ID: 1096387419

View in Genome Browser
Species Human (GRCh38)
Location 12:51204101-51204123
Sequence GCTCCCCAGGGACCACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 364}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096387414_1096387419 -7 Left 1096387414 12:51204085-51204107 CCAGGGATTCATGCTGGCTCCCC 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364
1096387405_1096387419 12 Left 1096387405 12:51204066-51204088 CCCTAAAACCACCTGAGCCCCAG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364
1096387413_1096387419 -6 Left 1096387413 12:51204084-51204106 CCCAGGGATTCATGCTGGCTCCC 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364
1096387410_1096387419 1 Left 1096387410 12:51204077-51204099 CCTGAGCCCCAGGGATTCATGCT 0: 1
1: 0
2: 3
3: 13
4: 243
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364
1096387406_1096387419 11 Left 1096387406 12:51204067-51204089 CCTAAAACCACCTGAGCCCCAGG 0: 1
1: 0
2: 5
3: 21
4: 522
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364
1096387409_1096387419 4 Left 1096387409 12:51204074-51204096 CCACCTGAGCCCCAGGGATTCAT 0: 1
1: 0
2: 1
3: 25
4: 352
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364
1096387412_1096387419 -5 Left 1096387412 12:51204083-51204105 CCCCAGGGATTCATGCTGGCTCC 0: 1
1: 0
2: 1
3: 17
4: 183
Right 1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG 0: 1
1: 0
2: 4
3: 39
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096387419 Original CRISPR GCTCCCCAGGGACCACAGGA GGG Intronic
900230151 1:1552589-1552611 GCTCTCCATGGCCCTCAGGACGG + Intronic
900236498 1:1594136-1594158 TCTCCCCAGGTGCCCCAGGAGGG - Intergenic
900429362 1:2594577-2594599 CCTCCTCAGGGACCCCAGGAAGG - Intronic
900482827 1:2907630-2907652 ACTCACCTGGGACCACATGAGGG + Intergenic
901322418 1:8347950-8347972 GCTCCCCAGGGAGCTCAGCTTGG + Intergenic
901673698 1:10870351-10870373 GCTCTCCAGGGAACAGAGGTGGG - Intergenic
902220475 1:14961307-14961329 GCTCTCCTGGGCCCAGAGGAAGG + Intronic
902256552 1:15192983-15193005 GTCCCCCTGGGCCCACAGGAGGG + Intronic
902712014 1:18246937-18246959 GCTCTCCATGCACCACCGGAAGG + Intronic
904102462 1:28043448-28043470 GCTCCCAAAGTACCACAGGAAGG + Intronic
904616002 1:31750255-31750277 CTTCCTCAGGGACCACAGGAGGG - Intronic
905022634 1:34828307-34828329 GCCCCACAGGGAGCACTGGAAGG + Intronic
905260096 1:36711059-36711081 TCTCCCCAGGGAAGAAAGGATGG - Intergenic
905456840 1:38094283-38094305 CCTCCCCAAGGGGCACAGGAAGG - Intergenic
905462154 1:38129028-38129050 GCCTCACAGGGACCAGAGGACGG - Intergenic
905492452 1:38355128-38355150 GCTTCCCATGGCCCACAAGATGG - Intergenic
905865723 1:41375581-41375603 GCTACAGAGGGCCCACAGGATGG - Intronic
906011136 1:42527768-42527790 CCTTCCCAGACACCACAGGAAGG - Intronic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907321653 1:53606431-53606453 GCACCCCAGGAATCACAGGCAGG + Intronic
907418861 1:54333066-54333088 GGTCCCTGCGGACCACAGGAGGG - Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
912414841 1:109500956-109500978 GCTTCCCAGGGTCCACAGCCTGG + Intronic
913112186 1:115666601-115666623 GCTCCCCAGGGAGAACTGAAAGG + Intronic
913442930 1:118918254-118918276 ACTCCCCCCGGACCACAGGTAGG + Intronic
915561202 1:156689333-156689355 GCTCCCCAGAGAGGACAGAAGGG - Intergenic
916023324 1:160813616-160813638 GCTCTGCAGGGACAACAGCATGG - Exonic
917352217 1:174090078-174090100 GCTCTCCAAGGCCCACAGGCTGG + Intergenic
917883908 1:179365240-179365262 CCTCCCGAGGGACTACAGGCGGG - Intergenic
918540377 1:185625696-185625718 GCAGCCCATGGACCACAGGTTGG - Intergenic
920693416 1:208163978-208164000 TCCCCCCATGGAGCACAGGAAGG + Intronic
922067520 1:222158513-222158535 TCTCCCAAGGGACCAAGGGAAGG + Intergenic
922897892 1:229114676-229114698 GCACCCGAGGGGCCACAGGCAGG + Intergenic
