ID: 1096373587

View in Genome Browser
Species Human (GRCh38)
Location 12:51089071-51089093
Sequence CAGGAGAAGCAGAATGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 405}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096373585_1096373587 10 Left 1096373585 12:51089038-51089060 CCTTAACTCACAACTAAGAAAGT 0: 1
1: 0
2: 1
3: 11
4: 177
Right 1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG 0: 1
1: 0
2: 0
3: 37
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096373587 Original CRISPR CAGGAGAAGCAGAATGATGT AGG Intergenic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
902604065 1:17559032-17559054 TGGGGGGAGCAGAATGATGTGGG + Intronic
903249638 1:22043435-22043457 CTAGACAAGCATAATGATGTGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904014304 1:27408289-27408311 CAAGAGAAGCGGGATGTTGTGGG - Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905229810 1:36508013-36508035 AAACAGGAGCAGAATGATGTAGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
909354097 1:74687180-74687202 TAGGAGAAGCCGGATGGTGTAGG - Intergenic
910228356 1:84960599-84960621 CAGCACAAGCTGGATGATGTGGG - Intronic
910813834 1:91266832-91266854 CAGGAGAATCTCCATGATGTGGG - Intronic
912173707 1:107132465-107132487 CCAGAGAAGTAAAATGATGTAGG + Intergenic
912602539 1:110951722-110951744 CAGGAGAAACAGAATTCTGTTGG + Exonic
912753316 1:112303487-112303509 CGGGAGCAGGAGAATGATGGGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916486034 1:165259479-165259501 TATGAGAACCAAAATGATGTGGG - Intronic
916584020 1:166134117-166134139 CAGGAGAAACTGAATGTTGTAGG - Intronic
918343737 1:183588784-183588806 CAGGAGAAACAGAGACATGTGGG + Intronic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920335679 1:205243658-205243680 CAGGAGAAGGAGCATGTTTTGGG + Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920754471 1:208715997-208716019 CTGGATCAGCAGAATGATTTTGG + Intergenic
921405252 1:214772069-214772091 CAGGAGCAAGAGAGTGATGTGGG + Intergenic
921420526 1:214942097-214942119 AATGAGAAGGAGACTGATGTAGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
924806444 1:247365456-247365478 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
924816486 1:247446424-247446446 CAGGAGAGGCTGGATTATGTGGG - Intronic
1063744320 10:8862612-8862634 GGGGAGAAGGAGAAGGATGTGGG - Intergenic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1066015051 10:31233010-31233032 GATGAGATGCAGTATGATGTTGG - Intergenic
1066278035 10:33887829-33887851 CAGGAGAGCCAGCACGATGTGGG - Intergenic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1068264468 10:54628245-54628267 GAGAAGAAGCAGGAAGATGTAGG + Intronic
1068477331 10:57545571-57545593 GAGGAGAAACAGAAAGATATAGG + Intergenic
1068746920 10:60542934-60542956 AAGGACAAGCTGAATCATGTTGG - Intronic
1069247201 10:66220805-66220827 GAAGAGAAGCAGCTTGATGTTGG - Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1072224518 10:93356071-93356093 CAGCAGCAGCAGAATACTGTGGG + Intronic
1072302020 10:94070918-94070940 CAGGAGAAGCGGATTAATGTTGG - Intronic
1072686486 10:97540385-97540407 CAGGAGACGCAGTATCTTGTGGG + Intronic
1073175741 10:101556169-101556191 CAAAAAAACCAGAATGATGTAGG - Exonic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074543853 10:114387389-114387411 CAGGGGAAGCTGAATCATGAAGG - Intronic
1074639056 10:115358073-115358095 CAAGAGAAGCAGGATCATGGAGG - Intronic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1078353794 11:10618176-10618198 CAGCAGAAGCAAAAGCATGTAGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082875303 11:57981833-57981855 GATGAGTATCAGAATGATGTTGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1086286178 11:85253944-85253966 GAGGAGAAGCAGCTGGATGTTGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086363608 11:86085784-86085806 CAAGAGAAGGAAAATGATATAGG - Intergenic
