11:58439236-58439258 CTTTAAAAAGACTGTAGGGAAGG - Exonic
1083537722 11:63486643-63486665 CTTTAGGGACTCAGAAGGGAAGG + Intronic
1083548215 11:63564673-63564695 CTGGAGGGAGACAGTAGGGTTGG + Intergenic
1085516119 11:77112884-77112906 CTTTAGGCACAGAGAAGTGAGGG + Intronic
1085846178 11:80068256-80068278 GTTTAGGCAAACAGAAGGGACGG + Intergenic
1086537930 11:87871274-87871296 CTGGTGGCAGACGGTAGGGAGGG - Intergenic
1088738081 11:112745103-112745125 CTTTAGGTACAAAGTAGGCATGG + Intergenic
1089094097 11:115903996-115904018 ATTTAGGCAGACATTTGTGATGG + Intergenic
1089788571 11:120925535-120925557 GTTTTGGCAGCCAGCAGGGATGG + Intronic
1090604313 11:128405691-128405713 TTTTCAGCAGACAGAAGGGAGGG + Intergenic
1090711139 11:129386866-129386888 GTTTAGGCAGACAGGAGTGGTGG - Intronic
1091188583 11:133669861-133669883 CTGTGGGCAGACAGCAGGGCGGG - Intergenic
1091692270 12:2605351-2605373 CTTAGGGCAGACACTTGGGATGG - Intronic
1091999579 12:5021238-5021260 CTTTGGGCAGACAGAGGGGAGGG - Intergenic
1092907327 12:13113637-13113659 CTTTATGCAGTAAGCAGGGAAGG - Intronic
1093623657 12:21321837-21321859 AGTTAGGCACACAGTAGGGTGGG - Intronic
1093841335 12:23905536-23905558 CTTTAGGCACATAGTAAGTATGG - Intronic
1094317065 12:29146484-29146506 CTTTAGGCAGACAGTAAGGAAGG - Intergenic
1096283191 12:50274731-50274753 CTTTAGGCAGTGATCAGGGAAGG + Intronic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1098496312 12:71139632-71139654 CTTTTAACAGACAATAGGGATGG + Intronic
1101627200 12:106456918-106456940 GTTTACACAGACAGTAGGTAGGG + Intronic
1105553787 13:21426391-21426413 TTTGAGGAAGACAGTGGGGAGGG - Intronic
1106209747 13:27630876-27630898 CTTTGGGTAGACAGCAGGGTGGG - Intronic
1106237030 13:27871304-27871326 CATAAGGTAGACAATAGGGAAGG - Intergenic
1107052453 13:36066223-36066245 GTTTAGGCAGCCAGGAAGGAGGG + Intronic
1107238315 13:38199897-38199919 CTTTAGGAAGATATGAGGGAAGG + Intergenic
1113343430 13:109448636-109448658 CTGTAGACTGACAGTAGTGATGG - Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119012652 14:71011884-71011906 CTATAGCCAAAAAGTAGGGAGGG - Intronic
1119382446 14:74237991-74238013 ATGTAGGCACACAGTAGGCACGG + Intergenic
1120228938 14:81821971-81821993 CTTTAGGCAGAAAACAGGGAGGG + Intergenic
1120846007 14:89125773-89125795 CAGAAGGCAGACAGTTGGGAGGG - Intronic
1121178799 14:91911725-91911747 GTTTAGGCAGTGAGTAGTGAGGG - Intronic
1122106163 14:99457235-99457257 CTTTAGGAAGTCATTAGGAATGG - Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122448539 14:101784748-101784770 CTTTGGGCAGAAAGAAGGGTGGG + Intronic
1126173698 15:45715973-45715995 CCAGAGGCAGAGAGTAGGGATGG - Intergenic
1128751997 15:70156427-70156449 TTTCAGGCTGTCAGTAGGGAAGG - Intergenic
1128889487 15:71318062-71318084 CTTTTGGGGGGCAGTAGGGAAGG + Intronic
1129323564 15:74787903-74787925 CTGCAGGGAGACAGGAGGGAAGG + Intronic
1130865565 15:87930548-87930570 CTCCAGGCAGACAGAAGGGAGGG - Intronic
1132420413 15:101661191-101661213 ATTTAGGATGACAGTGGGGAAGG - Intronic
1135033898 16:19060608-19060630 CTTCAGGGGGACAGGAGGGAGGG + Intronic
1135271051 16:21070196-21070218 CTTTTGGCAGACAGTTGCAAAGG + Intronic
