ID: 1096389266

View in Genome Browser
Species Human (GRCh38)
Location 12:51217060-51217082
Sequence AGGGTGGGTCAGTGATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 476}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389266_1096389271 -8 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389271 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 208
1096389266_1096389273 -7 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389273 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 142
1096389266_1096389287 25 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389266_1096389280 16 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389266_1096389278 7 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389266_1096389277 6 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389266 Original CRISPR AGGGTGGGTCAGTGATGGGA GGG (reversed) Intronic
900142760 1:1145462-1145484 AGGTGGGGTCAGTCATGAGATGG - Intergenic
900192669 1:1358126-1358148 GGAGTGGGTCAGTGATTGAAGGG - Intronic
900215144 1:1477546-1477568 AGGGAGGGTCAGTGTTGGTGAGG + Intronic
900319458 1:2075377-2075399 TGGGTGAGTCAGAGCTGGGATGG + Intronic
900882333 1:5391066-5391088 AGGAGGGGTATGTGATGGGATGG + Intergenic
901926805 1:12571200-12571222 AGTGTGGGACTGGGATGGGAAGG + Intronic
901949449 1:12730420-12730442 AGGGAGGGAGAGAGATGGGAGGG + Intergenic
902000867 1:13193704-13193726 AGGGTGGGTCAGGGCTGGAGTGG + Intergenic
902230072 1:15022195-15022217 AGGGCAGGGAAGTGATGGGAGGG - Intronic
902552778 1:17229214-17229236 AGGGTGGGTCAGGGTTGGGCAGG - Intronic
903294254 1:22333607-22333629 TGGGTGGATGAGTGATTGGATGG + Intergenic
903805700 1:26004223-26004245 AGGGTGGGGAAGGGAGGGGAGGG - Intergenic
903963453 1:27071556-27071578 CGGGTGGGCCAGTCTTGGGAGGG + Intergenic
904028903 1:27521725-27521747 AGGGTGGGGAAGGGCTGGGAAGG - Intergenic
904390210 1:30179999-30180021 AGGGTGGGGCAAAGACGGGAAGG + Intergenic
904641900 1:31937822-31937844 AGGGTGGGTGAGCGAGGGGCGGG - Intronic
904824423 1:33265329-33265351 GGGGAGGGACAGTGAGGGGAAGG + Intronic
905274631 1:36809216-36809238 TGGGTGGGTGAGTGGTTGGATGG - Intronic
905403324 1:37718066-37718088 AAGCTGGGGCAGGGATGGGAGGG - Exonic
905539554 1:38749075-38749097 AGGGAGGGTGGGTGATGGTAAGG - Intergenic
905831818 1:41075275-41075297 TGGATGGGGCAGAGATGGGATGG + Exonic
906104677 1:43284777-43284799 AGGGTGGGTGAGTGGGAGGAGGG - Intronic
906107074 1:43300964-43300986 AGTGTGGGTCGGTGCTGGGGAGG - Intergenic
906312206 1:44762029-44762051 AGGGAAGGGCAGTGATGAGAGGG + Intronic
906539511 1:46574395-46574417 AGATTGGGGGAGTGATGGGAAGG + Intronic
907314452 1:53559565-53559587 ATGGTGAGTGAGTGATGGGAGGG - Intronic
907369501 1:53991782-53991804 AGGGTGAGTCAGGCATGGAACGG + Intergenic
908168698 1:61483917-61483939 AGGCTGGGGCAGGGATGGGAAGG + Intergenic
909855213 1:80521027-80521049 AGGGAGGGTTGGGGATGGGAGGG + Intergenic
910604134 1:89065057-89065079 AGGTTGTGGCAGGGATGGGAAGG - Intronic
910635948 1:89407839-89407861 AGGTTGTGGCAGGGATGGGAAGG + Intergenic
911184274 1:94887717-94887739 AGAGTGGGGAAGTGATGGGGTGG + Intronic
912438593 1:109680572-109680594 AGGGTGGGTGAGCAGTGGGAAGG + Intronic
912441114 1:109699017-109699039 AGGGTGGGTGAGCAGTGGGAAGG + Intronic
