ID: 1096358865

View in Genome Browser
Species Human (GRCh38)
Location 12:50966353-50966375
Sequence CCTTTGGATACCTACCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096358861_1096358865 -9 Left 1096358861 12:50966339-50966361 CCAATCTCCCTAATCCTTTGGAT 0: 3
1: 165
2: 181
3: 152
4: 276
Right 1096358865 12:50966353-50966375 CCTTTGGATACCTACCTCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096358865 Original CRISPR CCTTTGGATACCTACCTCTG TGG Intronic
901057799 1:6456877-6456899 CCATTGGCCACCTGCCTCTGCGG + Intronic
902529617 1:17082383-17082405 ACTTGGGATAGCTGCCTCTGAGG - Intronic
904946587 1:34203496-34203518 CCTGTGGATACCAAAATCTGAGG - Intronic
905461539 1:38125955-38125977 CCTTTGGAAACCTGCCTTTCAGG + Intergenic
906347066 1:45022774-45022796 CCCTTGGATACCAAAATCTGAGG + Intronic
907329532 1:53662030-53662052 CCCTTGATTACATACCTCTGGGG - Intronic
910844317 1:91590827-91590849 TCTTTGGAAACCTACATTTGTGG + Intergenic
916026241 1:160836150-160836172 CCATTCCATACCTATCTCTGGGG - Intronic
917585761 1:176425337-176425359 CCTTTGGATTCTTCTCTCTGGGG + Intergenic
917675740 1:177317671-177317693 CCTTTGGACACCAAAATCTGTGG - Intergenic
920202795 1:204270174-204270196 CCTTTCAATACCTCCATCTGTGG + Intronic
924513577 1:244748351-244748373 CCTTTAAAAACCTACTTCTGAGG - Intergenic
1062821710 10:539502-539524 CCTATGGATACCAAGGTCTGTGG - Intronic
1063168471 10:3484924-3484946 CCTTTGGCCACCTCCCTCCGCGG + Intergenic
1064194517 10:13234316-13234338 CCTTTGGGTCCCCACTTCTGAGG + Exonic
1065323342 10:24529219-24529241 CCATTGGATACCAAAATCTGAGG + Intronic
1065389938 10:25173322-25173344 CATTTGGAGACCAACCACTGCGG + Intergenic
1070973038 10:80582916-80582938 CCTCTAGATACTTACATCTGAGG + Intronic
1073049055 10:100656243-100656265 CCCTTGGCTTCCTGCCTCTGCGG + Intergenic
1074395392 10:113093595-113093617 CCTTTAGATCCCTTCCTCTAGGG + Intronic
1077616387 11:3677311-3677333 CCTTTGAATTCCCACCTTTGGGG - Intronic
1080137741 11:28876641-28876663 CCCTTGGATACCAAAATCTGGGG - Intergenic
1080377066 11:31725135-31725157 CATTTGGATTCCTGCCTCAGAGG - Intronic
1081453637 11:43198695-43198717 CCTATGGATAACTACCTCTGTGG - Intergenic
1088129583 11:106471600-106471622 CCTTTAGATAACTGCCCCTGAGG - Intergenic
1089375912 11:117994509-117994531 CCTTTGTATCCCTGGCTCTGAGG - Intronic
1093098179 12:14995579-14995601 CCTTTGAATCCCTTCCTCTATGG - Intergenic
1095698759 12:45169603-45169625 ATTTTGGATACCTGCTTCTGAGG + Intergenic
1096358865 12:50966353-50966375 CCTTTGGATACCTACCTCTGTGG + Intronic
1098192259 12:67962109-67962131 TCTCTGGGCACCTACCTCTGTGG + Intergenic
1102074150 12:110046753-110046775 CCATTGGATACCCACTGCTGTGG - Intronic
1107232113 13:38122316-38122338 CCAATGGATACCTAAGTCTGTGG + Intergenic