1136022683 16:27449965-27449987 CCTTATCCAGACAGTGGGGAAGG + Exonic
1137803070 16:51278683-51278705 CTATATGCAGACAACAGGGAGGG - Intergenic
1138978725 16:62240866-62240888 CCTTAGGCAGACAGTAAGGGAGG + Intergenic
1140047517 16:71452006-71452028 CTCTAGGCAGGCAGAAGGGAGGG - Intronic
1140562992 16:76005747-76005769 CTTTAGGCACTCAGAAGGGGAGG + Intergenic
1141412737 16:83846504-83846526 ATTTAGGCAGATACTAAGGAAGG - Intergenic
1141777974 16:86137055-86137077 CTTTAGGAATACAGAAGGAAGGG + Intergenic
1144827195 17:18112136-18112158 CTTGGGGCAGACAGAAGGTATGG + Intronic
1147619922 17:41859125-41859147 CTTTGGGCAGCCAGAGGGGATGG + Intronic
1151640682 17:75390675-75390697 GTGTAGACAGAAAGTAGGGAAGG + Intronic
1151677078 17:75604086-75604108 CAAAAGGCAGGCAGTAGGGATGG + Intergenic
1153145008 18:2021341-2021363 CTATAGGCAGACAGAAGGCAGGG - Intergenic
1156437804 18:37152490-37152512 TTTTAGGCAGATAAAAGGGAGGG + Intronic
1157190901 18:45580820-45580842 TTTAAGGCAGACAGTGGGCAAGG + Intronic
1157829116 18:50840433-50840455 TTTTAGGCAGACAGAAGGAAGGG - Intergenic
1157954060 18:52075637-52075659 CTGAAGGAAGACAGGAGGGAAGG - Intergenic
1163700131 19:18782731-18782753 CTGCATGGAGACAGTAGGGACGG - Intergenic
1164852915 19:31499870-31499892 CAGAAGGCAGATAGTAGGGACGG + Intergenic
925883904 2:8377839-8377861 CTTTAGGCAAAAAGTAGAAAAGG - Intergenic
928119139 2:28569482-28569504 CTTTAGACTGACAAAAGGGAGGG + Intronic
928168884 2:28990663-28990685 CCCTAGTCAGACAGTATGGAGGG + Intronic
930254653 2:49076591-49076613 CTTTTGGTAGACTGTAGGGAAGG - Intronic
931319237 2:61159902-61159924 CTGGAGGCAGACAGTGGTGATGG - Intronic
932220801 2:69997547-69997569 CTTGAGGCAGACAGGAGAGGTGG - Intergenic
932302823 2:70679035-70679057 CTTTAAGCAGACGGAAGGAAAGG - Intronic
932703630 2:74006886-74006908 CTTTAGGCAAATAGAAGGCAGGG + Intronic
933252855 2:80048341-80048363 CTTCAGGCAGTGAGAAGGGAGGG + Intronic
936966646 2:118133824-118133846 CATGAGGCAGGCAGTAGGGATGG + Intergenic
939004372 2:136768101-136768123 CTTTTGAGAGAAAGTAGGGAAGG + Intronic
939024832 2:136999747-136999769 CTTTAGTCAGACATTAAGGGGGG - Intronic
941710327 2:168705119-168705141 CTCTAGTCACACAGTAAGGACGG - Intronic
944487364 2:200221048-200221070 CTTTGGGGAGACAGAAGCGAGGG - Intergenic
945097856 2:206236755-206236777 GTTTAGGTACACAGTATGGAAGG - Intergenic
946881176 2:224178655-224178677 ATGTAGGGAGGCAGTAGGGATGG + Intergenic
947024064 2:225716669-225716691 GCTTAGGAAGACAGTAGGGAGGG - Intergenic
947181186 2:227412819-227412841 ATTTAGGAAAACAGAAGGGATGG + Intergenic
947380548 2:229541099-229541121 CTTTAGGGAGTCAGCAGGAAGGG + Intronic
948027361 2:234788968-234788990 CATCAGGGAGGCAGTAGGGATGG - Intergenic
948857910 2:240738842-240738864 CTCAAGGCAGACAGGAGAGAAGG - Intronic
1169222890 20:3836783-3836805 GTTTAGACAGACAGCAGGGCAGG - Intergenic
1171973100 20:31576936-31576958 TTTTGGGAAGGCAGTAGGGAGGG - Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1174264743 20:49323252-49323274 CTTTTGGTAGACAATAAGGAGGG + Intergenic
1176551470 21:8224267-8224289 CTGAAGGCAGACCGAAGGGAAGG - Intergenic
1176570379 21:8407266-8407288 CTGAAGGCAGACCGAAGGGAAGG - Intergenic
