ID: 1096370803

View in Genome Browser
Species Human (GRCh38)
Location 12:51067519-51067541
Sequence CTTACTCTGTTGACGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096370796_1096370803 4 Left 1096370796 12:51067492-51067514 CCACCATGCCTGGCCGTGTGCTG 0: 1
1: 2
2: 41
3: 383
4: 2488
Right 1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 137
1096370798_1096370803 -4 Left 1096370798 12:51067500-51067522 CCTGGCCGTGTGCTGTTTGCTTA 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 137
1096370799_1096370803 -9 Left 1096370799 12:51067505-51067527 CCGTGTGCTGTTTGCTTACTCTG 0: 1
1: 0
2: 0
3: 24
4: 347
Right 1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 137
1096370797_1096370803 1 Left 1096370797 12:51067495-51067517 CCATGCCTGGCCGTGTGCTGTTT 0: 1
1: 2
2: 13
3: 115
4: 950
Right 1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096370803 Original CRISPR CTTACTCTGTTGACGGAGGA GGG Intronic
901852155 1:12022411-12022433 CTTGCTCTGTTGAGCCAGGATGG - Exonic
902316564 1:15624495-15624517 CTTACTCTGTTGCCCCAGGCTGG + Intronic
902847505 1:19123419-19123441 CTCACTCTGTTGACCCAGGTTGG - Intronic
903857846 1:26347123-26347145 CTAACTCTGTTCAGGGAAGATGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
909631927 1:77776913-77776935 CTTACTCTATAGACAGAGTAGGG - Intergenic
911205533 1:95088545-95088567 CTTACTTTGTTAAAGGAAGATGG + Intergenic
918433268 1:184484244-184484266 CTTGCTCAGTTGACTGAAGAAGG - Intronic
918498514 1:185166935-185166957 CTTACTCTGTTGCCCCAGGCTGG + Intronic
919564156 1:199162553-199162575 CTTACTCTGGAGACTGAGGTAGG - Intergenic
920519601 1:206613382-206613404 CTTACTCTGTTGTCCAAGGTGGG - Intergenic
921556765 1:216607941-216607963 TTTACTCTGTTGAAAGAAGAGGG + Intronic
1062766114 10:66535-66557 GTTACTCGGGTGACAGAGGAGGG + Intergenic
1063494729 10:6496184-6496206 CTTACTCTGTTTACCCAGGCTGG - Intronic
1071889268 10:89984849-89984871 CTCACACTGTTGAGGGGGGATGG + Intergenic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1072418403 10:95268821-95268843 TCTCCTCTGGTGACGGAGGAAGG - Exonic
1074484198 10:113856333-113856355 AATACTCTGTTGTCGGAGGCAGG - Intronic
1078056574 11:8014134-8014156 CTCACTCTGCTGCCAGAGGAAGG - Intergenic
1079059593 11:17236583-17236605 CTGACTCTCTTGGAGGAGGAGGG - Intronic
1080815495 11:35752499-35752521 CTTACTCTGTGGAGGGGTGAGGG - Intronic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1088735839 11:112727066-112727088 CTTACTCAGTTAATGGAGGAAGG + Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089477670 11:118778567-118778589 CTTACTGGGTTGGAGGAGGAGGG + Intronic
1089477950 11:118780987-118781009 CTTACTGGGTTGGAGGAGGAGGG + Intronic
1095928596 12:47604192-47604214 CTTACTGTGTGGAGGGAGGGGGG + Intergenic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1097170754 12:57111327-57111349 CTTACACTGAAGAGGGAGGACGG - Exonic
1098814459 12:75140198-75140220 CTTACTCTCTTGACGTAGGCTGG - Intronic
1100060575 12:90570226-90570248 CTTGCTCTGTTGCCTCAGGATGG + Intergenic
1104386065 12:128352619-128352641 ATTACTCAGATGAAGGAGGAAGG + Intronic
1105328579 13:19393218-19393240 CTTGCTCTGTTGCCTGAGGCTGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1107999239 13:45891185-45891207 CTGACTCTGTTGATGGAGGGAGG - Intergenic
1108047959 13:46400964-46400986 CTTGCTCTGTTGACCCAGGCTGG - Intronic
1108279541 13:48847850-48847872 CTGACTCTGATGAGGGAGAAAGG - Intergenic
1108649853 13:52467068-52467090 GTTGCTCTGTTGACTCAGGATGG - Intronic
1109189263 13:59306045-59306067 ATTTTTCTGTGGACGGAGGATGG - Intergenic
