ID: 1096368475

View in Genome Browser
Species Human (GRCh38)
Location 12:51048368-51048390
Sequence CAGGGTGTGCTGGGCTCGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096368467_1096368475 8 Left 1096368467 12:51048337-51048359 CCGCTTCTCTCGCTGTGAAGATG 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG 0: 1
1: 0
2: 0
3: 29
4: 272
1096368463_1096368475 30 Left 1096368463 12:51048315-51048337 CCCAAAGACAACCTCTTCTCTCC 0: 1
1: 0
2: 4
3: 25
4: 307
Right 1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG 0: 1
1: 0
2: 0
3: 29
4: 272
1096368466_1096368475 9 Left 1096368466 12:51048336-51048358 CCCGCTTCTCTCGCTGTGAAGAT 0: 1
1: 0
2: 1
3: 11
4: 211
Right 1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG 0: 1
1: 0
2: 0
3: 29
4: 272
1096368464_1096368475 29 Left 1096368464 12:51048316-51048338 CCAAAGACAACCTCTTCTCTCCC 0: 1
1: 0
2: 5
3: 40
4: 376
Right 1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG 0: 1
1: 0
2: 0
3: 29
4: 272
1096368465_1096368475 19 Left 1096368465 12:51048326-51048348 CCTCTTCTCTCCCGCTTCTCTCG 0: 1
1: 0
2: 4
3: 53
4: 556
Right 1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG 0: 1
1: 0
2: 0
3: 29
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096368475 Original CRISPR CAGGGTGTGCTGGGCTCGGT CGG Exonic
900313719 1:2047099-2047121 CTCGGTGTGCTGGGCTCGATGGG + Intergenic
900380446 1:2381510-2381532 GAGGGTGTGCGGGCCTCGGTTGG + Intronic
900471115 1:2855444-2855466 CAGCGGGTGCTGCGCTCTGTGGG + Intergenic
901350789 1:8593944-8593966 CAGGGTGTGCTGCCCCGGGTTGG - Intronic
901479988 1:9518613-9518635 CAGGGTGTGGTGGGGGCGGGGGG - Intergenic
901508423 1:9701209-9701231 CAGGGGGTGGTGGGCACGGAGGG - Intronic
901511880 1:9721672-9721694 CTGGGTGTCCTGGCCTCGCTAGG + Intronic
901635338 1:10667841-10667863 GAAGGTGGGCTGGGCTGGGTGGG - Intronic
902148173 1:14420806-14420828 CTGGGTGGGATGGGCTCGGTGGG - Intergenic
902443985 1:16449859-16449881 CAGGTTGGGCTGGGCTGGGCTGG + Intronic
902560630 1:17274915-17274937 CCGGATGTGCTGGGGTTGGTGGG + Intronic
902891300 1:19445909-19445931 CAGGGAGTGCTGGGCTGTGCAGG + Intronic
903219127 1:21859331-21859353 AAGGGTGGGCCGGGCACGGTGGG - Intronic
903225459 1:21892213-21892235 CCGGGTGGGCGGGGCTCTGTGGG + Intronic
903335849 1:22623968-22623990 CAGTGGGTGATGGGCTGGGTGGG + Intergenic
904695862 1:32330925-32330947 CAGGTTCGGCTGGGCTGGGTGGG + Intronic
904946664 1:34204056-34204078 CAGGCTGTGCTGGGCCAGGCTGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906156814 1:43618804-43618826 CTGGGTGTGGTGTGCTGGGTCGG + Intronic
906607920 1:47184290-47184312 CAGTGGGGGATGGGCTCGGTGGG - Intronic
908514645 1:64880116-64880138 CTGGGTGTGCTGGGCCAGGGAGG - Intronic
910371803 1:86524109-86524131 CTGGGTGGCGTGGGCTCGGTGGG - Intergenic
913438952 1:118877043-118877065 CAGAGTGTGCTGGTCTCAGGAGG - Intergenic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