1086642669 11:89178746-89178768 CAAGAGGAGAAGAATGATGCTGG - Exonic
1087061491 11:93983179-93983201 CAGGAGAGGCAGAAATATCTTGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087655501 11:100917926-100917948 AAAGAGAAGCTGAATGATGTGGG - Intronic
1087879957 11:103404518-103404540 CAGGATAATCAGAGTAATGTTGG + Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089216905 11:116839818-116839840 AAGGACAAGCAGAGAGATGTGGG - Intergenic
1089336311 11:117726095-117726117 CACGAGAAGCAGGACGAAGTGGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090536863 11:127652277-127652299 CATGGGAAGCTGAATGATCTGGG - Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1091080572 11:132663643-132663665 CAGCAAAAGCTGAATGATATGGG + Intronic
1091082184 11:132681373-132681395 GAGGAGAAGCAGCTGGATGTCGG + Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091800153 12:3319993-3320015 CAGGAGAAGCAGACTCTTGGAGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1093667478 12:21831685-21831707 AAGGATAAGCAGAATGTTTTTGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095973420 12:47921931-47921953 CAGGACTAGCAGAAGAATGTGGG - Intronic
1096216627 12:49801367-49801389 CAGGAGAAGCAGGAGGCTATTGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097303557 12:58043949-58043971 CAGGGGAAACAGTATGTTGTAGG + Intergenic
1097904309 12:64904389-64904411 GAGGAGATGGAGAAGGATGTGGG + Intergenic
1098316383 12:69197848-69197870 AAGGAGAACCAGTGTGATGTGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1100500850 12:95172709-95172731 CAGGAGGAACAGAATGATCTTGG - Exonic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1101255002 12:102967964-102967986 CAGCAAGAGCAAAATGATGTGGG + Intergenic
1102867904 12:116388685-116388707 TAGTAGAAGCAGAAGGTTGTTGG + Intergenic
1103875844 12:124126487-124126509 TAGGAGAAGAAGGAAGATGTGGG + Intronic
1104395433 12:128428342-128428364 CAGGAGAAGGAGAACAATGTGGG - Intronic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105607009 13:21934341-21934363 CAGGAGATGCACAACGCTGTAGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106042498 13:26106562-26106584 CAGTAGTAGTAGAAAGATGTGGG - Intergenic
1106175725 13:27329601-27329623 CAAGGGAAGCAGAAGGATCTAGG - Intergenic
1106816224 13:33410303-33410325 AAGCAGAAGCAGAAAAATGTAGG + Intergenic
1108151677 13:47542427-47542449 CATGAGAAGAAGAATTATGGGGG - Intergenic
1108168610 13:47718429-47718451 CAGGACAAGTAATATGATGTTGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1109237123 13:59837356-59837378 CACAAGAAACTGAATGATGTCGG - Intronic
1110356327 13:74571952-74571974 TAAGAGAAGCAGAAAGATGCAGG + Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1112451118 13:99510489-99510511 CCCCAGAAGCAGAGTGATGTCGG - Intronic
1112992422 13:105530238-105530260 CAGGAGAGGAAGAGTGATCTTGG - Intergenic
1113161154 13:107382626-107382648 CAGGAGAAGAAAAAACATGTGGG - Intronic
1113612206 13:111655077-111655099 CATGAAAAGCAGCAAGATGTAGG + Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1115153715 14:30314809-30314831 GAGGAGAAGCAGCTGGATGTTGG + Intergenic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1117800290 14:59436407-59436429 CAGCAGATGCAGAATTCTGTAGG + Intronic
1118566538 14:67147114-67147136 TAGCAGAACAAGAATGATGTAGG - Intronic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1120451767 14:84677423-84677445 CATAATAAGCAGAATGATGCTGG - Intergenic