913122429 1:115754208-115754230 AGGCTGGCTCAATGAAGGGACGG + Intronic
913205180 1:116532229-116532251 AGGGTGGTTCAGAAATGGCAAGG + Intronic
914972180 1:152317233-152317255 AGGGTGGGGTGGAGATGGGAAGG - Intronic
915095363 1:153458610-153458632 AGGGTCAGTGAGTGCTGGGAGGG + Intronic
917442765 1:175081573-175081595 GGGATGGGTCAGTGTTGGAAAGG + Intronic
918132033 1:181638004-181638026 AGGTTGGGTCAGTCATGGTAGGG + Intronic
918464356 1:184806463-184806485 AGGCAGGGTCAGGGATGGGTGGG + Intronic
919458269 1:197846122-197846144 AGGGTGGGGAAGGGAAGGGAAGG - Intergenic
919982815 1:202652946-202652968 AGGGGGGGTGGGTGGTGGGAAGG - Intronic
920171947 1:204077410-204077432 ATGGTGGCTGAGGGATGGGATGG + Intronic
921891684 1:220360118-220360140 AATGTGGGTAAGTGATTGGAGGG - Intergenic
922027033 1:221759939-221759961 CGGGTGAGGCAGGGATGGGATGG - Intergenic
922559607 1:226559596-226559618 AGGGTGGAGCAGTGAGGAGAGGG - Intronic
922633737 1:227142300-227142322 AGTGAGGGTCAGTGAAAGGATGG + Intronic
922989716 1:229896128-229896150 AGGGTGGGGGAGTGAGGGGCTGG - Intergenic
924501379 1:244641903-244641925 AATGGGGGTCAGGGATGGGAAGG + Intergenic
924658905 1:245998216-245998238 AGGGTGGGTAAGAGATGAGTGGG - Intronic
924799947 1:247321955-247321977 AGGGAGGGCTAGGGATGGGAAGG - Intronic
924800419 1:247325914-247325936 AGGGAGGGCTAGGGATGGGAAGG - Intronic
1062830722 10:603893-603915 AGGCTGGGGCAGTGGTCGGAGGG - Intronic
1062830742 10:603943-603965 AGGGTGGGGCAGTGGTTGGAGGG - Intronic
1063989550 10:11545215-11545237 AGGGTGGGGCAGAGAGGGGAGGG - Intronic
1065383602 10:25113498-25113520 AGGGTGGGTAAGAGTTAGGAGGG - Intergenic
1066677931 10:37908097-37908119 AGGGTGGGTGGGGGAGGGGATGG - Intergenic
1067685009 10:48461298-48461320 TTGGTGGGTCAGTGACTGGAAGG + Intronic
1068933101 10:62611543-62611565 AGGGTGCTTCATTGAAGGGAAGG + Intronic
1070137511 10:73707733-73707755 TGGGTGTGTTAGTGAGGGGATGG + Intergenic
1070206040 10:74262443-74262465 AGGGTGGGGCAGGGAAGGCAAGG + Intronic
1071372789 10:84969461-84969483 AGGGTGTGGCAGTTAAGGGAAGG + Intergenic
1072338722 10:94424725-94424747 GAGATGGGTCAGTGCTGGGAAGG + Intronic
1072572685 10:96672600-96672622 AGGGTGGGTTGGGGAGGGGAAGG - Intronic
1072599614 10:96913365-96913387 AGGGTCGGGGAGAGATGGGAAGG + Intronic
1072738911 10:97897815-97897837 TGTGTGGGGCAATGATGGGAAGG + Intronic
1073058089 10:100714959-100714981 TGGGTGGGGCAGTGGTGGGGTGG - Intergenic
1073487213 10:103827122-103827144 AGGGTGGATGAGGGGTGGGAGGG + Intronic
1074058509 10:109943657-109943679 AGGAGGAGTCAGTGAGGGGAGGG - Intronic
1075064987 10:119283267-119283289 TGGGTGGACCTGTGATGGGACGG + Intronic
1075228116 10:120648017-120648039 AGAGTGGAACAGTGGTGGGAGGG + Intergenic
1075446592 10:122517694-122517716 AGAGTGGCTCAGTGCCGGGAGGG + Intergenic
1075575259 10:123573002-123573024 TGGGTTGGTCACTGATGAGATGG - Intergenic
1075624436 10:123951428-123951450 AGGGTGTGTCAGTGGGGAGAAGG + Intergenic
1076240496 10:128901827-128901849 AGGGTCCTTCAGAGATGGGAGGG - Intergenic
1076369830 10:129945123-129945145 AGGGAGGGGCAGGGAGGGGAGGG + Intronic
1076564763 10:131390601-131390623 AGAGTGGGTCAGGGTGGGGAGGG - Intergenic
1076669150 10:132110137-132110159 AGGGTCGGTCTGTTCTGGGAAGG - Intronic
1077312020 11:1893080-1893102 TGGGTGGGTGAGTGGAGGGATGG + Intergenic