924099982 1:240593244-240593266 GCTCCCCATGCATGACAGGAAGG + Intronic
924546396 1:245031699-245031721 GCTCCACAGGGACCCAAGGAAGG + Intronic
1062909062 10:1200250-1200272 GCTCCCCAAGGTCCGCACGATGG - Intronic
1063670416 10:8095540-8095562 ATTCCCCAGGGAACACAGCAGGG + Intergenic
1064285311 10:13986132-13986154 GACACCCTGGGACCACAGGAAGG - Intronic
1064365158 10:14700926-14700948 GCACCCCAGGGGCCACATGTGGG - Intronic
1067089466 10:43259248-43259270 GCACCCCAGGGACCAGCTGAGGG + Intronic
1067439431 10:46300340-46300362 GGTCTCCAGGGAGCCCAGGAAGG + Intronic
1067939135 10:50638024-50638046 GCTATCCAAGGACAACAGGAGGG - Intergenic
1067973800 10:51001213-51001235 GCTCCCCAGGGAACCCAGACTGG - Intronic
1069594120 10:69659563-69659585 CCTCCTCAGGGACAGCAGGAAGG + Intergenic
1069759297 10:70797791-70797813 GCTCTCCAAGGCCCACAGGCTGG + Intergenic
1070725007 10:78781787-78781809 TCTCCACAGGCTCCACAGGATGG - Intergenic
1070739605 10:78894158-78894180 GCTGCAGAGGGACAACAGGAAGG - Intergenic
1075330810 10:121572726-121572748 GCTCCCAAGGAATAACAGGATGG - Intronic
1075676758 10:124301235-124301257 GCTCCCCTAGGACCAGAGGAAGG - Intergenic
1076246282 10:128950046-128950068 GCTATAGAGGGACCACAGGAAGG + Intergenic
1076752627 10:132551248-132551270 GAGTGCCAGGGACCACAGGAAGG - Intronic
1076813145 10:132899433-132899455 CCTCCCTTGGGCCCACAGGATGG + Intronic
1076904627 10:133355876-133355898 ACTCCCCAGGGCCCAAAGCAGGG + Intronic
1077252337 11:1566182-1566204 GAACCCCAGGGCCCACAGGAAGG - Intronic
1077463827 11:2724066-2724088 GGCCCCCAGGCACCACCGGAGGG - Intronic
1078185527 11:9048905-9048927 GGTCAACAGGGGCCACAGGAAGG + Intronic
1078436886 11:11332742-11332764 GCTGACCAGGTACCACCGGAAGG + Exonic
1079391067 11:20022750-20022772 ACTCCCCTGGGACCACATGGAGG + Intronic
1081646844 11:44796022-44796044 GCAACGGAGGGACCACAGGAAGG - Intronic
1081667704 11:44926258-44926280 GATCCCCAGGGACCACCTGTTGG + Intronic
1081839040 11:46182573-46182595 GCTCCTCAAGGACTAGAGGAGGG - Intergenic
1083179343 11:60974225-60974247 TCTGCCCTGGGACCACAGGCAGG + Intronic
1083281150 11:61628072-61628094 GCTCCCCAGGGGCCTGAGGAGGG + Intergenic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1083506580 11:63163508-63163530 GCTCCCCAGGGATGAGAAGATGG + Intronic
1083769776 11:64860113-64860135 CTTGCCCAGGGACCACATGAGGG + Exonic
1084148570 11:67277695-67277717 GCTCGGCAGGCGCCACAGGAAGG - Intronic
1084461116 11:69297208-69297230 GCTCCTCAGGAAGCACAGCAGGG - Exonic
1084926824 11:72520559-72520581 GCTGCCCAGAGCCCACAGCATGG - Intergenic
1085475043 11:76784034-76784056 GCTGTCCTGGGACCTCAGGAGGG - Intronic
1085939044 11:81186282-81186304 AGTCTCCAGGGATCACAGGAGGG + Intergenic
1086584017 11:88431649-88431671 ACTCCCCTCGGACCACAGCATGG - Intergenic
1087770626 11:102205946-102205968 GCTCCCCAGAGCCCACAGGGAGG + Exonic
1088688569 11:112305408-112305430 GCTCCCCAGTCACCAGAGGGTGG - Intergenic
1090266601 11:125357095-125357117 ACACCCCAGGGACCATATGAGGG + Intronic
1090274198 11:125408351-125408373 GCTCCCACGGGGCCCCAGGAAGG + Intronic
1090872525 11:130761004-130761026 GCTGCCCAGGGCCCTCAGGCTGG - Intergenic
1090959871 11:131546742-131546764 GCTGCCCAGTGACCCTAGGAGGG + Intronic
1091229091 11:133976245-133976267 GCCCCCCAGGGACTCCAGGCTGG - Intergenic
1091259070 11:134219435-134219457 CCTCCCCAGGGACCTCAGGGAGG - Intronic
1091275367 11:134346112-134346134 GCTCCCCAGGGACCAGGGGAGGG - Intronic
1091969979 12:4779085-4779107 TTTCCCCAGGGATCAGAGGAAGG - Intronic
1093465173 12:19440619-19440641 GCTCCTCACGGACCTCAGGACGG + Intronic
1094809619 12:34124562-34124584 GCTCCCCGGGGCCTAAAGGATGG + Intergenic
1094831939 12:34304294-34304316 GATCCCCAGGGCCCACCGCAGGG - Intergenic
1095094418 12:38138203-38138225 GGTCCCCAGGGGCAACAGGAGGG - Intergenic