914838813 1:151230828-151230850 CAGGGTGGGGTGGGCGCGGGCGG - Intronic
916605905 1:166342906-166342928 CAGGGAGCGTTGGGCTCGTTGGG + Intergenic
917145326 1:171884589-171884611 CAGGTTGGTCTGGGCTCAGTAGG + Intronic
920435314 1:205943336-205943358 TGGGGTGGGCTGGGCTGGGTGGG + Intronic
924793052 1:247270501-247270523 CAGGGCCTGCTGGGGTCTGTGGG - Intergenic
1063008448 10:1997416-1997438 AAGAGTGCGCTGGGCTGGGTGGG - Intergenic
1063178154 10:3570829-3570851 CAGGGTGTGCTGGGCACTAGGGG - Intergenic
1063393577 10:5666211-5666233 CAGGGCGCGCGGCGCTCGGTGGG + Intronic
1069212642 10:65780276-65780298 CAGGGGCTGCTGGGCTGAGTGGG + Intergenic
1069751146 10:70745733-70745755 CAGTTTGGGCTGGGCTCTGTGGG + Intronic
1069857110 10:71447469-71447491 CAGGGGGTGCTGGGCCCAGCAGG + Intronic
1069878957 10:71579907-71579929 AAGGGGGTGCTGGGCTGGGCAGG + Intronic
1070333252 10:75432591-75432613 CAGGGTGTGCAGGGAAAGGTGGG - Intronic
1071504838 10:86226358-86226380 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504852 10:86226398-86226420 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504873 10:86226452-86226474 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504887 10:86226488-86226510 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504908 10:86226546-86226568 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1073151650 10:101315749-101315771 CAGTGTCGGCTGGGCACGGTTGG + Intergenic
1074561692 10:114540791-114540813 CAGGGTCTGCAGGCCTCGCTGGG + Intronic
1076833756 10:133009727-133009749 GAGTGTGTGCGGGGCTCGGGCGG - Intergenic
1077096250 11:800328-800350 CAGGCTGTGCGGGGCCAGGTGGG - Exonic
1077174570 11:1182850-1182872 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077174785 11:1183969-1183991 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077437769 11:2550974-2550996 GAGGCTGTGCTGAGCTCAGTGGG + Intronic
1081221583 11:40469600-40469622 CATAGTTTGCTGGGCTCCGTGGG - Intronic
1081853571 11:46290362-46290384 CAGGCTGGGCTGGGCTCAGGAGG - Intronic
1082000811 11:47393023-47393045 CAGGGTGGGCCGGGCCTGGTGGG + Intergenic
1082988642 11:59188497-59188519 CAGATCGTGCTGGGCTCTGTAGG + Intronic
1083303753 11:61752538-61752560 CAGGGGGCGCTGGGCGCGGCGGG + Intergenic
1084066697 11:66708332-66708354 CAGGGTGGGGAGGGCTCAGTGGG + Intronic
1088597893 11:111453420-111453442 CAGCCTGAGCTGGGCTCGGAAGG + Exonic
1088749560 11:112832223-112832245 CAGGCTGGGCAGGGCTAGGTGGG - Intergenic
1090082524 11:123623544-123623566 CAGGGTGTGCTGGGCCCTCCAGG + Intronic
1091387113 12:102630-102652 AAGGCTGTCCTGGCCTCGGTAGG - Intronic
1092238157 12:6822342-6822364 TAGGGTGTACTGGGCTCCGGAGG + Intronic
1094361716 12:29638297-29638319 CAGTGTCTGCTGGGGTCTGTCGG - Intronic
1094364520 12:29665942-29665964 CAGGGTGTGGTGGGTTGGGGGGG - Intronic
1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG + Exonic