1077312059 11:1893263-1893285 TGGGTGGGTGAGTGGAGGGATGG + Intergenic
1077316430 11:1921329-1921351 GAGGAGGGTCAGTGAAGGGAGGG - Intronic
1077749797 11:4954228-4954250 AGGGTGGGGAAATGATGGGGCGG + Intronic
1078505201 11:11934516-11934538 AGCATGGGCCAGTGATGGAATGG - Intronic
1078757255 11:14222913-14222935 TGGGTGGGACAGTGATGTGCTGG - Intronic
1079114361 11:17631741-17631763 AGGATGGCTCAGTGGTGGGTGGG + Exonic
1080755099 11:35189653-35189675 AGGGTGTGTGGGGGATGGGAGGG + Intronic
1081685598 11:45040959-45040981 AGTGTGTGTCACTGATGTGAAGG + Intergenic
1083266360 11:61548632-61548654 AAGGTGGGGCAGTGTGGGGAAGG + Intronic
1083709798 11:64541030-64541052 GGATGGGGTCAGTGATGGGAGGG - Intergenic
1083757824 11:64801036-64801058 AGGTGGGGTCACAGATGGGATGG + Intronic
1085817535 11:79756158-79756180 ATGGAGGATCATTGATGGGAAGG - Intergenic
1087352302 11:97047436-97047458 AGTATGGGTTAGTGAAGGGAGGG - Intergenic
1088122917 11:106390712-106390734 GGGGGGGGCCAGTTATGGGAAGG - Intergenic
1089730466 11:120515822-120515844 AGGCTGGGTAAATTATGGGAAGG + Intronic
1090149656 11:124369461-124369483 AGGATGGGTCTTTGATGAGAGGG - Intergenic
1090745986 11:129705090-129705112 AGGGAGGCTCAGTGGTGGGGAGG + Intergenic
1090990791 11:131815359-131815381 AGGGTGGGCGAGGGCTGGGATGG - Intronic
1091549774 12:1529113-1529135 AGGGAGGGTCAGGGAATGGATGG - Intergenic
1092731392 12:11538444-11538466 AGGGTGAGGCAGGGACGGGAGGG + Intergenic
1092894648 12:13000420-13000442 AGGGCGGGTCAGTGATGCGAAGG + Intergenic
1094509664 12:31088688-31088710 AGGGTGGGTTGTTGGTGGGAGGG - Intronic
1095465853 12:42487511-42487533 AAGGAGGGTCAGGGAGGGGATGG - Intronic
1096389266 12:51217060-51217082 AGGGTGGGTCAGTGATGGGAGGG - Intronic
1098828923 12:75334803-75334825 AGTGTGGGTCAGTGATGGATGGG - Exonic
1099062152 12:77925081-77925103 AGGGTGGGGGAATGATGGGGAGG + Intronic
1100706043 12:97201533-97201555 AAGGTGGGTCAGAGATGAGAAGG + Intergenic
1100886572 12:99077387-99077409 ATGGAGAGTGAGTGATGGGATGG + Intronic
1102053893 12:109881904-109881926 AGGGTGGGGGAGGGGTGGGAAGG - Intergenic
1103027223 12:117583390-117583412 TGGGTGGGTGAGTGAGTGGATGG + Intronic
1103801448 12:123540421-123540443 GGGGTGGGAAAGGGATGGGAGGG + Intergenic
1104163277 12:126201408-126201430 ATGGTGGGACAGGGATGGGGAGG - Intergenic
1104236486 12:126943465-126943487 AGGGTGGGTAAATTGTGGGAAGG - Intergenic
1104529252 12:129553494-129553516 AGGCTGACTCAGTGGTGGGATGG + Intronic
1104806445 12:131592338-131592360 AGGGTGGGGCAGTGTTGGCTGGG - Intergenic
1104925954 12:132313977-132313999 TGGGTGGGTGGGTGATGGGTGGG - Intronic
1104944019 12:132407612-132407634 AGGGCGGGGCCGTGATGCGAAGG + Intergenic
1105050798 12:133048934-133048956 TGGGCTGGTCAGTGATGGGTTGG + Intronic
1105303756 13:19155494-19155516 AGGAGGGGTCAGGGATGGGAAGG + Intergenic
1105899531 13:24743367-24743389 AGGGTGGGTGGGAGATGGGAAGG - Intergenic
1106431985 13:29689347-29689369 AGGCAGTGTCAGTGGTGGGAGGG + Intergenic
1106948834 13:34859924-34859946 TGGGTTGGGGAGTGATGGGAGGG + Intergenic
1107430279 13:40334241-40334263 GAGGTGGGGCAGGGATGGGAGGG + Intergenic
1107460420 13:40596875-40596897 GGGGAGGATCAGTGATGAGATGG - Intronic
1107881575 13:44836822-44836844 TGGCTGGGGCAGTGATGGGAGGG - Intergenic
1108552693 13:51562405-51562427 TGGGTGGGTCTGTGGTGGCATGG + Intergenic
