ID: 1096386757

View in Genome Browser
Species Human (GRCh38)
Location 12:51199408-51199430
Sequence TCTTACAGGCATCCACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096386752_1096386757 14 Left 1096386752 12:51199371-51199393 CCTGGCTCTAAATGAGGACTCTG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 150
1096386749_1096386757 20 Left 1096386749 12:51199365-51199387 CCACTCCCTGGCTCTAAATGAGG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 150
1096386751_1096386757 15 Left 1096386751 12:51199370-51199392 CCCTGGCTCTAAATGAGGACTCT 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096386757 Original CRISPR TCTTACAGGCATCCACTGGA GGG Intronic
902773245 1:18658375-18658397 TATTATAAGCATGCACTGGAAGG - Intronic
903914502 1:26753754-26753776 CCTAACAGGCATCTTCTGGAAGG - Intronic
906428857 1:45738088-45738110 AGTTTCAGGCATCCACTGGGGGG + Intronic
906937595 1:50227541-50227563 TAAAACAGGCAGCCACTGGAGGG + Intergenic
907677927 1:56535879-56535901 TCTTACAGCAATCCTCTTGAGGG + Intronic
909969859 1:81969204-81969226 TCTTACAGTCATCACCTGGGTGG + Exonic
916578116 1:166085057-166085079 TCTTCCAGGGATCCACCAGAAGG - Intronic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
919283353 1:195519990-195520012 TCTTGCAGGAATTCTCTGGACGG - Intergenic
920906356 1:210173541-210173563 TCTCACAGAACTCCACTGGAAGG - Intergenic
923281957 1:232451947-232451969 TCTCAAAAGCATACACTGGAAGG + Intronic
924261282 1:242234278-242234300 TCTTAGAGGCATTCAATGCACGG - Intronic
1064007319 10:11709061-11709083 TCCTGCTGGAATCCACTGGAAGG - Intergenic
1065622934 10:27601678-27601700 TCTCACAGGCTTCCATAGGAAGG + Intergenic
1069501452 10:68956544-68956566 GCTTATAGGCATCCACAGGTCGG + Intronic
1070088766 10:73262725-73262747 TGTTACAGGTATCCACTGGGGGG + Intronic
1070507106 10:77123641-77123663 GGTTTCAGGCATCCACTGGGAGG - Intronic
1073842821 10:107517568-107517590 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1074051665 10:109886327-109886349 TCTTGCAGGCATCTCCTGGAAGG - Exonic
1074711137 10:116178603-116178625 TCTTCTGGGCATCCACTGCACGG - Intronic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1076758077 10:132585538-132585560 CGTTACAGGCGTCCACTGGGGGG + Intronic
1080653722 11:34242424-34242446 TCTGACACGCAGCCACAGGAGGG + Intronic
1087217153 11:95506483-95506505 TGTTTCAAGCATCCACTGGGGGG + Intergenic
1088832411 11:113548624-113548646 AGTTTCAGGCATCCACTGGGGGG + Intergenic
1089599730 11:119605925-119605947 TCTTGCTGGCATCCCCTGAAAGG + Intergenic
1090622669 11:128575119-128575141 GGTTTCAGGCCTCCACTGGAGGG - Intronic
1093559142 12:20517028-20517050 TCTCACAGGCATTTACTGAATGG + Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1098850100 12:75585983-75586005 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1099746716 12:86714102-86714124 TCTGATAGGCATCCATTGAATGG + Intronic
1100430234 12:94525674-94525696 TACTACAGGTATTCACTGGAAGG - Intergenic
1100877080 12:98973974-98973996 AGTTTCAGGCATCCACTGGGTGG + Intronic
1100883143 12:99040372-99040394 TCTTCGTGGCAGCCACTGGAGGG - Intronic
1101472912 12:105015733-105015755 TGTTTCAGGCATCCTCTGGGGGG + Intronic