1108826478 13:54417991-54418013 CATTTGGATTCCTTCCTCTACGG - Intergenic
1110537068 13:76663507-76663529 CTTTTGCACACCTACCTCTAGGG - Intergenic
1113352549 13:109543463-109543485 CCCTTGGATACCAAAATCTGAGG + Intergenic
1115160952 14:30393329-30393351 CCTATGGATACTGACATCTGGGG - Intergenic
1117056779 14:51920216-51920238 CCTGTGGATACCAAAATCTGAGG - Intronic
1117666125 14:58058123-58058145 CCCTTGGATACCAACATCTGAGG + Intronic
1121478260 14:94235024-94235046 CTTTTGGATACCAAAATCTGAGG + Intronic
1123824827 15:24070548-24070570 CCTTTGCATACCTTCCTCTGTGG + Intergenic
1124260021 15:28180937-28180959 CCTGTGGATACCAAGATCTGTGG - Intronic
1124870501 15:33536802-33536824 CCTTTGGATGCTTGCCTCTCTGG + Intronic
1126175764 15:45733880-45733902 CCTTTGGATTCCTGGCTCTGAGG - Intergenic
1126327276 15:47493272-47493294 CCCTTGGAAACACACCTCTGTGG + Intronic
1128242339 15:66109527-66109549 CCATTGGGTAACTACCTCTTCGG - Intronic
1128784045 15:70381693-70381715 CCTTTGGATCCCTCACTGTGGGG + Intergenic
1128965078 15:72050847-72050869 CCTTTGGATTACCAACTCTGTGG - Intronic
1130989737 15:88869202-88869224 CCTTTGGATACTTGTCTCAGTGG + Intronic
1133039500 16:3052836-3052858 CCTCTGGAGCCCCACCTCTGGGG - Intronic
1133043343 16:3072469-3072491 CCTCTGGAGCCCCACCTCTGGGG - Intronic
1135958184 16:26973927-26973949 CCTGTGGATACCAAAATCTGCGG + Intergenic
1137667596 16:50260826-50260848 CCTTTGGATCTCTCCCTCTAGGG - Intronic
1139781530 16:69355508-69355530 CATTTTGCTACCTCCCTCTGTGG + Intronic
1142766672 17:2068226-2068248 CCTGTGGATTCCTACCACTTGGG - Intronic
1143336516 17:6175570-6175592 CCTTTGAATCACTCCCTCTGGGG + Intergenic
1143611972 17:8023404-8023426 CCCTTGGATACCAAAATCTGAGG - Intergenic
1146008657 17:29178037-29178059 CCTTTAGGTACCTGCCTCTGGGG + Intronic
1146355926 17:32134230-32134252 CCCTTGAATACCAACATCTGAGG + Intergenic
1146478702 17:33184698-33184720 CCGTTGGATACCTGCCTTTCAGG + Intronic
1155558717 18:27051459-27051481 CTTTTGGATCACTCCCTCTGGGG + Intronic
1159012863 18:63074768-63074790 CCTTTGGATTTCTGCTTCTGAGG + Intergenic
1159199591 18:65166913-65166935 CCTCTGTAGACCCACCTCTGGGG + Intergenic
1159632042 18:70760218-70760240 GCTTGGGACACCTACCTCCGAGG + Intergenic
1161887899 19:7011225-7011247 ACTTTGGACACCTACCTCACAGG - Intergenic
1163269195 19:16240178-16240200 CCCTTGGATACCAAAATCTGAGG - Intronic
1164423987 19:28123849-28123871 CTTCTGGATTCCTACCTCTCAGG - Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1168136503 19:54355664-54355686 TCCTTGGATCCCTCCCTCTGGGG + Intronic
926360609 2:12083123-12083145 CCTTTGGAAACTTGCATCTGGGG + Intergenic
927333131 2:21889891-21889913 TCTAGGGATACCTACCTGTGAGG - Intergenic
928375987 2:30774172-30774194 CCTATGGATACACACCTCAGAGG + Intronic