1120472101 14:84938633-84938655 CATGAGAAGGGAAATGATGTGGG - Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120953699 14:90063391-90063413 CAGCAGAAGGAAAATGATTTGGG + Intronic
1121224291 14:92309879-92309901 CATGAGTAGCAGAATCAGGTAGG - Intergenic
1121269199 14:92626676-92626698 TAGGAGTAGCAGAAGGATCTGGG + Intronic
1122910534 14:104825840-104825862 CAGGAGCAGAAGCCTGATGTGGG + Intergenic
1124061319 15:26296198-26296220 CAGCAGAAGCAGAAGAATTTGGG - Intergenic
1125401816 15:39312208-39312230 CAGGAGAAACAGAGAGCTGTTGG - Intergenic
1126889559 15:53189857-53189879 GAGGAGAATTAGAATGATATTGG - Intergenic
1126896359 15:53261236-53261258 TAGGAGAAGCAGACTGGTATAGG + Intergenic
1127404809 15:58631517-58631539 CAGCAGCAGCAGCATTATGTGGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128267340 15:66278497-66278519 CAGCAGAAGCATAATAATGCTGG + Intergenic
1128606947 15:69043634-69043656 TAGGAGAAGCAGAACGTTCTCGG + Intronic
1130068789 15:80629053-80629075 CAGGAGGAGGAGAATGAAGGGGG + Intergenic
1130561706 15:84964082-84964104 CAGGAGAATCAGGGTGCTGTGGG - Intergenic
1130829524 15:87585108-87585130 CAGGAGGAGCAAATTGATTTGGG - Intergenic
1133460685 16:5983986-5984008 AAGGAGAAGAAGAAGAATGTGGG - Intergenic
1133734858 16:8607334-8607356 CAGGGGAGGCAGCGTGATGTGGG - Intergenic
1133928619 16:10213921-10213943 CAGGAGAGGCAGGATCAAGTCGG - Intergenic
1135616397 16:23914472-23914494 TGGGAGAGGCAGAATGGTGTTGG + Intronic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1139132890 16:64167778-64167800 CAGGAGGAGGACAATGATGAAGG - Intergenic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142785776 17:2221405-2221427 CAGGAGAATCACAATCATGGTGG - Intronic
1143818535 17:9540530-9540552 GAGAGGAAGGAGAATGATGTCGG - Intronic
1144434317 17:15225790-15225812 CATAAGCAGAAGAATGATGTTGG - Intergenic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1149302181 17:55315659-55315681 AAGGAGAAGCAGTAAAATGTTGG + Intronic
1150385249 17:64754029-64754051 CAGGATAACCAGAATAATCTTGG + Intergenic
1150456528 17:65310900-65310922 TAGGAGAAGCAAAATCCTGTTGG + Intergenic
1150771403 17:68044457-68044479 CAGGATAACCAGAATAATCTTGG - Exonic
1150894145 17:69190116-69190138 CATGGGAAGCAGACAGATGTTGG + Intronic
1150991196 17:70261164-70261186 CAGGAGAATCATAGTGATGGTGG + Intergenic
1151045015 17:70909619-70909641 CAGGTGAAGCAGGAGGATTTAGG + Intergenic
1151386118 17:73756492-73756514 CAGGACTAGCAGAGTGGTGTAGG + Intergenic
1151513020 17:74573284-74573306 CAGGAGGAGCTGTATAATGTGGG - Intergenic
1152580446 17:81163411-81163433 CAGGAAAAGCAGGGTGATGGGGG - Intronic
1152778468 17:82216091-82216113 CAGGAGAAGCCGCATGATGGTGG - Intergenic
1152940363 17:83168898-83168920 AAGGAGAAGGAAAATAATGTAGG - Intergenic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1153584850 18:6610689-6610711 GAAGAGAAGCACAATGATCTTGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1156539199 18:37893167-37893189 CAGGAAAAACAACATGATGTTGG + Intergenic
1157780070 18:50430614-50430636 GAGAAGATGCAGAATGATGGTGG + Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158293690 18:55970457-55970479 CAGGAAATGTAGAATGATGGTGG - Intergenic
1159507599 18:69357033-69357055 CAAGAGAAGCATAAGGATGCTGG - Intergenic
1159996262 18:74968377-74968399 CAAGAGAAGCAGAAGTATGGGGG - Intronic
1160343855 18:78113194-78113216 TGGGAGAAAAAGAATGATGTAGG - Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161907737 19:7169684-7169706 CAGGAGATGCAGACTGACATAGG + Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG + Intronic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165121838 19:33564932-33564954 CAGGGGAGGCAGCATGGTGTGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926877471 2:17497814-17497836 AAGCAGAAGCAGAGTGTTGTAGG - Intergenic