1176578288 21:8451453-8451475 CTGAAGGCAGACCGAAGGGAAGG - Intergenic
1178133447 21:29599683-29599705 TTTTATGCAGACAGCAGGGGAGG - Intronic
1182079029 22:27516095-27516117 CTTGTGGCAGACAGCAGGAATGG + Intergenic
1184694413 22:46131582-46131604 CTCTAGGCAGGCAGAGGGGAGGG + Intergenic
1203256492 22_KI270733v1_random:141211-141233 CTGAAGGCAGACCGAAGGGAAGG - Intergenic
949404950 3:3704283-3704305 CTTTGGGCAAACATTATGGAAGG - Intronic
955212221 3:56953004-56953026 CTTTAGGCAAATAGCAGGGGTGG + Intronic
956881868 3:73519179-73519201 CCTTGGGCAGAAAGTAGGGTGGG + Intronic
958220468 3:90667427-90667449 TTTGAGGCCGACAGTAGGAAAGG - Intergenic
958230217 3:90892194-90892216 TTTGAGGCCGACAGTAGGAAAGG + Intergenic
958240425 3:91063791-91063813 TTTGAGGCATACAGTAGGAAAGG + Intergenic
958247182 3:91176790-91176812 TTTGAGGCCGACAGTAGGAAAGG + Intergenic
960167268 3:114417421-114417443 CTTAAGGAAAATAGTAGGGACGG - Intronic
962375036 3:134852175-134852197 ATTGAGGCAGACAGTGGTGAGGG - Intronic
962658986 3:137581391-137581413 ATCAAGGCAGGCAGTAGGGATGG - Intergenic
967891897 3:194369619-194369641 CTCTAAGCAGAGAGGAGGGATGG + Intronic
968565841 4:1312283-1312305 CAGAAGGCAGACAGCAGGGAAGG - Intronic
969116269 4:4872487-4872509 ATTAAGGCAGACAGTAGCTATGG - Intergenic
969209158 4:5673052-5673074 CTGTAAGCAGACAGTGGTGATGG + Intronic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
975708328 4:77133719-77133741 CTTTAGGCAGGCAGGTGGGCAGG - Intergenic
976708163 4:88040689-88040711 CTTTCTGCAGACAGTATGAAGGG - Intronic
976775749 4:88704163-88704185 CTTTAGGAAGCCACTAGAGAAGG - Exonic
979435269 4:120680783-120680805 CTTTGGGGACACAGTGGGGAAGG + Intergenic
981634031 4:146854595-146854617 CTTTAGGGATACATTAGAGAGGG - Intronic
982367105 4:154591107-154591129 CTTTATGCAGAAATTAGGGTTGG + Intergenic
987024858 5:13915558-13915580 GTTCAGGTAGACAGGAGGGATGG - Intronic
988853496 5:35202495-35202517 AAGTAGGCAGAGAGTAGGGAGGG - Intronic
989631396 5:43485702-43485724 CTTTAGTCAGGTAGTAAGGAAGG + Intergenic
990097331 5:52133593-52133615 CTTTGTTCAGACAGTAGAGACGG - Intergenic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
994683668 5:102922365-102922387 TTTCAGGCAGACAGCTGGGATGG + Intronic
995708892 5:115014711-115014733 CTTTTGGCAGAGAGTATAGATGG + Intergenic
996347489 5:122502633-122502655 CATTAGGCAGAAAATAGTGAGGG - Intergenic
996853333 5:127977394-127977416 CTTTTGGGTGACAGTAGGAAAGG + Intergenic
997036739 5:130202194-130202216 CTTTGGGGAGACTGTTGGGAAGG - Intergenic
997711365 5:136007448-136007470 CTTTAGGGAGAAAGAAGGGCAGG + Intergenic
998142412 5:139707614-139707636 CTTCAGGCAGGCAGTGGGGGAGG + Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1003822718 6:9917927-9917949 CTGAAGGCTGAGAGTAGGGAAGG - Intronic
1003916732 6:10793910-10793932 CTAGAGGCAGACAGCAGGCAGGG - Intronic
1004411204 6:15383022-15383044 GTGTAGGGAGACAGAAGGGAGGG + Intronic
1004753550 6:18587626-18587648 ATTTAGGGAGAGAGTAAGGAGGG + Intergenic
1004916410 6:20336597-20336619 GTTTAGACATACATTAGGGAAGG - Intergenic