1103897210 12:124280467-124280489 TCATACGTGCATCCACTAGAGGG - Intronic
1104025388 12:125022182-125022204 TCCTCCAGGAATCCCCTGGAGGG - Intronic
1104800087 12:131548490-131548512 GGTTTCAGGCATCCACTGGGGGG - Intergenic
1107365885 13:39674875-39674897 AGTTTCAGGCATCCACTGGAGGG + Intronic
1108465393 13:50709904-50709926 GGTTTCAGGCATCCACTGGGAGG - Intronic
1108524728 13:51277085-51277107 TTTTCCAGTCATCCACTTGATGG - Intronic
1113373595 13:109744203-109744225 TCCTTCTGGCATCCTCTGGAAGG - Intergenic
1114877688 14:26742047-26742069 TAATACATGCATCCACTGAAGGG + Intergenic
1118433843 14:65751047-65751069 GCTTATCTGCATCCACTGGAAGG + Intergenic
1118479828 14:66153263-66153285 ACTTGCAGCCATCCCCTGGAAGG - Intergenic
1119170664 14:72533589-72533611 TCTTAATGGCATCCACCAGAAGG - Intronic
1119394614 14:74317082-74317104 TGTTACAGGAAGCCATTGGAGGG + Intronic
1120024846 14:79571147-79571169 TATTGCAGGCATCCATTGGGTGG - Intronic
1122345443 14:101055877-101055899 CCTTACAGGAATTCTCTGGAGGG - Intergenic
1125877301 15:43161115-43161137 GTTTTCAGGCATCCACTGGGGGG + Intronic
1128848467 15:70924951-70924973 TCTTAAAGGCAACCAGAGGAAGG - Intronic
1130666845 15:85877007-85877029 TCTTACAGCAAACCACTGAATGG + Intergenic
1130767302 15:86883940-86883962 AGTTTCAGGCATCCACTGGGGGG - Intronic
1130803112 15:87287547-87287569 TCTTACAGTCTTCCTTTGGAAGG - Intergenic
1131183871 15:90258663-90258685 TCTTGCAGGCATTAACTAGAGGG - Intronic
1135112144 16:19698660-19698682 TCTTACACGCATTCACTGTCAGG + Intronic
1137441703 16:48503871-48503893 TCTTTCAGGCATCCTGGGGAAGG - Intergenic
1139204278 16:65011476-65011498 TATTACAGGAATCCAATGTAAGG + Intronic
1141866816 16:86755946-86755968 GATTACAGGCATGCACTGGTGGG - Intergenic
1143081754 17:4386820-4386842 TCTTAAAAGCATCCACGGGCAGG + Intergenic
1150379051 17:64706371-64706393 TGATACAGGAAGCCACTGGAGGG - Intergenic
1151274278 17:73022255-73022277 ACTTGCAGGCATCCACAGAATGG + Intronic
1152128677 17:78462756-78462778 TGTCACAGGCATCCACGGGCTGG - Intronic
1153445608 18:5169199-5169221 TCTTACAGCCTTCAACTGGTTGG + Intronic
1154953306 18:21230757-21230779 TGTTTTAGGCATCCACTGGGGGG + Intergenic
1157162155 18:45323945-45323967 TGTAACACGCATGCACTGGAGGG + Intronic
1159464429 18:68762887-68762909 GGTTTTAGGCATCCACTGGAGGG + Intronic
1160131956 18:76233268-76233290 TCTTAAAGGCATTCACTCCATGG - Intergenic
1160796870 19:949618-949640 TCCAGCAGGCATCCACTGGAGGG - Intronic
1161732519 19:5970089-5970111 TGTTACAGACATCTAGTGGATGG + Intronic
1168683016 19:58329812-58329834 GGTTTCAGGCATCCACTGGAGGG + Intronic
927407117 2:22783564-22783586 TCTTCCAGGCCTCCATTAGAAGG + Intergenic
932815960 2:74862128-74862150 TCTTACAGTCATCCAGTGGTAGG + Intronic
935114147 2:100120178-100120200 TTTCACAGGCATACACTGGCAGG - Intronic
938107365 2:128542325-128542347 AGTTTCAGGCATCCACTGGGGGG + Intergenic
940755005 2:157671903-157671925 GGTTTCAGGCATCCACTGGAGGG - Intergenic
942408134 2:175677135-175677157 GGTTTCAGGCATCCACTGGAGGG - Intergenic
944627549 2:201587586-201587608 TCTTAAAGGCAGCCAGAGGAGGG - Intronic
945188898 2:207166479-207166501 TCTGCCAGGCATCTAGTGGAGGG - Intronic
945432488 2:209780611-209780633 TGTTACTGGCATCTAATGGATGG - Intronic