1109927441 13:69162993-69163015 TGGGTGGGTAAGAGGTGGGATGG - Intergenic
1113934098 13:113984342-113984364 CGGATGGGTGAGTGATGGGTAGG - Intronic
1114514544 14:23289542-23289564 GGGGTGGGGAAGTGAAGGGAAGG + Intronic
1114654861 14:24310057-24310079 TGGGTGCGTTGGTGATGGGAAGG + Intronic
1114980550 14:28158343-28158365 AGGTTGGGGGAGCGATGGGAGGG - Intergenic
1115258074 14:31423537-31423559 AGGGTGTGGGAGTGATGGTAAGG - Intronic
1118353287 14:64989913-64989935 AGGGTGTGTCAGGAATGGGTGGG + Intronic
1119379367 14:74218724-74218746 AGGCAGGGTCAGGGATGGCAGGG - Intergenic
1119401261 14:74364236-74364258 AGGATGGGACAGGGATGGGCTGG - Intergenic
1119407914 14:74410296-74410318 AGTGTGGGTCAATGAGGTGAAGG + Intronic
1119675201 14:76548282-76548304 AGGGTTGGGCAGGGAGGGGAGGG - Intergenic
1120727407 14:87960251-87960273 AGGGTGGGGCTGGGAAGGGAAGG + Intronic
1121382963 14:93490155-93490177 ACTCTGGGTCTGTGATGGGAGGG + Intronic
1121653232 14:95575423-95575445 AGGGTGGGGAAGTGATTGGAGGG + Intergenic
1121914082 14:97820415-97820437 TGGGAGGGGCTGTGATGGGAGGG - Intergenic
1122622231 14:103065954-103065976 AGGGTGGGTCCCTGCTGTGAGGG - Intergenic
1122741709 14:103875395-103875417 TGGGTGGGTGAGTGAATGGATGG + Intergenic
1122818722 14:104329002-104329024 AGGGTGGGTAATGGCTGGGATGG + Intergenic
1122879877 14:104685933-104685955 TGGGTGGGTAAGTGGGGGGATGG + Intergenic
1123030318 14:105448427-105448449 AGGCTGGGTCAGTGCTCGGATGG + Intronic
1123119316 14:105909501-105909523 AGTGAGGGACAGAGATGGGACGG + Intergenic
1124150936 15:27177505-27177527 AGAGGGGGTCAGTTTTGGGAAGG + Intronic
1124343312 15:28903800-28903822 GTGGTGGGCCAGTGGTGGGAAGG + Intronic
1125174617 15:36806600-36806622 GGGGTGCTTCACTGATGGGAAGG + Intronic
1125517882 15:40332986-40333008 AGAGCTGGTCAGGGATGGGATGG - Intronic
1125627751 15:41122533-41122555 AGGGAGGGGCAGGGAAGGGAAGG + Intergenic
1126475754 15:49063522-49063544 GGGGTGGGGAAGTGCTGGGAAGG - Intergenic
1127164728 15:56232442-56232464 CCGCTGGGTCTGTGATGGGAGGG + Intronic
1128603302 15:69015795-69015817 TTGGGGGGGCAGTGATGGGAAGG + Intronic
1128933623 15:71727163-71727185 AGAGTGGCTCAGAGATGGGAGGG - Intronic
1129200413 15:73995093-73995115 CGGGTGGGGCAGGGAAGGGAGGG + Intronic
1129600441 15:76995317-76995339 AGTGGAGCTCAGTGATGGGAGGG - Exonic
1129711798 15:77824164-77824186 AGGGTGGAGGAGGGATGGGAAGG - Intergenic
1130509868 15:84580708-84580730 AGGGAGGGGAAGTGAGGGGAGGG - Intergenic
1131518838 15:93098370-93098392 AGGGTGTGTGAGTGTGGGGAAGG + Intergenic
1131587846 15:93715588-93715610 TGGGTGGGGCAGTGCTGGGGAGG + Intergenic
1131676634 15:94676772-94676794 AGGTGGGGTCAGGGATGGGCAGG - Intergenic
1133621593 16:7531886-7531908 GGGATGGGTTAGGGATGGGAAGG - Intronic
1134148700 16:11788495-11788517 TGGGTGGCTAAGTGATAGGATGG - Intronic
1134782414 16:16910181-16910203 AGGGTGGGTGAGTGGATGGAGGG + Intergenic
1136074333 16:27806497-27806519 AAAGTGGGACAGGGATGGGAGGG + Intronic
1136174534 16:28507883-28507905 AGGGTGGGGCTGTGCTGGAAGGG - Intronic
1137250541 16:46737671-46737693 AGGCTGGGTGAGGGAGGGGATGG - Intronic
1137314196 16:47299472-47299494 AGGGTGGGGCTGAGATGGGCAGG + Intronic
1137345756 16:47657399-47657421 AGGTTGGGAGAGTGATGGGAAGG + Intronic
1137578644 16:49620629-49620651 GGGGAGGGTCAGGGCTGGGAAGG - Intronic