1005756675 6:28931178-28931200 CATTAGGGAGAGAGAAGGGAAGG + Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1018217875 6:161548491-161548513 CTTTAAGTAGACAGGAGTGAAGG - Intronic
1024809158 7:53187295-53187317 CCTCAGGCTGACCGTAGGGAGGG + Intergenic
1026254244 7:68697026-68697048 CAATAGGCAGAGAGTAGGGATGG + Intergenic
1027279885 7:76600625-76600647 CTTTAGGAACACAGTTCGGAAGG - Intergenic
1029532367 7:101133928-101133950 CTTTAGGGAGCCAGGAGAGAGGG - Intronic
1031123732 7:117749486-117749508 CTTTAAGCACTCAGCAGGGATGG - Intronic
1034387338 7:150751091-150751113 CTTTGGGCAGAGAGAAGTGATGG - Intergenic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1036481697 8:9145846-9145868 CTTTAGTGAGGCAGTAGTGATGG - Intronic
1036989554 8:13577246-13577268 TTTTAGCTGGACAGTAGGGAGGG + Intergenic
1037487473 8:19362096-19362118 CTTGAGGAAGACAGCAGGTATGG + Intronic
1037525122 8:19717150-19717172 CTTTTGGCAGAGAGGAGGAATGG + Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038418000 8:27411700-27411722 CTTTAGGCACACAGAAGGTGGGG - Intronic
1041135746 8:54756903-54756925 CATTTTCCAGACAGTAGGGAGGG + Intergenic
1041693061 8:60708551-60708573 ATGTAGGCAGGCAGTAGGGGAGG - Intronic
1042307499 8:67346695-67346717 TTTTGGGCAGACAGTGGGGCTGG - Intergenic
1044747869 8:95388719-95388741 CTTTAAGCAGAAAGTAGGAGGGG - Intergenic
1044876806 8:96676833-96676855 CTTTGGGGACTCAGTAGGGAAGG - Intronic
1048860799 8:138723336-138723358 CTTTAGGAAGGCAGGAGGAAGGG + Intronic
1049984912 9:941100-941122 CTTTATGCAAACAGTATGGTGGG + Intronic
1051626293 9:19102722-19102744 CCTCAGGCTGACCGTAGGGAGGG - Exonic
1052721210 9:32173205-32173227 CTGGAGGCAGAGAGAAGGGAGGG - Intergenic
1053354827 9:37436777-37436799 CTGTAGCCAAACAGTAGAGATGG + Exonic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1055498016 9:76875155-76875177 CTCTGGGCAGACAATGGGGAAGG - Intronic
1056157149 9:83849878-83849900 CTGGAGGCAGGCAGAAGGGATGG + Intronic
1056353389 9:85774235-85774257 CTGGAGGCAGGCAGAAGGGATGG - Intergenic
1056992706 9:91425256-91425278 CTCATGGCAGACACTAGGGATGG - Intergenic
1057905157 9:98977406-98977428 GTTTAGGCAGCCACCAGGGAGGG - Intronic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1060044891 9:120332134-120332156 CGCTTGGGAGACAGTAGGGAAGG - Intergenic
1203472649 Un_GL000220v1:122911-122933 CTGAAGGCAGACCGAAGGGAAGG - Intergenic
1186688952 X:11954568-11954590 CTTTAGGTAGGAAGTAAGGAGGG + Intergenic
1192031995 X:67523813-67523835 GTTTAAGCAGGGAGTAGGGATGG - Intergenic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1193450812 X:81662920-81662942 GTATAGGCACACAGTAGGGAAGG - Intergenic
1195386561 X:104318991-104319013 CTTTTGGGAGACAGTGGGGAGGG + Intergenic
1196639519 X:118041780-118041802 CTAAAGGAAGACAGGAGGGAAGG + Intronic
1196943335 X:120799191-120799213 CTTAAGGCAGTCAGTAGTGAGGG - Intergenic
1197671940 X:129286511-129286533 TTTTTTGCAGAGAGTAGGGATGG + Intergenic
1198863243 X:141092778-141092800 CTCTAGACAGACAGTAGTCAAGG + Intergenic
1199984561 X:152941445-152941467 ATTTGGGAAGACAGCAGGGACGG + Intronic
1200342202 X:155409461-155409483 CTTTAGGGGGACTGTTGGGAAGG + Intergenic
1201125110 Y:10905886-10905908 CTGTAGGCAGAGACTAGAGAAGG - Intergenic