926973644 2:18491623-18491645 CAGGAGGAGCAGAATGTCCTGGG - Intergenic
926997390 2:18751191-18751213 CAAGAGAAGCTGAATGATGGGGG - Intergenic
928028002 2:27755507-27755529 CAGGAAAAGCCTAATAATGTAGG + Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928452896 2:31394157-31394179 AAAGAGAAGGAAAATGATGTAGG - Intronic
928813088 2:35253497-35253519 GAGGAGAAGCAGCTGGATGTCGG + Intergenic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
930194159 2:48492618-48492640 TATGAGAAGTAGAATGTTGTAGG + Intronic
930807532 2:55506068-55506090 CAGGAGAAGGAGACTGCAGTGGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932110189 2:68992298-68992320 CAAGAGAAGCATGCTGATGTAGG - Intergenic
932254288 2:70270496-70270518 CAGCTGAAGCAGAGTGATATGGG - Intronic
932924909 2:75961846-75961868 CCCCAGAAGCTGAATGATGTTGG + Intergenic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
935648547 2:105362580-105362602 CAGGAGAAGTTTTATGATGTGGG - Intronic
936160053 2:110078058-110078080 CTGGAGAAGCAGCAGGATTTGGG - Intergenic
936184611 2:110293295-110293317 CTGGAGAAGCAGCAGGATTTGGG + Intergenic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
936433751 2:112485466-112485488 AAGGAGAACTAGAATGATGCTGG - Intronic
936868615 2:117107348-117107370 GAGGAGAAGCAGTTGGATGTTGG + Intergenic
937403430 2:121605843-121605865 CAGGTGTTGCAGAAGGATGTGGG - Exonic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
938942486 2:136181271-136181293 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
939967031 2:148620282-148620304 CAGGAGAAGAAAAACAATGTGGG - Intergenic
940000657 2:148963799-148963821 CAAGAGATGCAAAATGATGGGGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
942916146 2:181309623-181309645 TAAGTGAAGCAGAATGATCTAGG + Intergenic
943078082 2:183222541-183222563 CAGGAGATGAATAATGATGCTGG - Intergenic
945350239 2:208769042-208769064 CTGGAAAGGCAGAATGATTTTGG - Intronic
946448173 2:219757562-219757584 CAGGAGTAGCAGAGGGCTGTGGG - Intergenic
946471395 2:219964285-219964307 GAGGAGAAGCAGCTGGATGTAGG + Intergenic
946600120 2:221350634-221350656 CAGAAGAAGCACAATTATTTGGG + Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
1169000516 20:2164620-2164642 CAGGAGGAGGAGTATGATGGAGG - Intronic
1170192389 20:13657266-13657288 CAGGATAAGCAGGATTAAGTAGG + Intergenic
1170675041 20:18471201-18471223 CAGGAGGAGCAGATTGTTTTTGG + Intronic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172766009 20:37351255-37351277 GAGGAGAAGTTGAATGATCTTGG + Intronic
1174300112 20:49575683-49575705 CAGGAGAGCCAGGATTATGTAGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1179620594 21:42613303-42613325 CAGGAGGAAGAGAATGAAGTTGG + Intergenic
1182068472 22:27446559-27446581 CAAGAGAGGCAGCATGGTGTGGG + Intergenic
1183521503 22:38298441-38298463 CAGGAGCAGCAGGACGGTGTAGG + Intronic
1183968798 22:41460351-41460373 CAGCTGCAGCAGACTGATGTTGG + Exonic
1184191792 22:42899828-42899850 GAACAGAAACAGAATGATGTGGG + Intronic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
950176010 3:10874986-10875008 GAGGATCAGCAGCATGATGTAGG - Exonic
950198325 3:11025474-11025496 CAGGATGATCAGCATGATGTAGG - Exonic
950254501 3:11493311-11493333 GAGGAGAAGCAGCTGGATGTTGG - Intronic
950334421 3:12182209-12182231 GAGGAGAAGCAGCTTTATGTGGG + Intronic
951587276 3:24228284-24228306 AAGGAGAGGCAGAATGACCTTGG - Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
952867706 3:37865670-37865692 CAGGAGAATCACTATGATGTTGG - Intronic
952995597 3:38878813-38878835 CTGGAGAACCATAATGTTGTTGG - Intronic
953771650 3:45782186-45782208 CACGATAAGCATGATGATGTAGG + Exonic