947448580 2:230183955-230183977 GGTTTCAGGCATCCACTGGAGGG - Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
1169887708 20:10419517-10419539 AGTTTCAGGCATCCACTGGGTGG - Intronic
1170446975 20:16438510-16438532 AATTTCAGGCAACCACTGGAGGG + Intronic
1170692500 20:18628260-18628282 TGTTACAGGCACCCAAGGGACGG - Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1176671309 21:9737579-9737601 GCTTACAAGCATCCACATGAGGG + Intergenic
1176889323 21:14294967-14294989 TCTTAAAGTCATCAAGTGGAAGG - Intergenic
1177826503 21:26090134-26090156 TCTAACAAGCCTCCACTGTAAGG + Intronic
1178043006 21:28662315-28662337 TCTCACAGGAACCAACTGGAAGG + Intergenic
1181928712 22:26381515-26381537 TGATACAGGATTCCACTGGATGG - Intronic
1182218227 22:28737152-28737174 GGTTTCAGGCATCCACTGGGGGG - Intronic
1183481212 22:38066523-38066545 TCTTACAGGTGTCCACAGGCGGG + Intronic
952077140 3:29711033-29711055 GATTTCAGGCATCCACTGGGGGG - Intronic
952863572 3:37835151-37835173 AGTTTCAGGCATCCACTGGTGGG + Intergenic
953957565 3:47243591-47243613 TCATACAGGCTTCCCCGGGAAGG + Intronic
954456400 3:50601961-50601983 TCCCACAGCCATCCACTGGAAGG + Intergenic
954823555 3:53351567-53351589 TCTTACCTCCAGCCACTGGAAGG - Intergenic
956758416 3:72413650-72413672 AATTTCAGGCATCCACTGGGTGG + Intronic
959859665 3:111203230-111203252 TCCTACAAGCATCCAGTGGGAGG + Intronic
961140091 3:124548455-124548477 TCTTACAGCTATCAAATGGAAGG + Intronic
963508466 3:146217695-146217717 TCCTACAGGCCTCCAGTGTATGG + Intronic
964641972 3:158918119-158918141 TCTTACAGGACACCACTGGAAGG + Intergenic
966223416 3:177572608-177572630 TCTCAGATGCATCCCCTGGAGGG + Intergenic
966273492 3:178137092-178137114 TCTTACAGGAACCAACTGGAAGG - Intergenic
967140180 3:186551124-186551146 TCTTACATGCAGACACTGGTAGG - Exonic
968443618 4:636871-636893 TCTCACAGGTGTCCACTGGCTGG - Intronic
971400501 4:26271281-26271303 GATTTCAGGCATCCACTGGAGGG + Intronic
972735912 4:41841102-41841124 TCTTACAGGTAAGCACTGCAAGG + Intergenic
972822021 4:42712948-42712970 ACCTACAAGCATCCTCTGGAGGG + Intergenic
972964622 4:44494152-44494174 TCTTCCAGGGAACCACTAGATGG - Intergenic
974107760 4:57490049-57490071 TTTTACAGGCATCCAATGAAGGG + Intergenic
974429255 4:61774853-61774875 TGTTTCAGGCATCCACTGGGGGG + Intronic
974727205 4:65812457-65812479 TCCTAGAGGCCTCCACTGTATGG - Intergenic
977534652 4:98242929-98242951 GGTTTCAGGCATCCACTGGGGGG + Intergenic
982688356 4:158519959-158519981 TGCTACAGGCATCCAATGGGTGG + Intronic
984097611 4:175451270-175451292 TCTTTCTGGCAACCACTGAAGGG - Intergenic
986901217 5:12436323-12436345 GCTTACTGGCATCTAATGGATGG - Intergenic
990168433 5:53020024-53020046 TGTTTTAGGCATCTACTGGAGGG + Intronic
991229675 5:64317688-64317710 TGCTTCAGGCATCCACTGGGGGG - Intronic
994408498 5:99376740-99376762 TCTTACAGGGATCAATTAGATGG + Intergenic
994410515 5:99402270-99402292 GGTTTCAGGCATCCACTGGGGGG - Intergenic
994483310 5:100362999-100363021 GGTTTCAGGCATCCACTGGGGGG + Intergenic
997677443 5:135723649-135723671 GCTTACAGGCAGGCCCTGGAAGG - Intergenic
998080100 5:139267945-139267967 TCTCTCAGGCATCCACTTGATGG - Intronic
1009948971 6:70373198-70373220 TCTTAATGGCATCCTCTGTAGGG + Intergenic