1139426224 16:66881291-66881313 GGGGTGGGGGAGTGAAGGGACGG + Intronic
1139583104 16:67884816-67884838 AGGGAGGGACGGTGATTGGATGG - Exonic
1140834585 16:78781403-78781425 AGGGTGGGCTAGAGGTGGGAGGG - Intronic
1142135196 16:88448734-88448756 GGGGTGGCTGAGTGAGGGGAAGG - Intergenic
1142416563 16:89946610-89946632 AAGGTGAGTGAGTGAGGGGAAGG + Intergenic
1142641241 17:1287029-1287051 AGGGTTGGGCTGTGCTGGGAGGG + Intronic
1143028855 17:3956221-3956243 AGGGTGGGTCAGAGAGCAGAAGG - Intronic
1143181343 17:4986273-4986295 AGGGGGAGTCTGTGCTGGGAAGG + Exonic
1143608670 17:8004987-8005009 AGGGTCGGTCAGTGGAGAGAGGG + Intronic
1143624878 17:8104016-8104038 TGGGTGGGTCAGCGTTGGGGTGG - Intronic
1144630970 17:16872340-16872362 AGGGTGGGTGACTGATGGATGGG - Intergenic
1144650343 17:17003136-17003158 AGGGTGGGTGACTGATGGATGGG + Intergenic
1144839296 17:18175820-18175842 AGGAAGGGACAGGGATGGGAAGG - Intronic
1145912048 17:28548559-28548581 TGGGTGGGCCATTGATGGGGAGG - Intronic
1145941503 17:28745463-28745485 AGGGTGGGTCAGCTGTGGGGGGG - Intronic
1146269150 17:31473106-31473128 TTGGTGGCTGAGTGATGGGAAGG + Intronic
1146406845 17:32546096-32546118 AGGGCGGGTGTGTGAAGGGAAGG - Intronic
1146948998 17:36892800-36892822 AGGGTGGGGCAGGGGTGGGAGGG - Intergenic
1147056431 17:37838791-37838813 AGCGTGGGTCAGGGAGAGGAAGG - Intergenic
1147193632 17:38750682-38750704 AGGGTGGGTGAGTACTGGGGTGG + Exonic
1147547055 17:41409826-41409848 GGGGTTGGACAGGGATGGGAAGG - Intergenic
1147843224 17:43387432-43387454 AGAGTGGGACGGTGATGGCAGGG - Intergenic
1147868945 17:43573774-43573796 AGGGTGGGTGGGGGCTGGGAGGG + Intronic
1148233550 17:45952282-45952304 AGCAGGGGTCAGAGATGGGAGGG + Intronic
1148582348 17:48752707-48752729 AGCGAGGGGCAGTTATGGGACGG + Intergenic
1149461346 17:56832612-56832634 AGGGTGGGTCAGTGTAAGTAAGG - Intronic
1151122162 17:71805123-71805145 AAGGAAGGTCAGTGGTGGGAGGG - Intergenic
1151433557 17:74080757-74080779 AGTGTGGGTGAGTGGTGGGAGGG - Intergenic
1151751386 17:76040284-76040306 AGGTTGGGTAAGAGAAGGGAGGG + Intronic
1152141904 17:78541300-78541322 TGGGTGGGTGAGTGAGTGGATGG + Intronic
1152202842 17:78957016-78957038 AGAGTGGGACAGAGATGAGACGG - Intergenic
1152336299 17:79701524-79701546 AGGGAGGGTCACAGGTGGGAGGG + Intergenic
1152336332 17:79701614-79701636 AGGGAGGGTCACAGGTGGGAGGG + Intergenic
1154500400 18:14993244-14993266 TGGGTGAGTCAGTGATGAGTGGG - Intergenic
1155389766 18:25322425-25322447 AGAGTGGGTGAGTGATTTGATGG - Intronic
1156301473 18:35840241-35840263 AGGGTGGGCCTTTGATGGGAAGG - Intergenic
1156535041 18:37854295-37854317 AGGGAGGGTCAGAGATGGATTGG + Intergenic
1156787137 18:40929137-40929159 GGGGTGGGTCAGTGTAGGGAAGG + Intergenic
1156858894 18:41813967-41813989 CCAGTGGGTCTGTGATGGGAGGG + Intergenic
1156867344 18:41903867-41903889 ACTCTGGGTCTGTGATGGGAGGG - Intergenic
1157289477 18:46399572-46399594 ACGGTGAGGCAATGATGGGAGGG + Intronic
1157480771 18:48052211-48052233 AGGGTGGGGCTGTGGTGGAAGGG + Intronic
1157627159 18:49060608-49060630 AGGGTGGCTTAGAGAAGGGAGGG + Intronic
1157729527 18:49991417-49991439 ATCTTGGTTCAGTGATGGGAGGG + Intronic
1157817304 18:50738959-50738981 GGGGTGGGTCAGGGGAGGGAGGG + Intergenic
1159542084 18:69790914-69790936 AGGGTGGGGGAGGGGTGGGATGG - Intronic