1096523641 12:52198174-52198196 TAGGCTGTGCTGGGCTCACTGGG + Intergenic
1096668153 12:53180770-53180792 CAGGGTGTGCTGGGGCCTGGAGG + Exonic
1101957220 12:109222371-109222393 CAGGCTGTGCTGGGCCTGTTTGG + Intronic
1102809664 12:115813365-115813387 CAGCTTGGGCTGGGCTCAGTGGG - Intergenic
1104645047 12:130491326-130491348 GAGAGTGAGCTGGGCTCGCTAGG - Intronic
1104962308 12:132494013-132494035 CTGGGTGTGCTGGGGTGGGTGGG + Intronic
1105213707 13:18272577-18272599 CAGGCTGTGGTGGTCACGGTGGG - Intergenic
1106074437 13:26445546-26445568 CACTGTGTGCTGGGCACTGTGGG - Intergenic
1107243429 13:38264867-38264889 CATAGTTTGCTGGGCTCTGTGGG - Intergenic
1109269210 13:60235633-60235655 GAGGGTTTACTGGGCTCAGTTGG - Intergenic
1113613569 13:111665033-111665055 CAGGTGGTGCTGGGCTGGGGTGG + Intronic
1114516928 14:23306622-23306644 CACGGTGGGCTGGGCTGGGCTGG - Intronic
1117181863 14:53199841-53199863 CAGGGTGAGGTGGTCTCGGATGG + Intergenic
1119210189 14:72825708-72825730 CTGGGTGGGCTGGGCTGGGCTGG - Intronic
1120189797 14:81430157-81430179 CAGATTGTGCTGGGCTGGGAAGG - Intronic
1120852864 14:89186873-89186895 CATGGTGTGCTGGGCTCCCTTGG + Intronic
1121309607 14:92928493-92928515 CAGGGAGTGCTGGGCACAGCTGG + Intronic
1122122203 14:99560641-99560663 CAGAGTGGGCTGTGCTCGCTGGG + Intronic
1122159877 14:99775249-99775271 CAGGGAGTGCAGAGCTCAGTGGG + Intronic
1122724176 14:103739723-103739745 CAGGCTGTGCTGGGAGCAGTGGG - Intronic
1123014721 14:105368189-105368211 CCGGGTGTCCTGGGGTCTGTGGG + Intronic
1123084521 14:105711340-105711362 CAGGCTGGGCTGGGCTGGGCTGG - Intergenic
1202898453 14_GL000194v1_random:22985-23007 CAGGGTGCGCTCGGGTCGCTAGG - Intergenic
1125741173 15:41965969-41965991 CAGGGTAGGCGGGGCTGGGTGGG - Intronic
1129703809 15:77783180-77783202 CAGACTGTGCTGAGCTCGGGAGG - Intronic
1129798693 15:78397256-78397278 CAGCGTCTGCGGGGCTCTGTTGG + Intergenic
1130739950 15:86588492-86588514 CAGGGAGTGCTGGGATCTGTGGG + Intronic
1131068728 15:89450639-89450661 CAGGGTGTGCTGGTCCCTGCAGG + Intergenic
1132572789 16:651307-651329 TAGGGTGCGTGGGGCTCGGTAGG + Intronic
1133023032 16:2975212-2975234 CCGGGTGTCCTGGGCTAGGGTGG + Intronic
1133031508 16:3013399-3013421 CTGGCTGTGCTGGGCTGGCTGGG + Exonic
1133271293 16:4611978-4612000 CTGGGTGTGCTGGGCCTGGGAGG - Intronic
1133978974 16:10619556-10619578 CACGGTGGGCTGGGCTGGGTTGG + Intergenic
1134511879 16:14855035-14855057 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134699522 16:16253534-16253556 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134972307 16:18541137-18541159 CAGATTGTGCAGGGCTTGGTGGG - Intronic
1135480116 16:22814848-22814870 CTGGGAGCGCTGGGCTCGCTGGG - Exonic
1137257583 16:46789922-46789944 CAGGGTGGGCGGAGCTGGGTGGG - Intronic
1137622689 16:49886609-49886631 CCGGGTCTGCCAGGCTCGGTTGG + Intergenic
1137680345 16:50337702-50337724 AAGGGTGTGCTGGGCTCTCTTGG + Intronic