1096100212 12:48966269-48966291 GCTCCCCAGGGACAAGGGGCCGG - Exonic
1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG + Intronic
1096594753 12:52687768-52687790 GCTTCCGTGGGACCACAGGAAGG - Intergenic
1096880152 12:54660746-54660768 GCTACCAAGGGACAACAGGCAGG - Intergenic
1099115522 12:78619641-78619663 ACTGCCCAGGGCCCAAAGGAAGG - Intergenic
1101542487 12:105677462-105677484 GCTTCCCAGGGACCATATAAAGG + Intergenic
1102446572 12:113007628-113007650 GCCGCACAGGGACCACAGCAAGG - Intronic
1102623269 12:114214020-114214042 GCTCACCAAGGACAACATGATGG + Intergenic
1102980383 12:117236583-117236605 GCTCCCCAGGAACCAAAGACTGG - Intronic
1103030285 12:117606995-117607017 ACTCCCCAGGGACTCCAGGGAGG - Intronic
1103937245 12:124483207-124483229 GCTGCCCACCGACCACAGGACGG + Intronic
1104376454 12:128268045-128268067 GCTCACCAGGGACCCCAGCTTGG + Intronic
1104612996 12:130244777-130244799 GCTCACCAGGAAACACAGAATGG - Intergenic
1104758341 12:131282582-131282604 CCTCCCCAGAGCCCACAGGCTGG - Intergenic
1105278606 13:18950254-18950276 CCTCTCCAGGGACCTCGGGAGGG + Intergenic
1106620161 13:31364904-31364926 GCTCCCCCAGGAGCACAGGGAGG - Intergenic
1107155539 13:37163042-37163064 GCTGCCCATGGGCCACAGGTTGG - Intergenic
1107305537 13:39014294-39014316 CCTGCCCTGGGAACACAGGAAGG + Exonic
1107662147 13:42649830-42649852 ACTCCCCAGCCACAACAGGAGGG + Intergenic
1108707844 13:53006278-53006300 GCTCCCCAGGTAGGGCAGGATGG + Intergenic
1109241118 13:59889876-59889898 ACTCCCCAGGGAAAACAGGTTGG - Intronic
1109361510 13:61299724-61299746 GCTCTCCAAGGCCCACAGGCTGG - Intergenic
1113464275 13:110503202-110503224 GAACCCCAGGGACCAAAGGATGG + Exonic
1113800959 13:113085999-113086021 GCTCCCCACAGACCAGGGGAGGG + Intronic
1113820421 13:113209204-113209226 GCGCCCCGGGGCCCTCAGGAGGG + Intronic
1113826771 13:113261529-113261551 GCTTCCCAGGGCCCTGAGGACGG - Intronic
1113898538 13:113782746-113782768 TGTCCCCAGAGACCACAGGTTGG + Intronic
1117190898 14:53290135-53290157 GCTGCCCAGAGACCACAGCTAGG - Intergenic
1117591072 14:57268778-57268800 GCTCCCCACAGATCCCAGGAGGG + Exonic
1118737811 14:68714681-68714703 GCTACCCAGGGAGCTGAGGAGGG + Intronic
1118760682 14:68878867-68878889 GAGCCCCATGGCCCACAGGAGGG + Intronic
1121112921 14:91324598-91324620 TCTCCCCAGGGAAGACACGAGGG - Intronic
1121733462 14:96202347-96202369 GTTCAGCAAGGACCACAGGAGGG - Intergenic
1121996600 14:98607774-98607796 GCTCCTGAGGGACTCCAGGAAGG + Intergenic
1122264040 14:100538505-100538527 GCTCCCCGGGGAGGACATGAGGG - Exonic
1122849597 14:104520506-104520528 GCCCCTCAGGGACCACAGCTGGG - Intronic
1124120264 15:26882919-26882941 GCTCCCCAGGGAGCAGAAGGAGG + Intronic
1124403913 15:29377294-29377316 GTTTCCCAGGGACCACAAAATGG - Intronic
1124937445 15:34186419-34186441 GCTCCCCAAAGAGCACAGGGAGG - Intronic
1126108695 15:45163210-45163232 CCTGACCAGGGACCACTGGAGGG + Intronic
1127279303 15:57475271-57475293 GCTCACCAGGGACAACAGTGAGG - Intronic
1127849714 15:62902040-62902062 GCTCCTCAGGGCCCTGAGGAGGG + Intergenic
1128147036 15:65337564-65337586 GATCCCCAGGGAGCACTGGGAGG + Intronic
1128345404 15:66849827-66849849 GCTCCCCAGGAGCCACAGTCTGG + Intergenic
1129326489 15:74802678-74802700 GCTCCCCAGGCCCCACAGGTGGG - Exonic
1129669009 15:77596776-77596798 CCTCCCCAGGAACCAGAGAAGGG + Intergenic
1130088963 15:80803215-80803237 CCTCCCTTGGGGCCACAGGATGG + Intronic
1130546112 15:84858346-84858368 GGTCCCCAGGGACTCCAGGGCGG + Exonic
1130562461 15:84969347-84969369 GCTTGCCAGGGCCCACATGAAGG - Intergenic
1130898846 15:88192044-88192066 CCACCCCTGGGACCACAGAAAGG + Intronic
1132576911 16:668448-668470 GCTCACCAGGGACCCCCGGCTGG - Intronic
1132851250 16:2026031-2026053 GCTCCACAGTGTCCACAGGCAGG - Intronic
1133315889 16:4883804-4883826 CCTCTCCAGGGACCACAGTCTGG + Exonic