1159566412 18:70055995-70056017 AGGGTGTGTCAGAAAGGGGAGGG - Intronic
1160114422 18:76064271-76064293 AGGCTGGGCCAGGGATGGGCCGG + Intergenic
1160255581 18:77245760-77245782 AAAGTGAGTCAGTGATAGGAAGG + Intergenic
1160592698 18:79952731-79952753 AGGGTGCGCGAGTGATGGGCGGG + Intergenic
1160977721 19:1802097-1802119 TGGATGGGTGAGTGATGGGTGGG - Intronic
1160977744 19:1802163-1802185 TGGATGGGTGAGTGATGGGTGGG - Intronic
1160977754 19:1802193-1802215 TGGGTGGGTGAGTGATGGGTGGG - Intronic
1160977768 19:1802230-1802252 TGGATGGGTGAGTGATGGGTGGG - Intronic
1162061925 19:8101367-8101389 GGAATGGGACAGTGATGGGAAGG - Intronic
1162324658 19:9991912-9991934 GGGGGGGGTCAGTCATGGAAGGG + Intronic
1163450389 19:17373583-17373605 GAGGTGGGTGAGAGATGGGAGGG - Intronic
1164597763 19:29541399-29541421 CTGGTGGGTGAGTGAAGGGAAGG + Intronic
1164687353 19:30176177-30176199 AGGGTGAGTCAGGGATGGCTGGG + Intergenic
1164828763 19:31303911-31303933 TGTGTGGGTTAGTGCTGGGAAGG - Intronic
1164853173 19:31501279-31501301 GGAGAGGGTCTGTGATGGGAAGG - Intergenic
1165078911 19:33296707-33296729 GGGGTGGGGCTGTGAGGGGAGGG - Intergenic
1165342738 19:35224414-35224436 AGGGTGGGCAAGGGATGGGCAGG + Intergenic
1165356591 19:35308116-35308138 AGGGAGGGTGAGTGCTGGGGAGG + Intronic
1165822313 19:38684410-38684432 AGGGTGGGGCAGCACTGGGAAGG - Intronic
1166458519 19:42965484-42965506 AGGCAGGGTGGGTGATGGGAAGG + Intronic
1167644492 19:50698337-50698359 TGGCAGGGACAGTGATGGGAGGG - Intronic
1167880451 19:52453437-52453459 AGGGTGGGGCGGTGAGGGGCGGG - Intergenic
1168642472 19:58039296-58039318 AGGGTGGCTCTGGGCTGGGATGG - Intronic
924960779 2:32633-32655 AGGGTGGGACAGAGATGTGGAGG + Intergenic
925915431 2:8601125-8601147 ATGGTGGTTGAGTGAAGGGAGGG - Intergenic
926127342 2:10279681-10279703 AGGCTGGGCCAGTGAGGGGAGGG - Intergenic
926127959 2:10283465-10283487 AGGGTGAGTCAGGGTTGGGGTGG - Intergenic
926690868 2:15732509-15732531 AAAGGGGCTCAGTGATGGGAAGG - Intronic
927227169 2:20779350-20779372 GGGGTGGGGCGGTGAGGGGAGGG + Intronic
927950546 2:27165507-27165529 AGGGTGGGCACTTGATGGGAAGG - Intergenic
928691478 2:33804003-33804025 AGGCTGAGTGAGGGATGGGAAGG + Intergenic
928868699 2:35949592-35949614 AGGATGTGGCAGTGATGAGAAGG + Intergenic
929075328 2:38075535-38075557 AGAGTGGGTTGGGGATGGGAAGG - Intronic
931517641 2:63059262-63059284 AGGCAGGGTCACTGAGGGGAGGG - Intergenic
932030518 2:68178961-68178983 GGGGTGGGTAAGGGAGGGGATGG - Exonic
932242422 2:70167855-70167877 AGGGTGGTACAGGAATGGGATGG + Intronic
932311592 2:70746809-70746831 GCTGTGGGTCAGTGGTGGGAAGG - Intronic
932665066 2:73690831-73690853 AGGGAGGGTCATTGGTGGGCTGG - Intergenic
933258071 2:80103049-80103071 AGGGTGGGACAGTGCAGAGATGG - Intronic
933658434 2:84907293-84907315 AGGGTGGGGATGTGGTGGGAGGG + Intergenic
934559689 2:95306744-95306766 AAGCTGGGGCAGTGATGAGATGG - Intronic
935210574 2:100936529-100936551 AGGGTGTGCCAGTGAGGGGGAGG - Intronic
935743958 2:106174855-106174877 AGGGTGGCCCAGGGATGGGTGGG - Intronic
936980731 2:118262845-118262867 AGTGTGGGTAAGTGTTAGGATGG - Intergenic
937885488 2:126896945-126896967 AGGTGGGCTCTGTGATGGGAGGG - Intergenic
938499599 2:131823585-131823607 TGGGTGAGTCAGTGATGAGTGGG - Intergenic
939263441 2:139839818-139839840 AGGGTGGGGAGGAGATGGGATGG - Intergenic