953839016 3:46373651-46373673 CAGGAGAAGGACAATGTTGTAGG - Exonic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955777835 3:62452592-62452614 CAGGAGAAGAAAAAAGATATGGG + Intronic
956704704 3:71989309-71989331 CAGGAGAAGCATCATGCTTTGGG + Intergenic
956801596 3:72764657-72764679 CAGGAGCAGCAGCATCATCTTGG + Intronic
956927758 3:74007823-74007845 TAGGAAAACCAGAATGAAGTGGG + Intergenic
960089015 3:113620269-113620291 AAGAGGAAGAAGAATGATGTAGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
961452161 3:127007127-127007149 CAGGAGAAGCAGGGTGGTGGGGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
963900211 3:150726406-150726428 CAGGAGAAGCAGACTGAATGTGG + Intergenic
964320335 3:155489172-155489194 CATGAGAAGCATAATTCTGTTGG - Intronic
965241428 3:166204364-166204386 CAGGTAAAGCAGAATGGTGTAGG - Intergenic
967278072 3:187795863-187795885 CCGGGCCAGCAGAATGATGTTGG - Intergenic
971200881 4:24508180-24508202 CAGGAGGAGCAGAGTCATTTGGG - Intergenic
971510926 4:27422305-27422327 CACGATAATCAGAATGATCTGGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
974888747 4:67852677-67852699 CAGTTGAATCAGAATGATTTGGG + Intronic
974891602 4:67890763-67890785 GAGGAGAAGTAAACTGATGTTGG - Intergenic
976090428 4:81451826-81451848 GAGGAGAAGGTGCATGATGTAGG - Intronic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
976531851 4:86163933-86163955 CAGGAGAAGATCAATAATGTGGG - Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976864159 4:89704080-89704102 GAGGTGAAGCAGGTTGATGTTGG - Intergenic
976984095 4:91271147-91271169 CAGTAGAAGGAAAATTATGTGGG + Intronic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
978043509 4:104098686-104098708 CAGTAGAAGTAGAAATATGTGGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978904217 4:113986622-113986644 CAAGAAAAGATGAATGATGTGGG + Intergenic
980039302 4:127920854-127920876 GAGGACAAGCAGATTGATATTGG + Intronic
980165045 4:129215484-129215506 GTGGAGGAGCAGATTGATGTCGG + Intergenic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980572553 4:134639628-134639650 CTGGATAAGCAGTTTGATGTTGG - Intergenic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982504767 4:156203453-156203475 TTGGAAATGCAGAATGATGTGGG - Intergenic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
983307950 4:166017865-166017887 CAGGATAAGGACAATGATATTGG + Intronic
984359646 4:178711806-178711828 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
985161478 4:187048857-187048879 CAGGAGAAGGGGAATGAAGGTGG + Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985617908 5:935489-935511 CAGAAGAAATAGGATGATGTGGG - Intergenic
986279095 5:6308468-6308490 CAGTAGAAGCAGGATCCTGTTGG + Intergenic
986688640 5:10295814-10295836 AATGAGAAGCAGAGTGTTGTGGG - Intronic
986980831 5:13446742-13446764 CAGGGGAAGAGGAATGATCTTGG - Intergenic
986982453 5:13464819-13464841 TAGGAGAAACAGATTGATGTAGG + Intergenic
987693926 5:21303983-21304005 CAGGAGAAAAAGTTTGATGTGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989683499 5:44057792-44057814 AAGGAGAAGGAGAAAGATCTTGG + Intergenic
991272286 5:64798355-64798377 CAGGACAAGAAGAAAGATGGTGG - Intronic
991746327 5:69745548-69745570 CAGGAGAAAAAGTTTGATGTGGG + Intergenic
991751378 5:69809693-69809715 CAGGAGAAAAAGTTTGATGTGGG - Intergenic
991797929 5:70325501-70325523 CAGGAGAAAAAGTTTGATGTGGG + Intergenic
991825705 5:70620862-70620884 CAGGAGAAAAAGTTTGATGTGGG + Intergenic
991830666 5:70684587-70684609 CAGGAGAAAAAGTTTGATGTGGG - Intergenic
991890270 5:71324820-71324842 CAGGAGAAAAAGTTTGATGTGGG + Intergenic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