1110857958 13:80317499-80317521 CTTACTCTGTTGTCCCAGGCTGG - Intergenic
1112342213 13:98561945-98561967 CTCACTCTGTTGACCCAGGCTGG - Intronic
1112690532 13:101888585-101888607 CTTACTCTGTTGCCTTATGATGG + Intronic
1112748864 13:102559931-102559953 TTCACTCTGTTGACACAGGAAGG + Intergenic
1117294781 14:54369395-54369417 CTTACTCTGTTCACCCAGGCTGG + Intergenic
1119548709 14:75492597-75492619 GTTACTCTGGAGACGGAGGCAGG + Intergenic
1128344286 15:66843682-66843704 CTTCCTCTCTTGTCAGAGGAAGG - Intergenic
1140725666 16:77809338-77809360 ATTTCTCTGATGATGGAGGATGG - Intronic
1142439304 16:90084747-90084769 GTTACTCAGGAGACGGAGGAGGG - Intronic
1147033539 17:37662065-37662087 CATATTCTGTTGATTGAGGAAGG - Intergenic
1153798260 18:8645017-8645039 CTTGTTCTGTTGACTGAGAAAGG - Intergenic
1159035129 18:63269428-63269450 CTTTCTCTGTTGAGGGACGTGGG + Intronic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1166213581 19:41322203-41322225 CTTACTCAGTTGGCTGAGGCGGG - Intronic
929522986 2:42672307-42672329 CTTACTATGTTGACTCAGGCTGG - Intronic
932024067 2:68116115-68116137 CTTACTCTTTGGCCAGAGGAGGG - Intergenic
933474383 2:82770776-82770798 CTTTCTCTCTTGGAGGAGGAGGG - Intergenic
939166834 2:138649404-138649426 CTTAGTCTGTTGACTGAGTGGGG + Intergenic
940277625 2:151955870-151955892 CTTGCTCTGTTGGCCCAGGATGG - Intronic
945062612 2:205922501-205922523 CTCACTCTGTTGAGTGAGGCTGG + Intergenic
945157640 2:206856322-206856344 CTGACTCTGTTGGAGCAGGATGG + Intergenic
947256860 2:228176321-228176343 CTTACTCTCTTGAAAGAGGTGGG - Intronic
948020773 2:234731421-234731443 CTTACTCTTCTGAGGTAGGAAGG + Intergenic
948353741 2:237360886-237360908 CTTACTCTGTTTCAGAAGGAGGG - Intronic
1170844333 20:19949457-19949479 CTTACTCTGTCAACCAAGGATGG - Intronic
1172370002 20:34381831-34381853 CTTGCTCTGTTGACAGAGCTAGG - Intronic
1172702276 20:36861067-36861089 CTCACTCTGGTGAAGGGGGATGG - Intronic
1176046467 20:63095362-63095384 CTGGCTCTGAAGACGGAGGATGG + Intergenic
1178423334 21:32459356-32459378 CTGAGTCTGTTGACTGAGGCAGG - Intronic
1181474544 22:23160262-23160284 GTTACTCTGATAAGGGAGGAAGG - Intronic
1182401754 22:30083235-30083257 CTTACTCTGTTTACCCAGGCAGG - Intronic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183335472 22:37243773-37243795 TTTACTCTGTGGATGCAGGAGGG - Intronic
1184600466 22:45540391-45540413 CTGACTCATTTGACTGAGGAGGG + Intronic
955307768 3:57851401-57851423 CTTATTCTGGTGAGGGAGCATGG + Intronic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
962475335 3:135750374-135750396 CTCCCTCTGTTGAGGGAGGCAGG - Intergenic
963580675 3:147122936-147122958 CTTACCCTGTTGGTGAAGGAGGG - Intergenic
966265617 3:178038387-178038409 CATAGTCTGTTGATGGAGGGAGG + Intergenic
970680639 4:18503715-18503737 CTGACTTTGATGACAGAGGAAGG - Intergenic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
978534993 4:109751287-109751309 CTTACACTTTTGAAGGAAGAGGG + Intronic
980180623 4:129396100-129396122 CTTACTCTATTGACTAAGGTAGG + Intergenic
984814063 4:183821075-183821097 CTCACTCTGTTGCCAGAGGCTGG - Intergenic
984979345 4:185263150-185263172 CTTCCACTGTTAACGGAGAAGGG + Intronic
986218871 5:5748508-5748530 CTTACTGAGGTGACAGAGGAAGG + Intergenic
988261201 5:28887747-28887769 CTTACTCTGGTGAGAGAAGAGGG - Intergenic
991362506 5:65835687-65835709 CTTCCTCTGATGAGGGAGAAAGG + Intronic
992684173 5:79182988-79183010 CTTACTCTGTTGCCCCAGGCTGG - Intronic
995839168 5:116427036-116427058 CTTACTCAGTTTACTGAGTAAGG - Intergenic
999168154 5:149569347-149569369 CTTACTCTGTTGACCCAGGCTGG + Intronic
999695392 5:154184424-154184446 CTTACTCTGTTTAGGGAGGTTGG + Intronic