941163045 2:162056666-162056688 AGAGTGGGTCAGTTTTGGGAGGG - Intronic
942205927 2:173620072-173620094 AGGGTCTGTAAATGATGGGAAGG + Intergenic
942209887 2:173659757-173659779 GGGGTGGGTCACTGAGGAGATGG - Intergenic
944114432 2:196171661-196171683 AGGGTGGGTCTGTCACGTGACGG + Intronic
945977745 2:216283775-216283797 CTGGTGGGTGAGTGATGGGCGGG + Intronic
946071658 2:217039396-217039418 AGGGTGGGTCAGGGCTGGATGGG - Intergenic
946212789 2:218161099-218161121 AGTGGGGGTCAGAAATGGGAGGG - Intergenic
946422443 2:219572267-219572289 AGGGTGGGTGTGGGATGGGGAGG + Exonic
946475902 2:220006014-220006036 CGGGTGGGTGGGTGATAGGATGG + Intergenic
946664638 2:222035966-222035988 AGGGTGGCTGAATGATGGAATGG - Intergenic
946881220 2:224179135-224179157 AGTGTGGGGGAGTGATGGAAAGG + Intergenic
949023747 2:241755367-241755389 AGGGTGGGGCAGGGTAGGGAAGG - Intronic
949082964 2:242120017-242120039 AGGGGGGGTCAGGAAGGGGATGG + Intergenic
1169213915 20:3783100-3783122 AAGGTGGGCCGGGGATGGGAAGG + Intergenic
1170043726 20:12064630-12064652 AGGGTGAGTCAGGCATGGAATGG + Intergenic
1171007816 20:21484593-21484615 AGGGTGGGTTAGTACTTGGATGG - Intergenic
1171724700 20:28605374-28605396 AGGGTGGGGGAGAAATGGGAAGG + Intergenic
1171788890 20:29499886-29499908 AGGGTGGGGGAGAAATGGGAAGG + Intergenic
1171858640 20:30374612-30374634 AGGGTGGGGGAGAAATGGGAAGG - Intergenic
1172057910 20:32166888-32166910 AATGTGGGGCAGTGAGGGGAGGG - Exonic
1173863163 20:46297393-46297415 ACGGGGGCTCAGGGATGGGATGG + Intronic
1174459376 20:50672027-50672049 TGGGTGGGTGGGTGATTGGATGG + Intronic
1175524848 20:59626581-59626603 AGGCTGAGTGAGTGATGGAAAGG + Intronic
1175675318 20:60941802-60941824 AAGGTGGGTGAGTTGTGGGAGGG + Intergenic
1175676480 20:60950413-60950435 TGGGTGGATGAGTGATGGGTGGG + Intergenic
1175795101 20:61766175-61766197 AGGGTGGGGTAGGGAGGGGAGGG - Intronic
1175892283 20:62321174-62321196 AGGCAGGGTCAGTGAAGGGGTGG + Intronic
1175892316 20:62321260-62321282 AGGCAGGGTCAGTGAAGGGGTGG + Intronic
1175892436 20:62321598-62321620 AGGTGGGGTCAGTGAAGGGGTGG + Intronic
1175932012 20:62497809-62497831 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932029 20:62497857-62497879 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932045 20:62497906-62497928 GGGGTGGGTCCGTGTTGGGGTGG + Intergenic
1175932059 20:62497938-62497960 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932076 20:62497986-62498008 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932118 20:62498100-62498122 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932159 20:62498214-62498236 GGGGTGGGTCCGTGTTGGGGTGG + Intergenic
1175932166 20:62498230-62498252 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932188 20:62498295-62498317 GGGGTGGGTATGTGTTGGGATGG + Intergenic
1175932209 20:62498344-62498366 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932234 20:62498409-62498431 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932268 20:62498508-62498530 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932292 20:62498573-62498595 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932305 20:62498610-62498632 TGGGCGGGTCCGTGTTGGGATGG + Intergenic