1134678827 16:16109662-16109684 GCTCCACAGGGAATATAGGAGGG + Intronic
1137600448 16:49752542-49752564 ACTGTCTAGGGACCACAGGAGGG + Intronic
1138717991 16:59046318-59046340 GCTCCAGTGGGACCAAAGGACGG + Intergenic
1138915171 16:61455227-61455249 GCTGCCTGGGGACCACATGATGG + Intergenic
1139605616 16:68016065-68016087 AAGCCCCAGTGACCACAGGAGGG + Intronic
1139752974 16:69120325-69120347 GGTTCCCTGGGACCACAGGGGGG - Exonic
1141626574 16:85264566-85264588 GACCCCCAGGGACGAGAGGAAGG + Intergenic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1141994962 16:87630438-87630460 GCTCCCCAGGGAGGACTGGCTGG - Intronic
1142066939 16:88068151-88068173 GCTCTGCAGGGGCCACAGGTGGG - Intronic
1142648206 17:1328997-1329019 ACCCCACAGGGACCACTGGAAGG + Intergenic
1143183763 17:4998781-4998803 GGTCCACTGGGGCCACAGGAGGG + Intronic
1143575821 17:7792533-7792555 GATCCCCAGGCCCCACAGGAGGG + Intronic
1144040645 17:11407786-11407808 CATCCCCAGAGAGCACAGGAGGG - Intronic
1144274459 17:13652309-13652331 GCAGCCCAGGGACCACAGTTTGG + Intergenic
1144284556 17:13761004-13761026 GATGCCCAGGGACAGCAGGAGGG + Intergenic
1147313812 17:39609521-39609543 GCTCCCCAGGGACCTTGGGCTGG + Intronic
1147339879 17:39746957-39746979 GCGCCCCAGAGTCCACTGGATGG - Exonic
1147937908 17:44024170-44024192 GCCCCCCAGGCGCCACAGGCTGG + Intergenic
1148139182 17:45316602-45316624 GCGCCCCAGTGCCCCCAGGATGG - Intronic
1148332844 17:46822240-46822262 GCTCCCTAGAGGCCACTGGAAGG + Intronic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1150227820 17:63533395-63533417 GATCCCCAGGGCCCTCAGAAAGG + Intronic
1150484719 17:65535917-65535939 GCCCCCCTGGGAGCCCAGGATGG + Intronic
1151383986 17:73744087-73744109 GCACCCCAGGAGCCACAGGTGGG - Intergenic
1151871799 17:76841659-76841681 GCCACCCAGGGGCCACAGCATGG - Intergenic
1152202060 17:78952885-78952907 GCTCACCACTGACCACATGATGG - Intergenic
1152310991 17:79549647-79549669 CTTCCCCAGTGCCCACAGGAAGG - Intergenic
1152689938 17:81713367-81713389 GCTGCCCAGTGACCACAGCCAGG - Intronic
1152700988 17:81819748-81819770 GCTCTGCAGGGGCCACAGGGTGG - Intergenic
1152783403 17:82236328-82236350 GCTCCCCAGGGAACCCTGGAGGG + Intronic
1154383423 18:13872310-13872332 GATCCTCAGGGAACACGGGACGG + Intergenic
1154387755 18:13911049-13911071 GCTCAGCAGGGAACACAGGCAGG + Intronic
1156653762 18:39258474-39258496 GCTCTCCAAGGTCCACAGGCTGG - Intergenic
1157302049 18:46486136-46486158 ACTCCCCAGGGACCAGACCAGGG + Intronic
1157822637 18:50784938-50784960 GCTGCTCAGTGACCAGAGGAGGG - Intergenic
1159489901 18:69118711-69118733 ACACTCCAGGGACTACAGGAGGG - Intergenic
1160328574 18:77971692-77971714 GGTCACCAGGTACAACAGGAGGG + Intergenic
1160576416 18:79856831-79856853 CCTCCCCAGGGCTCACAAGACGG - Intergenic
1160776930 19:860852-860874 GGTCCCCAGGGCCGACGGGAAGG + Exonic
1160836384 19:1126655-1126677 GCTCTCCCGGGCCCTCAGGAAGG - Intronic
1161784075 19:6312205-6312227 ACTGCCCAGGAGCCACAGGATGG + Exonic
1162544700 19:11321704-11321726 GGGCCCCGGGGGCCACAGGAAGG + Intronic
1163603374 19:18261577-18261599 ACTCCCCAGTGACCACAGATGGG + Intronic
1163603402 19:18261694-18261716 ACTCCCCAGTGACCACAGATGGG + Intronic
1164705550 19:30316916-30316938 GCTCCTCAGGGTCCACAGCCAGG - Intronic
1164754844 19:30681788-30681810 GCTACCCAGAGACCAGAGGGTGG - Intronic
1164986320 19:32651348-32651370 GCTTCCCAGAGGCCACATGAAGG - Intronic
1165596870 19:37016464-37016486 GCACAACTGGGACCACAGGAGGG - Intronic
1165657779 19:37549162-37549184 GCGCCCCGGGGAACACAGGCAGG - Intergenic
1165716591 19:38049771-38049793 GTTCCCCCGAGAGCACAGGAGGG + Intronic
1166283987 19:41812208-41812230 ACTCCCCAGGGCCCTCAGGAGGG - Intergenic
1166354792 19:42220532-42220554 GAGCCCCAGGGCACACAGGAAGG - Intronic
1166931346 19:46303507-46303529 GCTGGCCAGGGGCCAGAGGAGGG - Intronic
1167154574 19:47730247-47730269 GCTCCGTAGGGACCAAAGGAGGG - Intronic
1167249748 19:48393595-48393617 GGTCCCCAGGGAGGCCAGGAGGG + Intergenic
1167792510 19:51690582-51690604 GCTCCCCAGGGTCCGCAGAGAGG + Intergenic
1168037942 19:53735246-53735268 GCTCCTCAGGAAGCTCAGGAAGG - Intergenic
1168078763 19:53994151-53994173 TCTCCCCAGGGCTCACAGGATGG - Intronic
1168129766 19:54310811-54310833 TCTCTCCAGGGACCACAACAGGG + Intronic
1168156901 19:54478851-54478873 TCTCCACTGGGACCACAAGAGGG + Intergenic
926109397 2:10172354-10172376 GCTCCGGAGGGACCAGGGGAGGG + Intronic
926987398 2:18639638-18639660 GCTCACCAAGGCCCACAGGCTGG + Intergenic
927575910 2:24201636-24201658 GCAGCCCTGGGAACACAGGACGG + Intergenic
927640377 2:24841880-24841902 GGTCCCCAGGCACCACAGGGAGG - Intronic
927697028 2:25245790-25245812 ACTCCCCAGTGGCCACAGAAGGG - Intronic
927873736 2:26640610-26640632 ACTCCCCAGGGGCCACAGCAGGG - Intronic
928342877 2:30460767-30460789 CCTCCCCAGAGACCAGGGGATGG - Intronic
928436908 2:31260711-31260733 CTTCCCCAAGGACCACATGAGGG - Exonic
929401108 2:41582562-41582584 GCTCTCCAAGGCCCACAGGCTGG - Intergenic
929788563 2:45008498-45008520 GCTCCCCGGGGCCCAAGGGAGGG - Intronic
932285063 2:70524953-70524975 GCTCACCTGGGCCCAGAGGATGG - Intronic
933632255 2:84671666-84671688 GCTTCCAGGGGGCCACAGGATGG + Intronic
935359519 2:102235662-102235684 GCTGTCGGGGGACCACAGGAGGG + Intronic
936012320 2:108932915-108932937 GCTCCCCAGGGATCTCTGGAAGG - Intronic
937684867 2:124684475-124684497 GCTCTCCAGGGAGAAAAGGATGG - Intronic
938070509 2:128305849-128305871 GCTCGCCAGGGAGTCCAGGATGG - Intronic
938079702 2:128363170-128363192 GCTCCACAGGGGACTCAGGAAGG + Intergenic
938135874 2:128755991-128756013 TCTCCCCACAGCCCACAGGATGG - Intergenic
938199808 2:129363383-129363405 GCTCCCCAGAGCCCTCTGGATGG + Intergenic
938320099 2:130356582-130356604 TGTCCCCTGTGACCACAGGAAGG + Intronic
940124640 2:150310072-150310094 GCTCTCCAAGGCCCACAGGCTGG - Intergenic
941443179 2:165564079-165564101 GCTTCCCAGGTACCACAAGGGGG - Intronic
945828733 2:214757108-214757130 GCTCCCCAGGCTATACAGGAAGG - Intronic
946187837 2:217991168-217991190 GCCCCTCAGGGTCCAGAGGAGGG + Intronic
946441924 2:219704065-219704087 CCTTCCCAGGGACCAAAGAAAGG + Intergenic
947172497 2:227325409-227325431 TCACCCCTGGGCCCACAGGAGGG - Exonic
947876318 2:233470347-233470369 GCTCCCTGGGAACCACAGAATGG - Exonic
948270966 2:236672872-236672894 GCTCCCCTGTGACCTGAGGACGG + Intergenic
948801922 2:240436917-240436939 GCTCCTCCGGGACCACAGGGAGG - Intronic
948845613 2:240681542-240681564 GTGCTCCAGGCACCACAGGAAGG - Intronic
948848242 2:240693188-240693210 GTGCTCCAGGCACCACAGGAAGG + Intronic
1169186034 20:3618017-3618039 GCTTCCCAGGCCCCACAGGGAGG - Intronic
1169305326 20:4484866-4484888 GCTCCCCAGGGACCATAGGCGGG - Intergenic
1173009387 20:39168017-39168039 GCTGCACAGGCACCAAAGGAAGG + Intergenic
1173124811 20:40326890-40326912 GATCTCCGGGGACCCCAGGATGG - Intergenic
1173328506 20:42054824-42054846 GCTGCCCAGAGTCCACAAGAAGG - Intergenic
1173329490 20:42062575-42062597 AATCCCCAGAGGCCACAGGAGGG - Intergenic
1174156915 20:48521638-48521660 GCTGCCCTTGGACCTCAGGATGG + Intergenic
1174803108 20:53581629-53581651 GCACTCCAGGGTCCACAAGAAGG - Exonic
1174864601 20:54123608-54123630 GCTCAACAGGGACCTCATGAAGG + Intergenic
1176127946 20:63484279-63484301 GCTCCCTGGGGTCCAGAGGAGGG - Intergenic
1176871247 21:14084549-14084571 GGTCCCCGGGGGCAACAGGAGGG + Intergenic
1177117706 21:17105512-17105534 GCTCTTCAGGGCCCACAGGCTGG - Intergenic
1178958489 21:37043823-37043845 GCTTCCCAGGGACAGCAGGCGGG + Intergenic
1179710532 21:43210627-43210649 CCTCCCCAGGTGTCACAGGAGGG + Intergenic
1179821654 21:43940504-43940526 GCTGCCCAAGGACCCCAGGAGGG - Intronic
1179933873 21:44590654-44590676 TCTCCCCAGGGGTAACAGGAGGG + Intronic
1179941022 21:44638886-44638908 TCTCCCCAGGGGTAACAGGAGGG - Intronic
1179999275 21:44987740-44987762 CCATCCCAGGGACCGCAGGAAGG - Intergenic
1180103549 21:45601735-45601757 GGTCCCCAGGGCCCACAGCAAGG + Intergenic
1181007898 22:20022777-20022799 GCTTCTCAGGGACCCCAGAAGGG + Intronic
1181171597 22:21013028-21013050 GGGCCCCAGGTACCACTGGAAGG - Intronic
1181177759 22:21047490-21047512 GGGCCCCAGGTACCACTGGAGGG + Exonic
1181475854 22:23167385-23167407 GCTCCACAGGGACCGGAGCAAGG + Intergenic
1181522713 22:23458758-23458780 CCTCCCCAGGAGCCACAGGGCGG - Intergenic
1182355987 22:29722415-29722437 GCTCCCCAGGGCCCAGGAGAAGG - Intronic
1182900896 22:33897412-33897434 GCTACTTTGGGACCACAGGAAGG - Intronic
1183354903 22:37353011-37353033 CCTACACAGAGACCACAGGAAGG + Intergenic
1183439462 22:37815259-37815281 GCTTCCTGGGGCCCACAGGACGG + Exonic
1183538988 22:38418819-38418841 GGTGCTCAGGGACCCCAGGATGG - Intergenic
1183545277 22:38452144-38452166 GCTCTCCTGGGCCCAGAGGAGGG - Intronic
1183650270 22:39149608-39149630 TTTCCCCCTGGACCACAGGAGGG - Intronic
1184274700 22:43403769-43403791 GCTCCCTGGGGAACCCAGGAGGG + Intergenic
1184779166 22:46637743-46637765 GGTGCCCAGGGGCCCCAGGATGG - Intronic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
950095721 3:10329154-10329176 ACTGCCCAGGGACCACAGCCAGG + Intronic
950152463 3:10698259-10698281 GCACCCCAGGGACAAAAGGCAGG - Intronic
950719373 3:14871682-14871704 GCCCCCCAAGGACCTCAGCAAGG - Intronic
950788471 3:15454349-15454371 GCTCCCCAGGGACACAAGGCTGG - Intronic
950792949 3:15487835-15487857 GCACCTCTGGGTCCACAGGAGGG + Intronic
952465726 3:33583411-33583433 GTTCCCTAGGGACCACTTGAAGG - Intronic
952883760 3:38000771-38000793 GCTCCCCAGGGACAACTGTCAGG + Intronic
953713321 3:45293751-45293773 ACACAACAGGGACCACAGGAGGG + Intergenic
954929753 3:54271309-54271331 GCTCAGCAGGGAACAGAGGATGG - Intronic
955404489 3:58617395-58617417 GCTCCTCAGGAAGCTCAGGACGG - Intronic
961112031 3:124292501-124292523 GCCACCCAGGGACAGCAGGAAGG + Intronic
961628899 3:128282087-128282109 GCCCACCAGGGCCCAGAGGAGGG + Intronic
962209422 3:133464721-133464743 GCCTCACAGTGACCACAGGAGGG + Intronic
966879022 3:184339204-184339226 TCTCCCGAGGGAGCTCAGGATGG - Intronic
967747901 3:193080769-193080791 GGACCCCTGGTACCACAGGAAGG - Intergenic
968704147 4:2070211-2070233 GCTGCCCAGGGAACGCAGGCAGG + Intergenic
968919408 4:3514978-3515000 GTTCACCCGGGACCACAAGATGG - Intronic
968955159 4:3715357-3715379 GCCCCCCACTGACCCCAGGAAGG - Intergenic
969345044 4:6564744-6564766 GCTCTCCAGGGAGCAGAAGAAGG + Intergenic
969470601 4:7385379-7385401 CTTCCTCAGGGACCACAGGATGG + Intronic
969537848 4:7767693-7767715 GCACCCCAGAGAGCACAGCAGGG + Intronic
971405899 4:26320750-26320772 GCTCCCCATGGACCACACGGAGG + Exonic
980649783 4:135697411-135697433 ACTCCACAGGCACCACAGGTAGG + Intergenic
981344389 4:143658617-143658639 GCCGCCCAGGGGCCACAGGTTGG - Intronic
984051154 4:174866874-174866896 GGTCCCCAGGGACCACTCTATGG - Intronic
984553821 4:181191003-181191025 GCTCTCCAATGATCACAGGAAGG - Intergenic
985420552 4:189781192-189781214 GAGCCCCAGGGACCTCAGGGAGG + Intergenic
985836762 5:2277421-2277443 CAGCCTCAGGGACCACAGGAAGG - Intergenic
986293296 5:6417500-6417522 CCTTCCCAGGGACCACAGGAAGG + Intergenic
986944633 5:13000948-13000970 GCTCCCCAGGAGCAAGAGGATGG + Intergenic
987415977 5:17662771-17662793 GCTCTCCAAGGCCCACAGGCTGG + Intergenic
987647737 5:20697210-20697232 GCTCATAAGGGACCACGGGAAGG - Intergenic
987970308 5:24934661-24934683 GCTACCCATGGGCCACAGGTTGG - Intergenic
988337282 5:29922900-29922922 GCTCCCCAGTTCCCACAGGAAGG + Intergenic
989480601 5:41925725-41925747 GGTCCCCAGGGGCCCCATGAAGG - Intronic
990075318 5:51838868-51838890 GGACCCCAGGGACCACCGTAAGG + Intergenic
992000824 5:72434614-72434636 GGTCCCCAGGGACCCCATAAGGG + Intergenic
992610461 5:78504204-78504226 GCTCACCAGGAACAAAAGGAAGG + Intronic
995931462 5:117451524-117451546 GCTCCCTTGGGGCCACAGAAAGG + Intergenic
996778591 5:127159670-127159692 GCTCTCCAAGGCCCACAGGCTGG + Intergenic
997052852 5:130403075-130403097 ACAAACCAGGGACCACAGGAGGG - Intergenic
997829876 5:137140566-137140588 GCTCCCCAGGTAAGGCAGGAAGG - Exonic
998818181 5:146034338-146034360 CCTCTCCAGGCACCACAGGCTGG + Intronic
999459567 5:151746293-151746315 GGTCCCCACAGCCCACAGGATGG - Exonic
999590752 5:153143100-153143122 GCTGCCTAGAGACCACATGATGG + Intergenic
999666213 5:153916459-153916481 GCTCTCCAAGGCCCACAGGCTGG + Intergenic
1001766540 5:174252294-174252316 GCTCCCCAGGGCCTACAACAGGG + Intergenic
1002052195 5:176577412-176577434 GCCCCCCAGCGACAACAGGAAGG - Exonic
1002212852 5:177608824-177608846 GCTCCCGAGGTCCCACAGGAAGG - Intronic
1003307914 6:4946002-4946024 GCTGCCCAGCGCCCACAGGCGGG + Intronic
1004696790 6:18041705-18041727 GCTCCCCAGGTATCAAAGAAGGG + Intergenic
1005266034 6:24113103-24113125 GCCCCCCCTGGACCGCAGGATGG - Intergenic
1007394892 6:41571893-41571915 ACTCCTCAGGGACCAGAGGGTGG - Intronic
1007727692 6:43926506-43926528 GAGCCCCAAGGACCACAGGCTGG - Intergenic
1010812257 6:80314394-80314416 GCTGCCCAAGGTCCACAGGCTGG + Intronic
1013340838 6:109213965-109213987 GCTCCCCAGGGACCAATGACTGG - Intergenic
1015933560 6:138386031-138386053 GCTCCTCAGGGACCTGAGGCAGG - Intergenic
1016423745 6:143912812-143912834 GCTCTCCAAGGCCCACAGGCTGG + Intronic
1017665753 6:156719141-156719163 GCTCCGCAAGGATCACAGGTGGG + Intergenic
1017775177 6:157675106-157675128 GCTCCCCAGAGGCCCCAGGAAGG + Exonic
1018743444 6:166747196-166747218 TCACCCCAGAGACCACAGGCAGG - Intronic
1019495987 7:1340940-1340962 TGTGCTCAGGGACCACAGGACGG - Intergenic
1019588612 7:1817779-1817801 CCTCCCCAGGAGCCACAGGGCGG + Intronic
1019592794 7:1844186-1844208 GCTCCCCGGGGACCTGACGAGGG + Intronic
1019622161 7:1997867-1997889 GCTCCCGAGGGACGAGAGGAGGG - Intronic
1020002864 7:4765551-4765573 CCTCCCCAGTGACCCCAGAACGG - Exonic
1021111546 7:16700038-16700060 TGGCCCCAGGGAACACAGGAAGG + Intronic
1021561521 7:21972534-21972556 GCTCCCCCAGGAGCACAGGGAGG + Intergenic
1022216143 7:28263597-28263619 GTTCCCAAGAAACCACAGGAAGG - Intergenic
1022538267 7:31111721-31111743 GCTCCCAAGGTACAATAGGAAGG - Intergenic
1022737721 7:33091739-33091761 GCTCCCCAAGGAACAGATGATGG + Intergenic
1022963629 7:35453730-35453752 GCTCCCCAGGGTCATTAGGAGGG - Intergenic
1023885273 7:44349617-44349639 GGTCCCCAGGTGGCACAGGAGGG - Intergenic
1025201224 7:56963018-56963040 GCTCCCCAGGGCACTCAGCAGGG - Intergenic
1025670720 7:63613915-63613937 GCTCCCCAGGGCACTCAGCAGGG + Intergenic
1025810389 7:64871893-64871915 GCTCACCTGGGAGCACCGGAGGG - Intronic
1026470575 7:70691704-70691726 GCTCCCCAGGGTCCCCTGGCTGG - Intronic
1028248828 7:88515439-88515461 GCTTCCCATGGACCAGATGAGGG - Intergenic
1029205880 7:98869365-98869387 GTCCCCCAGGGAGCACGGGATGG - Intronic
1030089326 7:105843500-105843522 GCTGCCCCTGTACCACAGGAGGG - Intronic
1030438255 7:109552485-109552507 GCTCTCCAAGGCCCACAGGCTGG - Intergenic
1031381700 7:121093812-121093834 GCTCCCCAGGGCCGACAAAATGG - Intronic
1032481072 7:132247698-132247720 GCTGGCCAGGGACCACATAAAGG + Intronic
1032487437 7:132298377-132298399 GCTCACCAAGGGCCTCAGGATGG + Intronic
1033423457 7:141222596-141222618 GCTCCCATGGGACCTCAGTATGG - Intronic
1033977136 7:147116394-147116416 GCTCTCCAAGGCCCACAGGCTGG + Intronic
1034066708 7:148143975-148143997 CCTACCCAAGGCCCACAGGATGG - Intronic
1034410556 7:150939309-150939331 GCTCCCCCAGGGCCAGAGGATGG + Intergenic
1035377272 7:158413738-158413760 GCTCCCCAGCACCCGCAGGATGG - Intronic