993436493 5:87901939-87901961 CAGGAGAACCAGAAGAATGCAGG - Intergenic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995199780 5:109413127-109413149 TAGGGGAAGTAGAATGGTGTTGG + Intergenic
995608036 5:113879376-113879398 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
995905639 5:117119275-117119297 CAGGAGAAGGAGACTGACCTTGG + Intergenic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996801994 5:127414641-127414663 AGGGAGAAGCAGATTAATGTGGG + Intronic
996832765 5:127757979-127758001 CGGGTGAAGTAGAATGAGGTGGG + Intergenic
997294518 5:132761333-132761355 CCAGAGAAGTAGAATCATGTGGG + Intronic
997668335 5:135649991-135650013 CAGGAGAAGCGGGTGGATGTAGG - Intergenic
998289021 5:140895037-140895059 CATATGAAGCAGAATGGTGTGGG - Intronic
998960560 5:147481966-147481988 CAGGAGAATAATACTGATGTAGG + Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1002177881 5:177412214-177412236 CAGGAGTTCCAGACTGATGTAGG + Intronic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1003598769 6:7499367-7499389 GAGGAGAGGGAGAAAGATGTGGG + Intergenic
1004495156 6:16156116-16156138 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005556985 6:26995937-26995959 CAGGAGAAAAAGTTTGATGTGGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008255791 6:49297978-49298000 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1010824175 6:80452691-80452713 GATTAGAAGCAGAATGTTGTAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013713915 6:112934869-112934891 AAGAAGAGGGAGAATGATGTTGG - Intergenic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1017114669 6:150965923-150965945 CATGAGGGGCAGAGTGATGTGGG + Intronic
1017133437 6:151127883-151127905 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1017478711 6:154827735-154827757 CTTGAGAAGCAAAATGCTGTAGG + Intronic
1017964951 6:159256109-159256131 CAGGAAACGAAGAATGTTGTTGG - Intronic
1018364236 6:163101642-163101664 GAGGAGAAGGAGTGTGATGTCGG + Intronic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1019485858 7:1288915-1288937 CAGGACAAGCAGGCCGATGTCGG - Intergenic
1019653419 7:2173099-2173121 CAGGAGATGCAGAGTGGAGTTGG - Intronic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1021241308 7:18205370-18205392 CAGGAGAAGCTCAATGTTTTTGG - Intronic
1021410156 7:20320933-20320955 GATGAGAAGAAGAATGAAGTAGG + Intergenic
1022267707 7:28773683-28773705 CAGGGAAAGCAGAAAGATATGGG - Intronic
1022673358 7:32476467-32476489 CAGCAGAAGACAAATGATGTGGG - Intergenic
1023126823 7:36962495-36962517 CAGGGAAAGATGAATGATGTGGG + Intronic
1025736331 7:64150455-64150477 CCAGAGAAGAAGAAAGATGTTGG + Intronic
1026310988 7:69184158-69184180 AAGGAAAAGGAGACTGATGTGGG + Intergenic
1026333832 7:69376978-69377000 AAAGAGATGCAGAAAGATGTAGG - Intergenic
1026475195 7:70729130-70729152 CAGGAGAAAAAGAGTGATGGAGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027141889 7:75663486-75663508 CAGGCGAGGCGGACTGATGTAGG + Intronic
1028465790 7:91149978-91150000 CAGGAGATGAAGAATTGTGTAGG + Intronic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1030546894 7:110907437-110907459 GAGGAGAAGCAGTTGGATGTTGG - Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1032248263 7:130231414-130231436 CAGGAGAAAGAGAGTGAAGTGGG + Intergenic
1032520295 7:132538710-132538732 CAGGAGAGCCAGGATGCTGTAGG + Intronic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034367944 7:150568007-150568029 CAGGAGAAGCTGGATGCTGATGG + Intronic
1035047458 7:155978043-155978065 CAGCAGCAGCAGCCTGATGTGGG - Intergenic
1035184024 7:157111887-157111909 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1036103145 8:5809688-5809710 TAGGAAAAGCAGAGTGATGTTGG - Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037649809 8:20826051-20826073 TAGGATAACCAGAATGTTGTGGG - Intergenic