1002980307 6:2129307-2129329 CTTCCTGTGTTGCGGGAGGATGG - Intronic
1003133135 6:3412826-3412848 CTGGCTCTGAAGACGGAGGATGG + Intronic
1005935310 6:30516628-30516650 CTTACGCTGTGGGCGGAGGCGGG - Intergenic
1011410597 6:87062088-87062110 CTTACTCTGTTGCCCCAGGCTGG - Intergenic
1014878920 6:126697262-126697284 CCTTCTCTGTTTACAGAGGAGGG - Intergenic
1015118142 6:129671675-129671697 CTTACTCTGTTTACCCAGGCTGG - Intronic
1016028383 6:139312396-139312418 CTTACTCTGTTGAAGCTGGCTGG + Intergenic
1017667706 6:156737205-156737227 CTTAGTCTGTGGGAGGAGGAAGG - Intergenic
1018964433 6:168473505-168473527 CTTATTCTCTTGAAGGAGCATGG + Intronic
1019094656 6:169569034-169569056 CGTTCTCTGTTGATGGAAGAGGG - Intronic
1020286926 7:6689550-6689572 CTTACTCTGCTGGCGGAGTTTGG - Exonic
1021061570 7:16118915-16118937 CTTACTCAGCTGAGGGAGAAAGG + Intronic
1021389491 7:20074125-20074147 CTTACTCTGATGACTGAATATGG - Intergenic
1023212692 7:37825063-37825085 CTTACTCTGTGGAGGGGTGAGGG - Intronic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1024049830 7:45611373-45611395 CTTCCTCTGTTGACTGGAGAGGG + Intronic
1025997526 7:66537416-66537438 CTTACTCGGGAGACTGAGGATGG + Intergenic
1027686745 7:81287849-81287871 CTGACTCTATTGATGGAGTATGG - Intergenic
1030427585 7:109398644-109398666 CTGACTCTGTTGATGGTGCAGGG + Intergenic
1031329879 7:120451329-120451351 ATAACTCTGTTGACAGAGTAGGG + Intronic
1031540105 7:122985163-122985185 CTTCCTCTCTTGAAGGAGGTTGG - Intergenic
1033059424 7:138091352-138091374 CTTTCCCTGATGAAGGAGGAGGG + Intronic
1035087457 7:156272995-156273017 GTTACTCTGTAAAGGGAGGAAGG - Intergenic
1035345444 7:158194054-158194076 CTTCCTCTGTTGCCTGAGGCTGG - Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1039089209 8:33810417-33810439 CTTGCTCTGTTGCCTGAGGCTGG - Intergenic
1040948276 8:52908035-52908057 TATACTCTGTTGTAGGAGGAAGG - Intergenic
1045964773 8:108012439-108012461 CTTACTATTTTGAGGGAGAAGGG - Intronic
1046971314 8:120226610-120226632 CTTCCTCTGTAAACCGAGGAAGG - Exonic
1053132024 9:35620992-35621014 CTTACCCTGTTCACAAAGGAAGG - Intronic
1054701555 9:68418274-68418296 TTTACTCTGTGGACTTAGGAAGG + Intronic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1056182060 9:84094544-84094566 CTTACTCTGTCAACCGAGGCTGG - Intergenic
1057277879 9:93685891-93685913 CTTTCCCTGTTCAGGGAGGAGGG + Intergenic
1057866649 9:98686934-98686956 CTGACTCTGCTGAGGGAGGGTGG - Intronic
1061905535 9:133694779-133694801 ATTACTTTGTGGATGGAGGATGG + Intronic
1062176634 9:135166852-135166874 CTTCCTCTGATGAGAGAGGAAGG - Intergenic
1062292982 9:135805688-135805710 CTTCCTCTATTGAAGGAGCAAGG + Intergenic
1062360811 9:136187215-136187237 ATGACACGGTTGACGGAGGAAGG - Intergenic
1062739126 9:138157760-138157782 GTTACTCGGGTGACAGAGGAGGG - Intergenic
1185859794 X:3566929-3566951 CTTATTGTGCTGACTGAGGAGGG + Intergenic
1186033141 X:5391669-5391691 CCTACTCTTTCGAGGGAGGAGGG + Intergenic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1187129997 X:16493505-16493527 CTAACTCTGATCACGAAGGAAGG - Intergenic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1193123519 X:77847720-77847742 CTTACTCAGGAGACGGAGGCAGG - Intronic
1195278887 X:103310629-103310651 CTTGCGCTGGTGACGGAGGCAGG + Exonic
1195926097 X:110026353-110026375 ATTACTCTGTAGACGGCAGAGGG + Intronic
1197418675 X:126208895-126208917 CTTACTCTGTTGCCCCAGGCTGG + Intergenic
1198731901 X:139740471-139740493 CTTACTGTTTTGGTGGAGGAGGG - Intronic
1201320308 Y:12691215-12691237 CTTACTCTGTTCACCCAGGCTGG - Intergenic
1202603304 Y:26616364-26616386 CTTGCTCTGTTGTCTGAGGCTGG + Intergenic