ID: 1096357550

View in Genome Browser
Species Human (GRCh38)
Location 12:50954247-50954269
Sequence CTGGGGGCTTACCATGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096357550_1096357555 0 Left 1096357550 12:50954247-50954269 CCTAATACATGGTAAGCCCCCAG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1096357555 12:50954270-50954292 TAAATGTTAGCTGTTATTTGAGG 0: 1
1: 0
2: 6
3: 52
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096357550 Original CRISPR CTGGGGGCTTACCATGTATT AGG (reversed) Intronic
903658555 1:24963490-24963512 CTGGGGGTGGACCATGTATAAGG - Intronic
904431003 1:30464091-30464113 CTGGGTGCTTCCTATCTATTAGG - Intergenic
904482803 1:30804821-30804843 CTGAGGGCTTACTATGTGCTGGG - Intergenic
904961038 1:34333094-34333116 CTGAGGGCTGACCTTGGATTAGG - Intergenic
906323645 1:44831277-44831299 CTGGGCCCTTTCTATGTATTAGG - Intronic
906424579 1:45699847-45699869 CTGTGAGTTTTCCATGTATTTGG - Exonic
907519595 1:55014464-55014486 CTGGGGGCTCACCAGGTGCTAGG - Intergenic
908026687 1:59959398-59959420 CTGGGTGGTTACCCAGTATTGGG - Intergenic
908995496 1:70147867-70147889 CTGGGTGTTTACTATGTTTTAGG + Intronic
909751587 1:79167604-79167626 CTGAGAGCTTAACATTTATTTGG + Intergenic
912382972 1:109257565-109257587 CTGGGGGCATAGCAGGCATTTGG + Intronic
912649324 1:111424029-111424051 CAGTGGGCATACCATGTTTTGGG - Intronic
912684308 1:111749950-111749972 CTGGGGGCCTATGATTTATTAGG - Intronic
916353838 1:163882230-163882252 TTGGAGGCTTACCATGCATCAGG - Intergenic
916755506 1:167766170-167766192 TTGGGAGCTTACTATGTAGTGGG + Intronic
917211705 1:172638344-172638366 CAGGGGGCTTACATTGTAGTTGG + Intergenic
917380533 1:174401394-174401416 GTGAGTGCTTATCATGTATTAGG - Intronic
919139547 1:193553562-193553584 CTGTGTGCTTAGCATATATTTGG - Intergenic
919435344 1:197552306-197552328 CTGAGTGCTTACAATGTATTAGG - Exonic
919937772 1:202265871-202265893 CAGGGGTCTTCCCATGTAATGGG + Intronic
923207314 1:231771536-231771558 TTGGGTGCTTACCATGTACCAGG + Intronic
923511319 1:234656326-234656348 CTGGGGGCTTTCCGTGTAAGAGG + Intergenic
1065645668 10:27831425-27831447 GTGAGTGCTTACCATGTATCAGG + Intronic
1067801104 10:49360361-49360383 CTGGAGTGTTACCATGTATGGGG + Intergenic
1077445258 11:2587769-2587791 CTGGGATCTCACCATGCATTTGG + Intronic
1079401359 11:20108796-20108818 CTGGAAGCTTACCATTAATTTGG + Intronic
1080888337 11:36387096-36387118 CTGCTGGCTTACCCTGTATCTGG + Intronic
1081890684 11:46539796-46539818 CTGAGGGCCTACTATGTGTTAGG - Intronic
1084638413 11:70409047-70409069 CTGGGGCCTTCCCAGGTTTTAGG + Intronic
1085720449 11:78907685-78907707 CTGAGGGCCTACCATGCATCAGG - Intronic
1086066605 11:82751750-82751772 TTGGGGGCTTACTATGTGCTAGG + Intergenic
1088089334 11:106020006-106020028 TTGTGGGCTTACTATGTCTTAGG - Intronic
1088115062 11:106303836-106303858 CTGGAGGGTTACTATGTATCAGG + Intergenic
1088822202 11:113465923-113465945 CTGAGAGCTTACCATGCATCAGG + Intronic
1089899432 11:121965444-121965466 CTGGGGGCTTCCCTTTGATTGGG + Intergenic
1089981503 11:122776644-122776666 CTGGGAGCTTCCCTTGTCTTTGG + Intronic
1091921365 12:4307672-4307694 CTGGTGGCTTTCCTTGTCTTTGG + Intergenic
1092096193 12:5843921-5843943 CAGGGGGCTTATGATATATTTGG + Intronic
1092207943 12:6627699-6627721 CTAGGAGCTTACCATCTAGTTGG - Intronic
1094771447 12:33665454-33665476 CTGGGCACTTACCATGTGCTAGG + Intergenic
1095904765 12:47366542-47366564 CTGAGGACTTACCATGTAACAGG - Intergenic
1096357550 12:50954247-50954269 CTGGGGGCTTACCATGTATTAGG - Intronic
1096485798 12:51980206-51980228 CTGCATGCTTACTATGTATTAGG - Intronic
1096749134 12:53747720-53747742 CTGGGGACTTACTATGTACAGGG + Intergenic
1097627371 12:62017029-62017051 CTGAGGGCTTACCATGCACCAGG + Intronic
1099218391 12:79881454-79881476 CTGGGGCCTTACTCTCTATTAGG - Intronic
1100456390 12:94755637-94755659 TTGAGTGCCTACCATGTATTAGG - Intergenic
1101254395 12:102963507-102963529 CAGGGAGGTTACCATGTAGTAGG - Intergenic
1101481607 12:105103431-105103453 CTGAGTGCTTAACATGTATCAGG + Intergenic
1102244457 12:111346525-111346547 ATGGGCGCTTATCATGTGTTGGG - Intronic
1102410679 12:112715639-112715661 CTGTGAGCTCACCATGTAGTTGG - Intronic
1102766683 12:115439755-115439777 CTGGGTGCTCACAATGTATCAGG + Intergenic
1107204816 13:37771736-37771758 CTGAGCACATACCATGTATTAGG + Intronic
1107353968 13:39546121-39546143 TTGGGGGCTTACCATGGGCTAGG - Intronic
1107638240 13:42414798-42414820 CTAAGTGCTTAACATGTATTAGG - Intergenic
1110678285 13:78276988-78277010 CTGGGGGCTTCCCATGCTCTAGG + Intergenic
1112157245 13:96831563-96831585 CTGGGTGCCTACAATGTGTTAGG - Intronic
1114042952 14:18695603-18695625 CTAGGGGCTTGCCCTGGATTAGG + Intergenic
1114047244 14:18886043-18886065 CTAGGGGCTTGCCCTGGATTAGG + Intergenic
1114116971 14:19633354-19633376 CTAGGGGCTTGCCCTGGATTAGG - Intergenic
1121360599 14:93254844-93254866 TTGGGGACTTACGATGTGTTAGG + Intronic
1122243895 14:100387539-100387561 CTGAGTGCTTACCATGTACTAGG + Intronic
1122309974 14:100788318-100788340 CTAGGGGCTGACCATTTACTGGG - Intergenic
1122955795 14:105070386-105070408 CTGGGGGCTTCCCATGGCTGTGG - Intergenic
1125421045 15:39504326-39504348 CTGGGGGTTTACCATGTGCCTGG + Intergenic
1125751216 15:42030435-42030457 CTGGGAGCCTATCGTGTATTTGG - Intronic
1125903848 15:43371803-43371825 CTGAGCGCTTACCATGTGTTTGG - Intronic
1126733856 15:51712189-51712211 CTGTGTGCTTATCATGTACTGGG - Intronic
1127642416 15:60928478-60928500 CTGAGGTCCTACCATGTATTAGG - Intronic
1128102344 15:65012988-65013010 CTGGGGTCTTTCCATTTACTTGG + Intronic
1128307724 15:66611063-66611085 TTGGGGGCTTCCCATGAAATGGG + Intronic
1128904877 15:71457806-71457828 CTGAGGTCTTAGCATGTCTTTGG + Intronic
1134769592 16:16795747-16795769 CTGAGGGCTTACTATGTACATGG - Intergenic
1138975938 16:62207891-62207913 CTGAGCGCCTACTATGTATTAGG - Intergenic
1146539086 17:33679467-33679489 TTGGGGGCCTACCTTGTACTGGG + Intronic
1146617828 17:34370661-34370683 CTGTGGGCCTACGATGCATTGGG - Intergenic
1149608987 17:57945685-57945707 CTAGGGGCTTAATAAGTATTTGG + Intronic
1153845881 18:9049512-9049534 CTGTGGGCATAACATCTATTTGG - Intergenic
1156482333 18:37444210-37444232 CAGGGTGCTTACCCTGCATTTGG + Intronic
1157684015 18:49628585-49628607 CTGGGAGCTTACCATCTTGTTGG + Intergenic
1157729890 18:49994283-49994305 TTGAGTGCTTACCATGTACTGGG - Intronic
1159723464 18:71922580-71922602 CTGTGGACTGACAATGTATTTGG - Intergenic
1162343001 19:10102995-10103017 CTGGGGACTTACCGTGTGTAGGG + Intergenic
1164811875 19:31163864-31163886 CTGGGGGCTTACCCTGCACCAGG + Intergenic
1167728779 19:51237346-51237368 TCGGGGGCTTAACATTTATTGGG + Intronic
929985568 2:46728416-46728438 TTGAGTGCTTACTATGTATTGGG + Intronic
930172824 2:48268693-48268715 TTGAGTGCTTACCATGTACTGGG - Intergenic
931358821 2:61560319-61560341 TTGGGTGCTTACCAAGTAGTAGG - Intergenic
933434633 2:82232424-82232446 GTGAGGGCCTACCAGGTATTAGG + Intergenic
933462351 2:82604411-82604433 CTGAAGGCTCACCATGTAATAGG - Intergenic
933839333 2:86273861-86273883 CAGGGAGCTTACAATGTATTAGG - Intronic
934040383 2:88123440-88123462 CTTGGTGCTCAACATGTATTTGG - Intronic
936948257 2:117950803-117950825 CTGGGAGCTTACTATCTAATAGG - Intronic
937645960 2:124266155-124266177 ATGGGCCCTTACCATGTATAAGG - Intronic
937876078 2:126826489-126826511 CTGGGGGCTCACCATGATGTTGG + Intergenic
938246299 2:129780291-129780313 CGGGGAGCTTCCCATTTATTTGG - Intergenic
938424623 2:131174589-131174611 CTAGGGGCTTGCCCTGGATTAGG + Intronic
941773911 2:169371188-169371210 CTGAGGACCTGCCATGTATTGGG - Intergenic
942975937 2:182017072-182017094 CTGTTGGCCTACCAAGTATTTGG - Intronic
943734599 2:191340482-191340504 CTGGGGACTAAACATGTCTTTGG - Intronic
944307000 2:198189869-198189891 CTGAGGACTTACTATGTGTTGGG - Intronic
945252250 2:207773599-207773621 CTGGCTGTTTAACATGTATTAGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946411646 2:219518113-219518135 CTGGGTGCCTACTATGTGTTGGG + Intronic
947004916 2:225499745-225499767 CTGGCAGCTAACAATGTATTGGG + Intronic
947301290 2:228690576-228690598 CTGCGGGCTCACCATGTGTCAGG - Intergenic
948639622 2:239367059-239367081 CTGGGGGCTGATCACTTATTTGG - Intronic
1171305750 20:24104487-24104509 CTGTGGGCTGACCATGTTTCAGG - Intergenic
1172833260 20:37854949-37854971 CTGGGGACTTACTATGTGTCAGG - Intronic
1173814871 20:45980745-45980767 CTGGGTACTTACCAAGTATCAGG + Intergenic
1178785806 21:35652156-35652178 CTGGGGCTTCACCATGTATTAGG - Intronic
1180465777 22:15608698-15608720 CTAGGGGCTTGCCCTGGATTAGG + Intergenic
1180732198 22:17990451-17990473 CTGGGTGCTTACCACGTGCTGGG + Intronic
1182188144 22:28429091-28429113 CTGGGGGCTTACTATGTGCCAGG - Intronic
1183253222 22:36744633-36744655 CTGGGGGCTTACTATGTGCCTGG + Intergenic
1183397684 22:37581828-37581850 CTGGGGTTTTACCATGCCTTTGG - Intronic
1183430294 22:37761807-37761829 CTGGGGGCTTACCTTGTCCTGGG + Intronic
1183919539 22:41153860-41153882 CTGGGGGGTTGCCATGGAGTGGG - Intronic
951963693 3:28357394-28357416 CCGTGGGCTGCCCATGTATTTGG + Intronic
954444710 3:50540475-50540497 CTGCAGGCCTACCATGTGTTGGG - Intergenic
955235691 3:57137120-57137142 CTGAATGCTTACCATGTGTTGGG - Intronic
956681941 3:71789121-71789143 CTGGGAGCTTACCATCTCATGGG + Intergenic
958984591 3:100765829-100765851 CTGGTGGCTTACCTCGTGTTTGG + Exonic
959546829 3:107606231-107606253 CGTGGGTCTTACCATATATTAGG - Intronic
960098577 3:113713709-113713731 CTGAGAGCTTACCATGTATCAGG - Intergenic
961763778 3:129192010-129192032 TTGGGTGCTTACCATGTGTCAGG - Intergenic
963668965 3:148227989-148228011 CTGAGTGCCTAGCATGTATTTGG + Intergenic
964071266 3:152635968-152635990 CCTGGGGATTACCATCTATTTGG + Intergenic
966885771 3:184377434-184377456 TTAGGGGCTTACCTTGTCTTAGG + Intronic
967299230 3:187996192-187996214 CAGGGTGCTTACCAAGCATTAGG - Intergenic
970219234 4:13793137-13793159 CTAGTGGCTTTCCATGTAATTGG + Intergenic
970247083 4:14074905-14074927 AAGGGGGTTTTCCATGTATTAGG - Intergenic
975234543 4:71976929-71976951 CTGGGAGCTTACAATTTATAAGG + Intergenic
976039413 4:80864809-80864831 TTGAGTGCTTACCATGTATCAGG + Intronic
977393221 4:96439964-96439986 CTAGGAGCTTACCATCTAGTGGG - Intergenic
978872107 4:113591894-113591916 CTGGGAGCTCACCTTGTCTTAGG + Intronic
980718776 4:136664534-136664556 TTGAGGGCATATCATGTATTAGG + Intergenic
982356984 4:154481637-154481659 CTGGGAGTTTACCATGTGCTAGG + Intronic
985089314 4:186347391-186347413 CTGTGTGCTTACCATGTGTCAGG + Intergenic
986598536 5:9448412-9448434 CTAGGGGTTTACCATGTGTCAGG - Intronic
988082413 5:26430783-26430805 ATGGGGGCTTACCATGAGGTAGG + Intergenic
988543023 5:32129352-32129374 CTGAGAGCTTACCATGTGTTAGG - Intronic
993921510 5:93810591-93810613 ATGGGGTCTTACTATGTTTTCGG + Intronic
997481108 5:134185177-134185199 CAGGGAGCTTACCATCTAGTGGG + Intronic
997967672 5:138372345-138372367 CTGAGGGCTTACCATATATAAGG - Intronic
999212891 5:149905680-149905702 CTGGGTGCTTACCATGAGTCAGG - Intronic
999596870 5:153214768-153214790 CTGGGTGCTTAGCATGTTATTGG - Intergenic
1002797352 6:484973-484995 CTGGGGACTTACCATGTGCGAGG - Intergenic
1006659920 6:35632438-35632460 CTGAGTGCTTACCATTTGTTAGG + Intronic
1011239520 6:85256064-85256086 CTGGGGGCAGACCATGTTTTAGG + Intergenic
1012811275 6:103961566-103961588 ATATGAGCTTACCATGTATTAGG - Intergenic
1012951621 6:105524006-105524028 TTGGAGGCTTACTATGTGTTGGG + Intergenic
1013173330 6:107657131-107657153 CTGGGGCTTTACCATGCAGTTGG + Intronic
1013368340 6:109450978-109451000 CCGAGCGCTTACTATGTATTTGG + Intronic
1014678316 6:124396197-124396219 ATGGCATCTTACCATGTATTGGG - Intronic
1018030328 6:159836650-159836672 CTGGGGGCTTCCCAGGGAGTGGG + Intergenic
1020606081 7:10338548-10338570 CTGTAGACTTACCGTGTATTAGG - Intergenic
1021317042 7:19160790-19160812 CTGAGCACTTACTATGTATTTGG + Intergenic
1021494384 7:21258448-21258470 CTGAGTGCTTACCATGTGCTAGG + Intergenic
1021602664 7:22379777-22379799 CTGGGGGTTTACTGTGTAATGGG - Intergenic
1023181911 7:37492977-37492999 CTGTGGGCCTACCATGTACCAGG + Intergenic
1025165429 7:56708050-56708072 TTGGAGACTTACCATGTCTTTGG + Intergenic
1025240465 7:57267852-57267874 TTGGAGACTTACCATGTCTTTGG - Intergenic
1028647850 7:93118757-93118779 TTGGGCGCTTACCATGTACCAGG + Intergenic
1028894625 7:96027226-96027248 CTGAGAACTTACCATGTATAAGG - Intronic
1029630368 7:101746443-101746465 CTGGGGGCTTGCCCTGTCTAAGG - Intergenic
1030288812 7:107852019-107852041 CTGGGGAGTTACCATTTAATGGG - Intergenic
1031356242 7:120790428-120790450 CTGGGTTCTTAACATGTATGAGG - Intronic
1034419513 7:150981717-150981739 CTGGGGGCTTTCTAAGTACTGGG + Intergenic
1037492922 8:19412653-19412675 CTTGGGGCCTTCCATGTATGGGG - Intronic
1040879874 8:52192960-52192982 CTGGGGGCTTATTACATATTGGG + Intronic
1044423446 8:92024985-92025007 CGGAGTGCTTACCATGTATCAGG - Intronic
1046603149 8:116341006-116341028 CTAAGGGCTTACCATGTGTCAGG + Intergenic
1047413599 8:124644963-124644985 CTGGGGGCCTACTATATATGTGG + Intronic
1047752940 8:127896185-127896207 CTGAGGGCTTACTATGTCCTAGG + Intergenic
1054995817 9:71387708-71387730 CTGAGGGCTTACTATATGTTAGG - Intronic
1056663653 9:88563117-88563139 CTGAGGGCTTACCACATATGGGG + Intronic
1057925636 9:99145546-99145568 CTGAGGATCTACCATGTATTAGG - Intronic
1059462526 9:114443070-114443092 TTGGAGGATTCCCATGTATTTGG - Intronic
1059699992 9:116766080-116766102 ATGGAGGCTTGCCATGTTTTAGG - Intronic
1061344564 9:130012343-130012365 CTGAGGGCTTACCATGTGCCAGG - Intronic
1061397530 9:130351567-130351589 GTGGGGGCTCACCATGAACTCGG - Intronic
1062164739 9:135101958-135101980 CTGGGGGCTTCCCAGGCTTTGGG - Intronic
1188603789 X:32002863-32002885 TTTGGGGCTTACCATATATATGG - Intronic
1189378447 X:40484079-40484101 CTGGGAGATTACCATTGATTGGG + Intergenic
1190421536 X:50289585-50289607 CTGGGTGCTTACCATGTGTCAGG + Intronic
1192117306 X:68423577-68423599 CTGGGGGGTTGGAATGTATTGGG - Intronic
1192238042 X:69308449-69308471 CTGGGTGTTTACCATGTGCTGGG + Intergenic
1195459230 X:105104967-105104989 CAGGGGGCTTTCAATGTACTTGG - Intronic
1196244510 X:113384602-113384624 CTGAGTGCCTACCAGGTATTAGG - Intergenic
1196733210 X:118962253-118962275 CAGGGGGATCACCATCTATTTGG + Intergenic
1197958645 X:131980041-131980063 TTTGAGGCTTACTATGTATTAGG - Intergenic
1198546672 X:137699735-137699757 CTAGGGTCTTTCCATGTTTTTGG - Intergenic