1011428530 6:87257821-87257843 TCTTACTGTAAACCACTGGATGG + Exonic
1012473608 6:99597556-99597578 TATTACTGGCATCCAGTGGGTGG + Intergenic
1015469039 6:133582180-133582202 TCTTACATTCATGGACTGGAAGG + Intergenic
1017583540 6:155894475-155894497 TCCTACAGGCATCTACAGTAAGG + Intergenic
1017642235 6:156505463-156505485 TTTTACAGGCAGCCACTGTAAGG - Intergenic
1017980010 6:159393201-159393223 TCTTGCAGGTTTCCATTGGAAGG + Intergenic
1019846678 7:3509752-3509774 TCTTACAGAAATCCTCTGCAGGG - Intronic
1020761554 7:12273341-12273363 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1022022503 7:26414421-26414443 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1022410037 7:30132375-30132397 TGCTACAGGCATCCAGTGGGTGG + Intergenic
1022570414 7:31447489-31447511 TCTTACAGCCATCCACATCAAGG + Intergenic
1023244788 7:38190080-38190102 TGTTTCAGGCATCCCCTGGGGGG - Intronic
1027305781 7:76895128-76895150 TCTTACAGGCAGGGTCTGGACGG + Intergenic
1027772684 7:82427068-82427090 AGTTTCAGGCATCCACTGGGGGG + Intronic
1028248908 7:88516257-88516279 TTCTACTGGCATCCAATGGATGG - Intergenic
1029187838 7:98752333-98752355 ACTTACAGGTATGCACGGGAGGG + Intergenic
1030774806 7:113521145-113521167 AATTTCAGGCATCCACTGTAGGG - Intergenic
1031376306 7:121030790-121030812 AGTTTCAGGCATCCACTTGAGGG + Intronic
1032224610 7:130021239-130021261 GGTTACAGGATTCCACTGGAGGG - Intronic
1032918771 7:136522242-136522264 AGTTTCAGGCATCCACTGAAGGG - Intergenic
1041591692 8:59594120-59594142 GGTTTCAAGCATCCACTGGAGGG + Intergenic
1042355273 8:67820943-67820965 TCTGACAGGAGTCCACTGGAGGG + Intergenic
1042744330 8:72090311-72090333 AGTTTCAGGCATCCACTGGGGGG - Intronic
1044738733 8:95304318-95304340 TCTTAAATGGATCCCCTGGAGGG - Intergenic
1044981279 8:97719084-97719106 TTTTAGAGGTATTCACTGGAAGG - Exonic
1046600755 8:116314784-116314806 TTTTACAGGCTTCTAGTGGAAGG - Intergenic
1047055063 8:121154802-121154824 TTTGAGAGGCAGCCACTGGATGG + Intergenic
1049613338 8:143565965-143565987 TCTAACAGGCATGGAATGGATGG - Intergenic
1051387841 9:16529102-16529124 TCTTACACGGATACACAGGATGG + Intronic
1054988030 9:71285312-71285334 TCTCACTAGCATCCACTAGAGGG + Intronic
1056573167 9:87834061-87834083 TATTACAGGCATGCACGTGATGG + Intergenic
1057706282 9:97397318-97397340 TATAACAGGAAACCACTGGAAGG - Intergenic
1059149843 9:111939457-111939479 TATTACATGAATGCACTGGAGGG - Intergenic
1060260809 9:122072081-122072103 TCATGCAGGCCTACACTGGAAGG - Intronic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1192539197 X:71954089-71954111 TGTTACAGGCATTCCCTGGGGGG + Intergenic
1194681124 X:96854484-96854506 GGTTTCAGACATCCACTGGAGGG - Intronic
1194730517 X:97447859-97447881 TCTAACAGGCATGCTTTGGAGGG - Intronic
1195209011 X:102633435-102633457 TCTTACAGAAAGCCACTAGAAGG + Intergenic
1195335230 X:103847017-103847039 GGTTTCAGGCATCCACTGGGAGG + Intergenic
1195514486 X:105757692-105757714 TTTTAGATGCAACCACTGGAGGG + Intronic
1199006744 X:142708467-142708489 TGTTTCAGGTATCCACTGGGGGG - Intergenic
1200312195 X:155088824-155088846 TCTTACAGGAAGCCATTGTATGG - Intronic
1202088342 Y:21162675-21162697 TCTGACAGCCATGTACTGGAAGG + Intergenic