931460108 2:62443120-62443142 CCTTTGAGTGGCTACCTCTGAGG + Intergenic
932337963 2:70941851-70941873 CCTTTGGAAGCTTCCCTCTGGGG - Exonic
935898086 2:107759363-107759385 CCTTTGGGTACCTTCCTCTATGG + Intergenic
938831819 2:135057602-135057624 CCTTTGAATTCCTAACCCTGAGG - Intronic
940976492 2:159951325-159951347 AGTTAGGATACCTACATCTGTGG + Exonic
947227482 2:227854080-227854102 CCTTTGGGTACAAAGCTCTGGGG - Intergenic
948012115 2:234657122-234657144 GATTTGCACACCTACCTCTGAGG + Intergenic
1170082507 20:12492138-12492160 TCTGTAGATTCCTACCTCTGGGG + Intergenic
1174220219 20:48948469-48948491 TCTTTGGATTCCTATCACTGAGG + Intronic
1178193836 21:30319674-30319696 CCGCTGGACACATACCTCTGTGG + Exonic
1183292468 22:37011127-37011149 GCCTTGGCTGCCTACCTCTGCGG - Exonic
1184349134 22:43932048-43932070 CTTTTGGATGCCTTTCTCTGTGG + Intronic
1184819003 22:46894608-46894630 GCTTTGGATACCTCCTTCAGGGG + Intronic
1184965824 22:47971451-47971473 CCTATGGATACCAAACCCTGAGG - Intergenic
951457746 3:22911518-22911540 CCTGTGGATACCAAAATCTGTGG + Intergenic
952006340 3:28846511-28846533 ACTTGGGATAAATACCTCTGAGG - Intergenic
953585685 3:44199246-44199268 CCTTTGGCCACCTACCTTTGTGG - Intergenic
957389799 3:79549699-79549721 CCTTTGGATACCAAGATCTGTGG - Intronic
959073462 3:101725320-101725342 CCTGAAGATACCTACCTCTTTGG + Intronic
960033208 3:113076678-113076700 CCTTTGGGCACCTTCCTCTGTGG - Intergenic
962186113 3:133261300-133261322 CCTTTGGATTGAGACCTCTGTGG + Intronic
966594856 3:181716605-181716627 GCTTTTGATAACTACATCTGAGG + Intergenic
967204684 3:187108699-187108721 CCCTTGGATACCAAAATCTGTGG + Intergenic
967286203 3:187872985-187873007 CCTTTTGCAACCTATCTCTGAGG - Intergenic
969067624 4:4500537-4500559 CCTCTGGATACCAAACTCTGTGG - Intronic
970954413 4:21793776-21793798 CCTTTGGGTATATACCCCTGTGG - Intronic
973872444 4:55179930-55179952 CAGTTGGAGACCTACCTATGGGG - Intergenic
975147121 4:70980631-70980653 CCTATGGATTCCTCACTCTGTGG - Intronic
983809764 4:172046656-172046678 CATTTGGATATCTTCTTCTGAGG + Intronic
986600223 5:9465702-9465724 CCTGTGGATACCAAACTCTGTGG - Intronic
987370947 5:17192455-17192477 GCTTTGGAATCCTTCCTCTGAGG - Intronic
987750723 5:22035753-22035775 ATTTTGGAAACCTTCCTCTGGGG - Intronic
988471068 5:31539287-31539309 CCTGTGGATACCAAAATCTGTGG - Intronic
990323343 5:54650302-54650324 CCTATGGATACCAAAATCTGAGG + Intergenic
993627040 5:90238353-90238375 GCTGTGGATACCCACCCCTGTGG - Intergenic
995425563 5:112018451-112018473 ACTTTGGAGACCTGCCTCTGGGG - Intergenic
995995455 5:118292933-118292955 TCTTTGGGTCCCTCCCTCTGGGG - Intergenic
997189942 5:131922550-131922572 CCCTTGGATACCAAAATCTGTGG - Intronic
1002321410 5:178378237-178378259 CCCTTGGAGAGCTACCACTGTGG - Intronic
1004622377 6:17342393-17342415 CCTTTGAATCCCTTCCTCTACGG - Intergenic
1005582977 6:27251183-27251205 CTTCCGGATACCTTCCTCTGCGG + Intronic
1005921000 6:30401562-30401584 CCTGTGGATACCAAAATCTGTGG + Intergenic
1006511039 6:34521314-34521336 CGTGTGGATTCCTACCTCAGTGG - Intronic
1006727820 6:36212503-36212525 CATTTGTATCCCTACTTCTGGGG + Intronic
1007597203 6:43058756-43058778 CCTCAGGATACCTTCCCCTGAGG + Intronic
1012467176 6:99529161-99529183 CCCTTGGATACCAAAGTCTGTGG - Intergenic
1012929708 6:105304305-105304327 CCTGTGGATACCGAAATCTGAGG - Intronic
1013063042 6:106656195-106656217 CCTGTGGATACCAAAATCTGAGG - Intronic
1015117575 6:129666404-129666426 CCTGTGGATACCAAGCCCTGTGG + Intronic
1016704776 6:147094020-147094042 TCTTTGCATACATATCTCTGAGG + Intergenic
1017413930 6:154199807-154199829 CTTGTGGATGCCTGCCTCTGAGG + Exonic
1025709654 7:63896180-63896202 CCTTAAGATACCTGCCTCTTAGG - Intergenic
1027740821 7:82002145-82002167 CCTTTGGATACCATCATCTCTGG - Intronic
1028359289 7:89948546-89948568 CCTTTGCATATCTTCCTCTATGG + Intergenic
1028677515 7:93483061-93483083 CCTGTGGATACCAAAATCTGAGG + Intronic
1031719508 7:125153666-125153688 CCTTTGGATCCCTTACTCTCTGG - Intergenic
1032431162 7:131862900-131862922 CCTTTGAACACCTAACTCAGTGG + Intergenic
1039453581 8:37694595-37694617 CCTTTGGGTGCCGAACTCTGGGG - Intergenic
1044305286 8:90633006-90633028 CTTTTGGATATTAACCTCTGTGG + Intronic
1045863647 8:106840549-106840571 CCCTTGGATACCAAAATCTGTGG + Intergenic
1046343232 8:112886717-112886739 CCCTTGGATACCAAAATCTGAGG + Intronic
1046771520 8:118121470-118121492 CATTTGGATAACTAGCTCTATGG - Intergenic
1048464712 8:134655853-134655875 CATCTGGGTACCTGCCTCTGGGG - Intronic
1053425851 9:38009373-38009395 CCTTTGGTTACCCGCCTCTGCGG - Intronic
1060165542 9:121411225-121411247 CCTGTAGATACCAACATCTGTGG + Intergenic
1060741396 9:126099851-126099873 GTTAAGGATACCTACCTCTGGGG + Intergenic
1061829294 9:133280581-133280603 CCTTTGGATTGCTATCTCAGTGG + Intergenic
1194438350 X:93897433-93897455 CCTTTGAGTACCTACCTCACAGG + Intergenic
1195244586 X:102983858-102983880 CCATTGGAGCCCTAGCTCTGGGG + Intergenic
1195438883 X:104878526-104878548 CCTTCTGATATCTACCTTTGTGG - Intronic
1195761473 X:108250760-108250782 CCTTTGTACAGCAACCTCTGAGG + Intronic
1195930183 X:110066649-110066671 CCTTTGGAAACCTGCAGCTGTGG - Intronic
1196041420 X:111208872-111208894 CCTTTAGATACCAACATCTATGG - Intronic
1196127844 X:112118456-112118478 CTTTTGGATTCCTAACTCTAGGG - Intergenic
1197612146 X:128651913-128651935 CCTTTGGTTACCTCCTTCTCGGG - Intergenic
1198751038 X:139936524-139936546 CCTCTGAATTCCTACCTGTGGGG - Intronic
1200814495 Y:7517610-7517632 CCATTGGCTACCTACTTTTGGGG - Intergenic