1037933072 8:22895317-22895339 CTGGAGAGGCATAATAATGTTGG + Intronic
1038024337 8:23575616-23575638 CAGGGCAAGCAGATTGATGGTGG + Intergenic
1038351410 8:26779534-26779556 CATGACAAGCAGGATGATGAAGG + Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042291436 8:67172902-67172924 GAGGAGAAGCAGGAGAATGTAGG + Intronic
1044142861 8:88675952-88675974 CAGGAGAAGCAGAAGTATACTGG + Intergenic
1044274680 8:90285838-90285860 AAGGAGAAGCAGCTGGATGTTGG - Intergenic
1044905367 8:96995424-96995446 CAGAAGAAGCTGATTTATGTGGG + Intronic
1045775702 8:105800004-105800026 CAGGGGAAGCAGAAACATATTGG + Intronic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046176255 8:110578770-110578792 GAGGAGGAGCAGAATAAAGTAGG - Intergenic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1046840249 8:118848235-118848257 CAGTAGAATGAGGATGATGTAGG + Intergenic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047843873 8:128785009-128785031 CAGGAGGAAGAGAATGAAGTGGG + Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1050539319 9:6656632-6656654 CAAGAGAAGCAGAATTATAAAGG + Intergenic
1051984829 9:23071289-23071311 CAGTGGAAGCAGAATTATGGAGG - Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052158731 9:25227921-25227943 CAGGAGATGCAAAATTATTTAGG + Intergenic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053556816 9:39145897-39145919 GAGGAGAGGGAGAAGGATGTGGG - Intronic
1054089796 9:60834314-60834336 GAGGAGAGGGAGAAGGATGTGGG - Intergenic
1054111207 9:61109872-61109894 GAGGAGAGGGAGAAGGATGTGGG - Intergenic
1054609650 9:67221253-67221275 GAGGAGAGGGAGAAGGATGTGGG + Intergenic
1055420523 9:76136313-76136335 CAGGAGAAGCAACATGCTTTGGG + Intronic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1056450951 9:86716294-86716316 CAGGACTAACAGAATGATGGGGG - Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057369729 9:94459544-94459566 GAGGATGAGCAGAATGATGGCGG - Exonic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1059049488 9:110908041-110908063 GATGAGAAGCAGAATTATTTGGG - Intronic
1059226923 9:112680983-112681005 CAGCAGAGGCAGCATGGTGTGGG + Intergenic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1060527196 9:124327306-124327328 GAGGAGAAGGAGATTGGTGTGGG - Intronic
1060535868 9:124387541-124387563 CATGGGAAGCAGAATCAGGTTGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1186672121 X:11778387-11778409 CAGGAGAAGCATCATCCTGTAGG - Intergenic
1187603666 X:20860699-20860721 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188184970 X:27102626-27102648 CAGGAGAAGCATATTTGTGTTGG - Intergenic
1188553245 X:31383692-31383714 GAGGAGAAGCAGCTGGATGTTGG + Intronic
1188643793 X:32538693-32538715 CAGTAGCAGCAGAATCACGTGGG + Intronic
1188675858 X:32938164-32938186 CAAGAGAACCAGAATGATTTTGG - Intronic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190701477 X:52992575-52992597 CAAGTGAAGCAGAGTGCTGTGGG - Intronic
1192494327 X:71604856-71604878 CAGGAGCATGAGAAAGATGTGGG - Intronic
1195001203 X:100645006-100645028 CAAGGGAAGTAGAAAGATGTGGG - Intronic
1196024705 X:111029061-111029083 CAGGAGATGCAGGCTGCTGTGGG + Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197632151 X:128873717-128873739 TAGGAGAAGCTGGATGATTTTGG - Intergenic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1198717455 X:139573507-139573529 CAGGAGCAGGAGAGTGATGGGGG - Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1201453853 Y:14146677-14146699 CAGGAGAAGTAAAATGGTCTTGG - Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic