ID: 1096389116

View in Genome Browser
Species Human (GRCh38)
Location 12:51215728-51215750
Sequence ATTTTGACATGAGGGGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389108_1096389116 7 Left 1096389108 12:51215698-51215720 CCCACTCTCTCTTCTGCCTCATG 0: 1
1: 0
2: 4
3: 60
4: 600
Right 1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160
1096389109_1096389116 6 Left 1096389109 12:51215699-51215721 CCACTCTCTCTTCTGCCTCATGA 0: 1
1: 0
2: 7
3: 68
4: 682
Right 1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160
1096389105_1096389116 30 Left 1096389105 12:51215675-51215697 CCTGTGGCCAGTTTCTCCTGCAT 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160
1096389106_1096389116 23 Left 1096389106 12:51215682-51215704 CCAGTTTCTCCTGCATCCCACTC 0: 1
1: 0
2: 1
3: 40
4: 453
Right 1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160
1096389107_1096389116 14 Left 1096389107 12:51215691-51215713 CCTGCATCCCACTCTCTCTTCTG 0: 1
1: 0
2: 4
3: 46
4: 538
Right 1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160
1096389110_1096389116 -9 Left 1096389110 12:51215714-51215736 CCTCATGAACCCTCATTTTGACA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389116 Original CRISPR ATTTTGACATGAGGGGTCAA AGG Intronic
905744044 1:40398640-40398662 ATTCTTACAAGTGGGGTCAAAGG + Intronic
907116450 1:51972542-51972564 ATTTGGAGATGAGGCCTCAAAGG + Intronic
908552923 1:65227846-65227868 ATATTCACATGAAGGGACAATGG - Exonic
911323713 1:96444784-96444806 ATTTTCACTTGAGGGGATAAAGG - Intergenic
911372982 1:97016438-97016460 ATTTAGAAATGAGGAGACAAAGG - Intergenic
915257642 1:154646899-154646921 ATTTTGACATGAGATTTGAAGGG + Intergenic
916270201 1:162932705-162932727 ATTTTGACACTGGGGGACAAGGG - Intergenic
917481770 1:175418406-175418428 ATTTTGAAAGGAGGAGGCAATGG + Intronic
918712938 1:187754183-187754205 AATTAGACTTGAAGGGTCAAGGG + Intergenic
921946019 1:220886740-220886762 ATTTCGATATGTGGGGTCAGGGG - Intergenic
1063594218 10:7418891-7418913 AATTTGCCAAGAGGAGTCAAAGG - Intergenic
1065303012 10:24341105-24341127 ATTTTGACAGGAGAAGTAAAAGG - Intronic
1066486959 10:35855404-35855426 ATTTTGAAATAAGAGGACAAAGG - Intergenic
1067307898 10:45082665-45082687 ATTTTGAAATAAGAGGACAAAGG - Intergenic
1069179244 10:65335553-65335575 ATTTTAGCTTGAGGGGTAAAAGG + Intergenic
1070231803 10:74575506-74575528 ATTTTGACAAGAGTGGTTGAAGG + Intronic
1074158583 10:110818779-110818801 ATTTTGACAAGAGAGGGCCATGG + Intronic
1079750782 11:24193717-24193739 ATTTTGTCATAAGGGGATAAAGG + Intergenic
1094567601 12:31614084-31614106 ATATTCACATGAAGGGACAATGG + Intergenic
1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG + Intronic
1102669010 12:114601305-114601327 ATTGTGAGATGTGGAGTCAAAGG + Intergenic
1103151109 12:118639619-118639641 ATTTTAAAATGAGGGGGTAATGG - Intergenic
1106345499 13:28872792-28872814 ATTTCGACATGAGGTTTGAAGGG + Intronic
1106401399 13:29434748-29434770 ATTTTAACATGTGTGGTCAATGG - Intronic
1110311124 13:74050426-74050448 ATCTTGATATGAGGAGACAAAGG + Intronic
1110908942 13:80930782-80930804 ATTTTTCCATGAGGGATTAAGGG - Intergenic
1112914580 13:104531718-104531740 AGTTTGGCATTAGGGGTGAAGGG + Intergenic
1114444652 14:22779155-22779177 ATCTTGACAGGAAGGGTCCAGGG + Intronic
1120525616 14:85573660-85573682 ATTCTGACATCAGGTGTCAGGGG + Intronic
1126874662 15:53028168-53028190 ATTTTGACATGAGGCATCATTGG - Intergenic
1126875225 15:53034029-53034051 ATTCTGACCTGAGGGTCCAAAGG + Intergenic
1130516751 15:84631603-84631625 AGTTTGATAAGAGGAGTCAAGGG - Intergenic
1130562709 15:84971291-84971313 ATTTTGACATGAGGTTTGAGGGG - Intergenic
1130849550 15:87779905-87779927 AGTGTGAGATGAGGAGTCAAAGG - Intergenic
1136510982 16:30738220-30738242 ATGTGGAAATTAGGGGTCAAGGG + Exonic
1138290708 16:55844425-55844447 ACTATGAAATGAGAGGTCAAGGG + Intergenic
1141049662 16:80748824-80748846 GTTCTGTCATGAGAGGTCAAAGG + Intronic
1141376012 16:83531456-83531478 ATCTTGAGATGAGGGGTGAGGGG + Intronic
1143218807 17:5244582-5244604 ATTTTGTCATGAGCGGTACAAGG - Intergenic
1146251424 17:31347853-31347875 ATATTCACATGAAGGGACAATGG - Intronic
1151895475 17:76977572-76977594 ATTTTGACATGAGGTTTGGAGGG + Intergenic
1153446712 18:5180872-5180894 ATTTAGACAGGAGGGCTCTATGG - Intronic
1155414535 18:25582488-25582510 ATTTTGACCAGAGGGATAAAAGG - Intergenic
1156564435 18:38169091-38169113 ATTTTGGTATGAAGGGTCAGGGG + Intergenic
1157026084 18:43845502-43845524 ATTTTGACATGAGGAAACTAAGG + Intergenic
1158747004 18:60212711-60212733 AATTTGACATGAGATTTCAATGG - Intergenic
1162864940 19:13538530-13538552 ATTTTGACATGAGCAGTCTGAGG + Intronic
1164117563 19:22237066-22237088 ATTTTGAAGTCAGTGGTCAAGGG + Intergenic
1164889804 19:31813665-31813687 ATTTTGAGATGAAATGTCAAAGG - Intergenic
1168366179 19:55789771-55789793 ATTTTGACATGAGTACTGAAAGG - Intronic
925560656 2:5190536-5190558 ATTTTCAGATGAGGGGAAAAAGG + Intergenic
926537536 2:14131720-14131742 ATGATGAAATGAGGGGTGAAAGG + Intergenic
929105622 2:38362593-38362615 ATTCTGACACAAGGGGTGAAAGG + Intronic
933914802 2:86979016-86979038 ATTTTAACAATAGGGTTCAAAGG + Intronic
934008192 2:87790884-87790906 ATTTTAACAATAGGGTTCAAAGG - Intronic
935632292 2:105221991-105222013 ATTTTCAGATGAGGGACCAAGGG + Intergenic
935771829 2:106431824-106431846 ATTTTAACAATAGGGTTCAAAGG - Intronic
935908242 2:107864117-107864139 ATTTTAACAATAGGGTTCAAAGG + Intronic
935994649 2:108756348-108756370 ATTTTAACAATAGGGTTCAAAGG + Intronic
936130031 2:109829239-109829261 ATTTTAACAATAGGGTTCAAAGG + Intronic
936214666 2:110542246-110542268 ATTTTAACAATAGGGTTCAAAGG - Intronic
936423803 2:112396809-112396831 ATTTTAACAATAGGGTTCAAAGG - Intronic
937198099 2:120178182-120178204 AGTTTCACATCAGGGGTCAGCGG - Exonic
940497538 2:154452351-154452373 AATTTTACATGAGGCCTCAATGG - Exonic
941368105 2:164631678-164631700 ATTTTGAAATCAGGGGACCAGGG + Intergenic
942324994 2:174769003-174769025 ATTTTGACGTGAGGGTTAATGGG + Intergenic
944357657 2:198811027-198811049 ATTCTGAAAAGAGGGGACAATGG - Intergenic
945619021 2:212110148-212110170 ATCTTGACTAGAGGAGTCAAAGG + Intronic
946073370 2:217053440-217053462 ATTTTCCCATGAGGTATCAAAGG - Intergenic
1171007905 20:21485632-21485654 ATGTTGACTTGAAGAGTCAATGG + Intergenic
1173950220 20:46986890-46986912 ATTTTAACATGAGAGTTGAAGGG + Intronic
1176588468 21:8614719-8614741 ATTAAAACATGTGGGGTCAAAGG + Intergenic
1177928700 21:27251624-27251646 ATCTTGAGATGAGAGGCCAAAGG - Intergenic
1180271296 22:10591716-10591738 ATTAAAACATGTGGGGTCAAAGG + Intergenic
1181652247 22:24266048-24266070 ACTATGAAATGAGAGGTCAATGG + Intergenic
949138860 3:607043-607065 ATTAAAACATGTGGGGTCAAAGG - Intergenic
949200606 3:1374277-1374299 ATTTTGACATGTTGGCTTAAAGG - Intronic
951449263 3:22818458-22818480 ATTTTGACATGAGATTTCAGTGG + Intergenic
952511857 3:34066098-34066120 TTTTAGACAGGAGGGGTTAAAGG + Intergenic
953374875 3:42420177-42420199 TTTTTGACATAAGGAGTCTAAGG + Intergenic
955335394 3:58081334-58081356 ATTTTGACCAGAGGAGTAAATGG + Intronic
957161484 3:76615870-76615892 ATTTTGGGATGAGGAGTCAGAGG + Intronic
957361737 3:79168444-79168466 ATTTTACCATGTTGGGTCAAAGG - Intronic
960446855 3:117759592-117759614 ATTTTCACATGGGTGGTCCATGG - Intergenic
961840177 3:129703919-129703941 GTTTTAACCTGAGAGGTCAAAGG + Intronic
964485363 3:157179909-157179931 AATTTGAAATGAGAGTTCAAAGG + Intergenic
965855320 3:173081080-173081102 ATTTTGATATTAGGGTTCAAAGG - Intronic
968024192 3:195425170-195425192 ATTTTTATATGAGGGCTCTAAGG - Intronic
970265601 4:14280778-14280800 ATTTTGACATGTGAAGTCATTGG + Intergenic
973618647 4:52705833-52705855 ATTCAGAGATGAGGGGTCAATGG - Intergenic
974197011 4:58588148-58588170 ATTCTCACATGAGGGCGCAAGGG - Intergenic
975922376 4:79407626-79407648 AGTTTGACAGGAGGAGTTAATGG - Exonic
976831216 4:89316882-89316904 ATTTTAAATTGAGGGGTGAAAGG + Intergenic
978957973 4:114638352-114638374 CTTTTTACATGAGGGTTCCAAGG + Intronic
979124144 4:116946424-116946446 ATTTTGACATGAGGTTTGGAGGG - Intergenic
979327235 4:119394383-119394405 AGTTTGACAGGAGGCGTCAATGG - Intergenic
980021321 4:127713443-127713465 ATTTAGAGATTATGGGTCAAAGG + Intronic
983245118 4:165279071-165279093 AGTTTGACAGGAGGCGTCAATGG - Intronic
984096897 4:175445679-175445701 TTTTTGAAATGATGTGTCAAAGG - Intergenic
985341772 4:188962073-188962095 CTTTTGACATTAGAGGTCACTGG + Intergenic
985507222 5:290265-290287 ATTTTGAGAAGAGGGGAAAAAGG - Intronic
985740748 5:1614870-1614892 ATTTTGAGAAGAGGGGAAAAAGG + Intergenic
986272409 5:6245054-6245076 AATGAGACATAAGGGGTCAACGG + Intergenic
986404262 5:7409900-7409922 ATTTTACCATGAGGTGTGAAAGG - Intronic
986982283 5:13462436-13462458 ATTTTGACATGAATTCTCAAAGG - Intergenic
987999766 5:25332797-25332819 ATTTTGGTGGGAGGGGTCAAGGG - Intergenic
988120212 5:26951924-26951946 ATTTTAACATGAGTGTTGAAAGG - Intronic
989353442 5:40514884-40514906 AATTAGACATGATGGGTCCATGG + Intergenic
993311535 5:86338467-86338489 ATTTTGAAGTGTGGGGACAATGG - Intergenic
994185411 5:96809703-96809725 AATTTGACAGGAGGTATCAATGG + Intergenic
995333147 5:110968069-110968091 ATGTTGGCATGAGCAGTCAATGG + Intergenic
995566643 5:113437872-113437894 ATTTTGGCAGGAGTGGTAAAGGG + Intronic
995656060 5:114427287-114427309 ATTTTGACATGTGGGTTTGATGG + Intronic
995956535 5:117783382-117783404 ATTAAGACATGACGGGGCAAGGG + Intergenic
996112098 5:119577748-119577770 GTCTTGACTGGAGGGGTCAAAGG + Intronic
996216910 5:120879447-120879469 ATTTTGTCATGAAGTTTCAATGG + Intergenic
997014576 5:129917824-129917846 ATTTTGACATAACGGATGAAGGG - Intronic
1001951479 5:175819737-175819759 CTTTTGACCTGTGAGGTCAAAGG - Intronic
1005227545 6:23659910-23659932 ATTTTGACAGGAGGGGTGAGAGG - Intergenic
1005642642 6:27811073-27811095 ATTTTTACATGGGGCTTCAAAGG - Exonic
1005860861 6:29899080-29899102 ATTTTAACATGAGGTATCAGGGG - Intergenic
1007358489 6:41338777-41338799 ATGTTGACCTAAGGCGTCAAGGG + Intronic
1011519350 6:88187514-88187536 ATTTAGAAATGATGGGTAAAAGG + Intergenic
1012206244 6:96464134-96464156 CTTTTGTCATGGGGGTTCAAGGG - Intergenic
1014764488 6:125391058-125391080 ATATTGAGATGAGGGGAAAAAGG + Intergenic
1014816873 6:125945593-125945615 ATTTTGAGCAGAGGAGTCAAAGG + Intergenic
1015847845 6:137539541-137539563 ATTTTAATATTAGTGGTCAAGGG + Intergenic
1020647723 7:10835621-10835643 ATTTTGATAGGAGGGGTAATGGG - Intergenic
1022673526 7:32477722-32477744 ATGTTGACATGAGGGCTAACTGG - Intergenic
1023496870 7:40807348-40807370 ATTTTGACGTGAGGTCTCACAGG + Intronic
1024098872 7:46008444-46008466 ATGATGACATGAGGTGTCACTGG - Intergenic
1025576375 7:62647785-62647807 TTTTTGACCTTAAGGGTCAAAGG + Intergenic
1025761386 7:64398587-64398609 ATTTTCCCATAAGGGCTCAATGG + Intergenic
1026189925 7:68116451-68116473 ATTTTGACATGAGATTTCAAGGG - Intergenic
1028641581 7:93047744-93047766 TTATTGACCTGAGGAGTCAAAGG + Intergenic
1028675356 7:93454084-93454106 TTTTTGAGATGAGAGGTCAATGG - Intronic
1030785615 7:113657790-113657812 ATTTTGACATGATCGGCTAAGGG - Intergenic
1032489407 7:132312874-132312896 TTATTTACATGAGGGGTCCATGG + Intronic
1035764745 8:2097013-2097035 ATGCTCAGATGAGGGGTCAAGGG - Intronic
1036912641 8:12770323-12770345 ATCTTGACATGTGTGGTCTAAGG + Intergenic
1037591012 8:20312100-20312122 ATTTTGCCTTCAGGGTTCAATGG + Intergenic
1037793194 8:21966285-21966307 CTTTAGACATGAGGGATCCAGGG + Intronic
1038993873 8:32900285-32900307 ATTTTGACATGAAGGGACCCTGG + Intergenic
1039343119 8:36672819-36672841 ATTTTGAAATGAGGTGTCTAAGG - Intergenic
1040114910 8:43605723-43605745 TTTTTGACATTAGGCCTCAATGG - Intergenic
1040678857 8:49785225-49785247 ATTTTGACATCAGGGCTTCAGGG + Intergenic
1041467224 8:58168862-58168884 ATTTTGACATGAGATTTGAAGGG - Intronic
1043679714 8:83008145-83008167 CTTTTAACATTATGGGTCAAAGG - Intergenic
1044713142 8:95076054-95076076 ATTTTTACATGAGGTCTCAATGG + Intronic
1045409597 8:101903916-101903938 ATTGTGTCATGTGGGGTTAATGG - Intronic
1047016304 8:120727157-120727179 TCTCTGACATGTGGGGTCAAAGG + Intronic
1047273120 8:123381694-123381716 ATTTTCACATTAGAAGTCAAAGG + Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051046461 9:12881106-12881128 ATTTTCACATGGGGGGAAAAAGG - Intergenic
1051705319 9:19872923-19872945 ATTTAGACATGAGGGATTTAAGG - Intergenic
1051722024 9:20047155-20047177 ATGTTGACATGAAGGCCCAAGGG + Intergenic
1053433157 9:38057446-38057468 ATTTTGTTATAAGGGGTAAAAGG + Intronic
1055324922 9:75119173-75119195 ACTTTCACATGAGGAATCAATGG - Intronic
1057589038 9:96355959-96355981 ATTTTAACATGAGGCATAAAGGG - Intronic
1059236684 9:112766409-112766431 ATTTTGACATTTGAGGTTAATGG + Intronic
1060863070 9:126972194-126972216 ATTGTGCCATGATGGGGCAATGG - Intronic
1187674215 X:21699784-21699806 ACTCTGAGATGAGGGTTCAAGGG - Intergenic
1188487255 X:30696042-30696064 AGTTTGACAGGAGGAGTCAATGG + Exonic
1189549956 X:42082693-42082715 AATTTGACTTTGGGGGTCAAGGG + Intergenic
1189725891 X:43968032-43968054 ATTTTGCCATGAGGGTGAAATGG + Intronic
1191260276 X:58311390-58311412 ATTTTAACTTTAGGAGTCAATGG - Intergenic
1192962141 X:76142692-76142714 ATTTTGACAAGAGAGCTCAAAGG + Intergenic
1192963392 X:76152395-76152417 ATTTTGACAAGAGAGCTCAAAGG - Intergenic
1193262649 X:79427236-79427258 ATTTGGACATGATGGGTCAAAGG - Intergenic
1195123350 X:101779966-101779988 AATTTGACAGGAGGAGTCAATGG - Intergenic
1196896334 X:120340478-120340500 ATTTATACATGAGGGGAGAAAGG - Intergenic
1197188484 X:123616761-123616783 ATTTGGAAATTAGGGGTAAAGGG + Intronic
1197652799 X:129084307-129084329 ATTTTGACATGGTTGTTCAAAGG + Intergenic
1197665465 X:129218427-129218449 ATTTTGACATGTTTGGTGAATGG - Intergenic
1199570677 X:149264209-149264231 TTTTTGACATTAGGGGAGAAGGG - Intergenic
1200600598 Y:5200527-5200549 AATATGACATGATGGGTCTATGG - Intronic
1200767761 Y:7094752-7094774 ACATTGTCATGAGGGGTCAGAGG - Intergenic