1035730974 8:1853319-1853341 GCTCCACAGGGACCAACGGGCGG + Intronic
1035755634 8:2029053-2029075 GCTCCCCAGGGACCCCAAAGAGG - Intergenic
1036654037 8:10664064-10664086 TCTCTCCAGGGACCCCGGGATGG + Intronic
1036665151 8:10732804-10732826 CCTCCCCAGGGAACACGGAATGG + Intronic
1037689246 8:21168895-21168917 GCTGTCCAGGGCCCACAGGAAGG + Intergenic
1037742140 8:21616391-21616413 GACCCCCAGGGGCCACAGGGAGG + Intergenic
1039793810 8:40895857-40895879 GACCCCCAGGGAGCCCAGGAGGG - Intronic
1040110079 8:43563348-43563370 GCTTCCCAGGGACCAATGCAGGG + Intergenic
1040280583 8:46039853-46039875 GGTCCCCGGGGGCAACAGGAGGG + Intergenic
1040593601 8:48818077-48818099 GCTTCTCAGTGAACACAGGAAGG + Intergenic
1043324632 8:79034487-79034509 GCTCTCCAAGGACCACAGGTTGG - Intergenic
1043645744 8:82516515-82516537 GCTCCCCAAGAACCACCAGAAGG - Intergenic
1043737795 8:83768999-83769021 GAGCCCCAGTGAGCACAGGAAGG - Intergenic
1047305182 8:123646927-123646949 GCTCCCCAAGCACCACTGCAGGG + Exonic
1048003356 8:130397796-130397818 GATGCCCTGGGGCCACAGGAGGG - Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049021692 8:139961525-139961547 GCTCCCCTGAGAGCACAGGGAGG - Intronic
1049247503 8:141570605-141570627 GCTGCACAGGGTGCACAGGAGGG + Intergenic
1049300537 8:141867220-141867242 TCTCTCCAGGGACCAGAGGGTGG + Intergenic
1049360190 8:142209068-142209090 GCTCCCTAGGTTCCAGAGGAGGG - Intergenic
1049510669 8:143025285-143025307 ACCCTCCAGGGACCACAGGATGG + Intergenic
1049511406 8:143028556-143028578 ACCCTCCAGGGACCACAGGATGG + Intergenic
1049576952 8:143393930-143393952 GCTCCCCAGGGGGCTGAGGACGG - Intergenic
1049680494 8:143915862-143915884 GCTACCCTGGGAAGACAGGAGGG + Exonic
1049684134 8:143932526-143932548 GCTCTCCAGGGACCTGAGGCGGG + Exonic
1049758449 8:144321102-144321124 GCACCCAAGTGACCACAGCAGGG + Intronic
1050441224 9:5666000-5666022 GCTCTCCAGGACCCACAGGCTGG + Intronic
1051665558 9:19464674-19464696 TGTCCGCTGGGACCACAGGAAGG + Intergenic
1052300130 9:26944665-26944687 GCCACCCATGGGCCACAGGATGG + Intronic
1052321922 9:27176850-27176872 GGTTCCCAGGGACTACAGGGTGG - Intronic
1056833105 9:89932379-89932401 GCTTCTCAGGGAACACAGCAAGG + Intergenic
1057384251 9:94593541-94593563 GCTCCCCAGGACTCACAGGTGGG + Exonic
1057581899 9:96294536-96294558 GATAGCAAGGGACCACAGGAAGG + Intronic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059652149 9:116324938-116324960 GCTGCCCATGATCCACAGGATGG - Intronic
1059921657 9:119167227-119167249 GTTTCCCCGGGGCCACAGGAGGG + Exonic
1060218518 9:121752509-121752531 TCTGCCCAGGGAGCCCAGGAAGG + Intronic
1060402007 9:123354806-123354828 GGTCCCCAGGGACCAAAGGAGGG - Intergenic
1060802996 9:126556661-126556683 TCTCCCCAGGAGCCCCAGGATGG + Intergenic
1061140272 9:128762012-128762034 GCAGCCCATGGACCACAGGTTGG - Intronic
1061627088 9:131847194-131847216 GCAGCCCAGGGACCCCACGAAGG - Intergenic
1062376568 9:136264407-136264429 GCTGCCCAGGGATCCCAGGCGGG - Intergenic
1062394768 9:136348330-136348352 GGTGACCAGGGGCCACAGGAAGG + Intronic
1062606665 9:137351572-137351594 GCTCTGCAGGGACCACAGCCTGG + Intronic
1186464541 X:9774633-9774655 GCTACCTAGAGACCCCAGGATGG - Intronic
1186593283 X:10953517-10953539 GCTCTCCAAGGCCCACAGGCTGG - Intergenic
1187245296 X:17548422-17548444 GATCCCCAGGGAACAGAGGCTGG + Intronic
1187418637 X:19115450-19115472 ACTCCCCACTTACCACAGGAAGG - Intronic
1193758742 X:85440361-85440383 GCTCCCCAAAGCCCACAGGCTGG + Intergenic
1194537112 X:95119227-95119249 GCTTCCCAAGGCCCACAGGTTGG + Intergenic
1195065426 X:101234665-101234687 ACTCCCCAGGCAGCACAGGTAGG + Intronic
1196717544 X:118825315-118825337 TCTCCCCAGGGACCTCAGCATGG - Exonic
1196891736 X:120297949-120297971 GCTCCCCTGAGACCTCAGAAAGG + Intronic
1200926887 Y:8662642-8662664 ACACCCCAGGGAACACAGGTGGG - Intergenic