1138417220 16:56878276-56878298 CAGGGAGAGCTGGGCTGGGAGGG + Intronic
1141172763 16:81701598-81701620 CAGAGTGTGCTGAGCTAGGGTGG + Intronic
1141205095 16:81927388-81927410 CAGGTTGTGTTGGGCTTGGAAGG + Intronic
1141346650 16:83252771-83252793 CAGGCTGTGCTGTGAACGGTAGG - Intronic
1141941490 16:87278949-87278971 CAGGGTGGGCTGGCCTCACTGGG + Intronic
1142390391 16:89796072-89796094 CAGTTTGTGCTGGGATTGGTGGG - Intronic
1203138351 16_KI270728v1_random:1744547-1744569 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1142976347 17:3646920-3646942 CAGGGTGAGCTGGGTTGGGAAGG + Intronic
1143137982 17:4722684-4722706 CAGGGAGTTCTGAGCTAGGTTGG + Intergenic
1143156684 17:4841813-4841835 CAGTATATGCTGGGCACGGTGGG + Intronic
1144697226 17:17313124-17313146 CTGGGTGTGGTGGGCGTGGTGGG + Intronic
1146936298 17:36814501-36814523 CAGCGTGGGCTGGGCTGGGCTGG + Intergenic
1147133061 17:38420091-38420113 GAGTGTGGGCTGGGCTCAGTGGG + Intergenic
1147217347 17:38908496-38908518 CAGCGGATGCTGGGGTCGGTTGG + Intronic
1147627386 17:41908962-41908984 CTGGGTGTGCTTGGCTGGGAGGG - Intronic
1148610159 17:48959775-48959797 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610170 17:48959815-48959837 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610189 17:48959895-48959917 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610200 17:48959935-48959957 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610211 17:48959975-48959997 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610222 17:48960015-48960037 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610242 17:48960095-48960117 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610253 17:48960135-48960157 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610264 17:48960175-48960197 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610283 17:48960255-48960277 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610302 17:48960335-48960357 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1148610329 17:48960455-48960477 CAGGATGGGCTCAGCTCGGTGGG + Intronic
1151093761 17:71472326-71472348 CACAGTGTGCTGGGGTGGGTGGG - Intergenic
1151183989 17:72350114-72350136 CAGGCTGTGATGGGCAGGGTAGG - Intergenic
1151461555 17:74257316-74257338 CAGGGCAGGCTGGGCTAGGTGGG - Intronic
1152272790 17:79334873-79334895 CAGGGTGGGCTGGGCTGGTTGGG - Intronic
1152289846 17:79433687-79433709 CAGTGTGGGCTGGGCTGGGCTGG - Intronic
1152390523 17:80001473-80001495 CAGGCTGCGCTGGGCCCGGAGGG + Intronic
1152935074 17:83131971-83131993 CAAGGTGTTCTGGGCTCAGCTGG - Intergenic
1156388433 18:36627476-36627498 CTTGAAGTGCTGGGCTCGGTAGG + Intronic
1157697227 18:49732599-49732621 CAGGGGCTGCAGGGCTGGGTGGG - Intergenic
1157820815 18:50767267-50767289 CAGGCTGTGGTGGGCAGGGTGGG - Intergenic
1158043797 18:53130683-53130705 CAGGCTGTCCTGGGATCTGTAGG + Intronic
1158227313 18:55214719-55214741 CTAGGTGAGCTGGGCTCAGTGGG - Intergenic
1160537703 18:79603822-79603844 CAGGGCCTGCAGGGCTGGGTGGG + Intergenic
1160781056 19:878172-878194 CACGTGGGGCTGGGCTCGGTGGG - Intronic
1160853343 19:1205403-1205425 CAGGGTGGGCTGAGCCCGGTGGG - Intronic
1160917936 19:1506646-1506668 CAGGGTGGGCAGGGGTCTGTGGG + Exonic
1160949406 19:1658342-1658364 CGGGGTGAGGTGGGGTCGGTGGG - Intergenic
1161099402 19:2413895-2413917 CAGGCTGTGCTGGGGGCGGCAGG - Exonic
1161238829 19:3210753-3210775 CAGGTTGTGCAGGGCCTGGTGGG + Intergenic
1161328779 19:3676347-3676369 CAGGGTGTGCTGGGAGTGGTGGG - Intronic
1161331974 19:3692791-3692813 CAGGGTGTGCAGGGCCTTGTGGG - Intronic
1161848281 19:6724888-6724910 CCGGGAATGCTGGGCTGGGTGGG - Intronic
1163271708 19:16258534-16258556 CAGGGTGTCCTGGCCTGGGCAGG - Intergenic
1165455357 19:35907606-35907628 CAGTGTGTGCTGGGAACTGTGGG + Intronic
1165495234 19:36148838-36148860 CAGGGTGTGCAGGACGCTGTGGG + Intronic
1166377143 19:42333975-42333997 CAAGGTGTGCTGGGTAAGGTGGG - Intronic
1166687962 19:44807452-44807474 CAGAGTGTGCCGGGCTCAGGTGG + Intergenic
1167521541 19:49958787-49958809 CAGGCTGAGCTGGACCCGGTGGG - Exonic
1167523836 19:49971935-49971957 CAGGCTGAGCTGGACCCGGTGGG + Intergenic
1167568638 19:50272735-50272757 CAGGGTGGGGTGGGCTTGGTGGG + Intronic
1168405519 19:56108350-56108372 CAGGGAGTGCTGGGCAGGGGCGG - Intronic
925231310 2:2236213-2236235 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925231404 2:2236533-2236555 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925231426 2:2236613-2236635 TGGGATGTGCTGGGCTGGGTTGG - Intronic
926766681 2:16328368-16328390 CAGGGTGGGCTGGGCTACGAAGG - Intergenic
927948166 2:27149778-27149800 CAGGGTGTGCTGGGGCCAGGGGG - Intronic
928173212 2:29016757-29016779 CCGGGTGTGCTTGGCTGGTTGGG - Intronic
929812315 2:45200991-45201013 CAGGCTGTGATGGGCAGGGTGGG - Intergenic
930847723 2:55923662-55923684 CAGTGAGTACTGGGCTCGCTCGG + Intronic
934300620 2:91774172-91774194 CAGGCTGTGGTGGTCACGGTGGG + Intergenic
935628786 2:105194804-105194826 CAGGGTTTGCTGGGCTGCTTGGG - Intergenic
937925354 2:127163487-127163509 CAGGGTGTGATGGGCATGGGTGG + Intergenic
946463496 2:219890909-219890931 CAGGTTGTGCTGGGCTTAGCCGG + Intergenic
948030549 2:234814169-234814191 CAGGGTGGGCAGGGCTAGGGTGG + Intergenic
948853639 2:240720117-240720139 CAGGAAGTGCTGGGCTTGGTGGG + Intronic
1168911598 20:1452428-1452450 CAGGGTCTGCTGGGCTTGGCAGG + Intronic
1170574643 20:17653173-17653195 GAGGGCGCGCTGGGCACGGTGGG - Intronic
1170945516 20:20887856-20887878 CAGGGTAGGCAGGGCTCGGGGGG - Intergenic
1171424988 20:25043512-25043534 CTGGGTGTGCTGTGCTGGGCTGG - Intronic
1172760014 20:37315088-37315110 CAGGGTGTGGGGGCCACGGTCGG + Intronic
1172891683 20:38270427-38270449 CAGGGAAGGCTGGGCTCGGTGGG + Intronic
1172969995 20:38866256-38866278 CCGGGTGTGCTGTCCTCTGTGGG + Intronic
1173664531 20:44754952-44754974 CAGGGAGGGCTGGGCTGGGAAGG + Intronic
1175576419 20:60064000-60064022 CAGGGTGGGCTGGGTTCTGTGGG - Intronic
1175767634 20:61602146-61602168 CATCATGTGCTGGGCTCGGAGGG + Intronic
1176286487 21:5021712-5021734 CGGGGTGGGCTGGGTGCGGTGGG + Intergenic
1176428109 21:6561011-6561033 CAGAGGGTGGTGGCCTCGGTGGG + Intergenic
1176618135 21:9038975-9038997 CAGGGTGCGCTCGGGTCGCTAGG - Intergenic
1178943803 21:36929386-36929408 CTGGGTGTGATGGGCTCACTTGG - Intronic
1179103237 21:38375571-38375593 CACGGTGTGTCGGGCTCTGTGGG - Intergenic
1179703600 21:43169328-43169350 CAGAGGGTGGTGGCCTCGGTGGG + Intronic
1179870694 21:44241763-44241785 CGGGGTGGGCTGGGTGCGGTGGG - Intergenic
1179928117 21:44549810-44549832 CTCCGTGTGCTGGGCTGGGTGGG - Intronic
1179994477 21:44967645-44967667 CAGGGTGTGCAGTGTTAGGTGGG - Intronic
1180816539 22:18792968-18792990 CAGGCTGTGGTGGTCACGGTGGG - Intergenic
1180982563 22:19885678-19885700 CAGGAAGTGCTGGGCCTGGTGGG - Intronic
1181047505 22:20222631-20222653 CAGTGTGTGCCAGGCTCGGCTGG + Intergenic
1181202729 22:21227300-21227322 CAGGCTGTGGTGGTCACGGTGGG - Intronic
1181698975 22:24609305-24609327 CAGGCTGTGGTGGTCACGGTGGG + Intronic
1182419103 22:30240201-30240223 AAGGGGGTGCTGGGCACGGTGGG - Intergenic
1183535991 22:38401739-38401761 CAGGGGGTGCTGAGCTTGTTTGG + Intergenic
1184354711 22:43971353-43971375 CAGAGCGGGCTGGGCTCTGTAGG - Intronic
1184730659 22:46369419-46369441 CTGGGTGTGGTGGGCGCTGTGGG - Intronic
1184818755 22:46892986-46893008 CAGGCAGAGCTGGGCCCGGTGGG + Intronic
1203224187 22_KI270731v1_random:68113-68135 CAGGCTGTGGTGGTCACGGTGGG + Intergenic
1203266639 22_KI270734v1_random:18679-18701 CAGGCTGTGGTGGTCACGGTGGG - Intergenic
950216283 3:11162066-11162088 CAGGCAGTGCTGGGCTCTGCAGG + Intronic
950486015 3:13274368-13274390 GAGGGTGTCCTGGGACCGGTAGG - Intergenic
950725120 3:14912238-14912260 CAGGGTGTGCTGGGCCCCGATGG + Intronic
952833016 3:37581041-37581063 CAGAGTGTGCTGGGCTACATAGG + Intronic
953863284 3:46563460-46563482 CAGTGTGTGCTGAGCTCTGAGGG - Intronic
954663134 3:52236748-52236770 AAGGGTCTGCTGAGCTCAGTTGG - Intronic
954696899 3:52432388-52432410 CACAGTGTGCTGGGCTGGGAAGG - Intergenic
954699293 3:52443103-52443125 CAGGGTAGGCTGGGCCAGGTGGG - Intronic
954809701 3:53240423-53240445 AAGGGCTTGCTGGGCTGGGTGGG - Intronic
955407082 3:58632404-58632426 GAGGGTGAGCTGGGGTGGGTTGG + Intergenic
956436956 3:69243485-69243507 CAGGTTGTGCTGGTGTTGGTGGG + Intronic
961378353 3:126481736-126481758 CAGGCTGTGCTGGCCTAGGGGGG + Intronic
961530589 3:127537626-127537648 AAGGGTGTGCTGGGCAGGGGAGG - Intergenic
961791726 3:129381138-129381160 CAGGGTGGGCTGGGCAGGCTGGG + Intergenic
961805750 3:129488091-129488113 CAGGGTGGGCTGGGCAGGCTGGG + Intronic
962367773 3:134797178-134797200 CAGGGACTGCTGGGCTTTGTAGG + Intronic
962932174 3:140048819-140048841 CTGGGTGTGGTGGGCCTGGTGGG - Intronic
964511665 3:157459235-157459257 TAGGGTCTGCTGGGCTCGCATGG + Intronic
968504867 4:967086-967108 CAGGGTCTGCTGGGCGGGGTGGG - Intronic
969516432 4:7650757-7650779 CAGGCTGGGCTGGGCTGGGCTGG - Intronic
969924560 4:10574214-10574236 CAGGTTGTGCTGAGCTCTGGGGG - Intronic
975033576 4:69655184-69655206 AAGTTTGTGCTGGGCTCAGTTGG + Intergenic
977905523 4:102473712-102473734 CAGGGTGTGGTGGTGTCTGTAGG + Intergenic
983944340 4:173568917-173568939 CAGGGTGTGGTGGGGCGGGTAGG + Intergenic
984193368 4:176630339-176630361 CTGCGTGTGGTGGACTCGGTGGG - Intergenic
984701040 4:182819052-182819074 GAGGCTGTGCTGGGCTCGAAGGG + Intergenic
986963573 5:13244247-13244269 CCGAGTGGGCTGGGCTCAGTGGG + Intergenic
990759023 5:59108051-59108073 CAGTCTGTGCTGGGCTCAGCCGG - Intronic
992795950 5:80255619-80255641 CGGGGCGTGCCGGGCTCGGGCGG - Intronic
996530847 5:124525217-124525239 CAGGGTGTGCTGGCCTGGTAGGG - Intergenic
1001634079 5:173197301-173197323 CAGGGACTGCTGGGCTGGGCTGG + Intergenic
1006130323 6:31865229-31865251 GTGGGTGTGCTGTGCTCAGTCGG - Intronic
1006456854 6:34136925-34136947 CAGGGTGTGGTGGGGTGGGTTGG + Intronic
1006679721 6:35788174-35788196 CTGGGTGGGCTGGGCTGGGGTGG + Intronic
1007298686 6:40849027-40849049 CAGGCTGCACTGGGCTCTGTTGG + Intergenic
1016741412 6:147533099-147533121 CTGGGTGTGCTGGCCTCTGCTGG - Intronic
1017715943 6:157213264-157213286 CAGGGTGGGCCGGGCTGGGGAGG - Intergenic
1017716489 6:157217201-157217223 CAGGGTGGGCCGGGCTGGGGAGG + Intergenic
1018154333 6:160971756-160971778 CAAGGTGTGGAGGGCTCTGTGGG - Intergenic
1019105995 6:169667637-169667659 CAGGGTGTGGAGGGTTCAGTCGG - Intronic
1019324075 7:429504-429526 CAGGTTGTGCAGGGTTCAGTGGG - Intergenic
1020023328 7:4882293-4882315 CAGGGCGTGCTCCGCCCGGTCGG - Intronic
1023093453 7:36637587-36637609 CAGGCTGTCCTGGGCTTTGTAGG - Intronic
1023391166 7:39713174-39713196 CAGGGTATGCAGGGCTCAGCAGG + Intergenic
1024273134 7:47657340-47657362 CAGGGGGTGCAGGGCTAGCTGGG - Intronic
1025823783 7:64994885-64994907 AGGGGTCTGCTGGGCTGGGTAGG - Intronic
1026934221 7:74243219-74243241 CAAGGCTTGCTGGGCTCCGTCGG + Exonic
1029706738 7:102280272-102280294 CAGGGTGTGCAGGGCTGGCGTGG - Intronic
1032166989 7:129553145-129553167 CAGGGTGTGCAGTGCACTGTCGG + Intergenic
1032582080 7:133112757-133112779 TAGGGTGTGCTGTGCTTGTTTGG + Intergenic
1032602795 7:133317478-133317500 TAGGTTGGGCTGGGCTAGGTGGG + Intronic
1032855414 7:135829792-135829814 CTGGGTGTGCTGTGCTCCTTGGG - Intergenic
1032891456 7:136199539-136199561 CAGGCTGTGGTGGGCTGGCTTGG + Intergenic
1034258769 7:149740783-149740805 GAGAGTGGGCTGGGCGCGGTGGG + Intergenic
1034840111 7:154387690-154387712 CAGGGGCTGTGGGGCTCGGTTGG - Intronic
1035258465 7:157646943-157646965 CAGGGTGCACTGAACTCGGTGGG + Intronic
1035259000 7:157649867-157649889 CAGGGTGCACTGAACTCGGTGGG + Intronic
1037655259 8:20877629-20877651 CAGTCTGTGGTGGGCTGGGTTGG + Intergenic
1037758765 8:21728189-21728211 CAGTGTGTCCTGGGCTCCCTGGG - Intronic
1041327323 8:56682235-56682257 CAGGGTGGGCTGGGCCATGTAGG + Intergenic
1045112561 8:98948484-98948506 GAGGGTGGGCTGGGCTGGGCTGG + Intronic
1047682345 8:127266900-127266922 CAGGCTTTGCTGGGAGCGGTGGG - Intergenic
1049659583 8:143813787-143813809 CAGCCTGTGGTGGGGTCGGTAGG - Intronic
1049689368 8:143952006-143952028 CCGGGTTTGCCGGGCTTGGTGGG - Intronic
1051414222 9:16821805-16821827 CAGGTGGGGCTGGGCACGGTGGG + Intronic
1052014827 9:23452093-23452115 CTGGGTGGGCTGGGCTTGGCGGG + Intergenic
1052656483 9:31369222-31369244 TAGGGTGTGTTGGGATAGGTTGG + Intergenic
1055627697 9:78191439-78191461 CAGGTTGGGTTGGGCTCAGTGGG + Intergenic
1056318120 9:85410745-85410767 CTGGCTGTGCTGGCCTAGGTTGG + Intergenic
1056942329 9:90966277-90966299 TAGGGTGTGCTGGGTTCCCTGGG - Intergenic
1057259740 9:93576924-93576946 CCGGGGGCGCGGGGCTCGGTCGG - Intronic
1057702031 9:97370304-97370326 GTGGGTGTGCTGGGTTCCGTGGG + Intronic
1058587975 9:106530898-106530920 CAGGGTCGGCTGGGCACAGTGGG - Intergenic
1060585336 9:124782090-124782112 CAGGGTGGGCTGGGCCTAGTAGG + Intronic
1060962503 9:127690949-127690971 CAGGGCGTGCAGGGCTGGGGAGG - Exonic
1062005116 9:134235079-134235101 CAGGGTGTCCTGGGCCAGGCAGG + Intergenic
1062190968 9:135247667-135247689 CAGGGTGTGTCGGGCACGCTGGG + Intergenic
1062366821 9:136213922-136213944 CAGTTTGGGCTGGGCTCGGCTGG - Intronic
1062715992 9:138010328-138010350 CAGGGTGTGCTGGGAGCAGGAGG + Intronic
1185533332 X:839215-839237 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533369 X:839385-839407 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533409 X:839555-839577 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533446 X:839725-839747 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533484 X:839895-839917 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533521 X:840065-840087 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533561 X:840235-840257 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533598 X:840405-840427 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533636 X:840575-840597 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1186000277 X:5001820-5001842 AAGTCTGTGCTGGGCTCAGTGGG + Intergenic
1187280116 X:17852169-17852191 CACAGTGTGCTGGGCTCAGGCGG - Intronic
1193406753 X:81109667-81109689 CAGGGTGGGTTGGGCAGGGTAGG + Intergenic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1199191967 X:144981276-144981298 CAGGCTGTGCTGGTCTCAGATGG + Intergenic
1199514571 X:148661930-148661952 AAGCGTGTTCTGGACTCGGTTGG - Exonic
1200259078 X:154602410-154602432 CAAGCTGGGCTGGGCTCCGTCGG + Intergenic
1201151525 Y:11097812-11097834 CAGGGTGCGCTCGGGTCGCTAGG - Intergenic