1175932332 20:62498675-62498697 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932362 20:62498772-62498794 GGGGTGGGTCGGTGTTGGGATGG + Intergenic
1175932374 20:62498804-62498826 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932394 20:62498852-62498874 GGGGTGGGTGGGTGTTGGGATGG + Intergenic
1175932406 20:62498884-62498906 GGGGTGGGTCCGTGTTGGGGTGG + Intergenic
1175932447 20:62499003-62499025 GGGGTGGGTCGGTGTTGGGATGG + Intergenic
1175932451 20:62499019-62499041 GGGATGGGTCAGTATTGGGATGG + Intergenic
1177557097 21:22704572-22704594 AATGTGGGTCTGTGATGGGAGGG - Intergenic
1178272086 21:31199872-31199894 AGGGTGAGTGAGTGAAGAGAGGG - Intronic
1178495231 21:33080649-33080671 AGGGTGGGACAGGGATTTGAAGG - Intergenic
1178925222 21:36769063-36769085 AGCCAGGGACAGTGATGGGAGGG + Intronic
1181319228 22:21991766-21991788 AGGGTGGCTCTGTGAGGGGAGGG + Intergenic
1181468749 22:23125316-23125338 AGCCTGGGTCAGTGTTGGGTGGG - Intronic
1181742913 22:24935653-24935675 AGGGTGGATGAGTCGTGGGATGG - Intronic
1182554176 22:31120154-31120176 TGTGTGGGTCAGGGATAGGAAGG - Intergenic
1183442649 22:37831904-37831926 AGGGTGGGGCAGTGGCAGGAAGG + Exonic
1183493711 22:38129938-38129960 AGGGTGGGTGAGGGCAGGGAAGG + Intronic
1183625273 22:38997827-38997849 AGGAAGGGTCAATGAAGGGAGGG - Intergenic
1183625297 22:38997904-38997926 AGGAAGGGTCAATGAAGGGAGGG - Intergenic
1183772368 22:39938166-39938188 AGGGAGGGGTAGTGAAGGGAGGG - Intronic
1184615958 22:45639059-45639081 AGGGTGGCGCAGTGTGGGGACGG + Intergenic
1185352584 22:50345926-50345948 TGGGTGGGTCACTGACTGGAGGG - Intronic
1185352619 22:50346050-50346072 TGGGTGGGTCACTGACTGGAGGG - Intronic
952883703 3:38000473-38000495 AGGGAGGGTCAGTGATAGATGGG + Intronic
953040355 3:39250679-39250701 AGGGGGGGTGGGTGATGGGTGGG - Intergenic
953342860 3:42150166-42150188 GGGGTGGGGAGGTGATGGGAGGG + Intronic
954366856 3:50151034-50151056 AGGGAGGGGGAGTGTTGGGAAGG - Intergenic
954459783 3:50619703-50619725 TGGGTGAGTCAGGGATGGGGTGG + Intronic
954750192 3:52809232-52809254 TGGGTGGGTGAGTGAATGGATGG - Intergenic
954906830 3:54070323-54070345 AGGGTGGATGTTTGATGGGAAGG - Intergenic
954954851 3:54510163-54510185 AGGGTGGGTGAGTGAGTGGAGGG + Intronic
954954875 3:54510254-54510276 AGGGTGGGTCGGTGAGTGGATGG + Intronic
955073300 3:55589680-55589702 TGGGAGGGGCAGTGAGGGGAGGG + Intronic
955112492 3:55962836-55962858 AAAGTGGGACAGTGGTGGGAAGG - Intronic
955146375 3:56324269-56324291 AGGCTGGGTGAGTCATGGGAAGG - Intronic
955756895 3:62233943-62233965 AGGGTGGGTGAGTGATGGGATGG - Intronic
955973670 3:64460895-64460917 TGTTTGGGTAAGTGATGGGAGGG + Intergenic
956327569 3:68070461-68070483 TGGGAGGGGCTGTGATGGGACGG + Intronic
956491121 3:69773268-69773290 AGGTGGGGTCAGTGAAGGAATGG + Intronic
956503928 3:69917449-69917471 AGGGTGGTTCATTCATGGTATGG + Intronic
956586690 3:70872767-70872789 AGGGTGGGTGGGTGGGGGGAAGG - Intergenic
957182231 3:76893815-76893837 AGGGTGGGTCGGTGGGAGGAGGG - Intronic
959423929 3:106162025-106162047 AATGTGGATCAGTGATGGAATGG + Intergenic
961205951 3:125081828-125081850 AGTGTGGGTGAGGGCTGGGAAGG - Intergenic
961647088 3:128398353-128398375 AGGCTGGGGCAGTGCTGAGATGG + Intronic
961736398 3:129004471-129004493 TGGGTGGGTGAGTGAGTGGATGG - Intronic
962377049 3:134867075-134867097 AGGGGGTGGCAGTGCTGGGAGGG + Intronic
965545993 3:169916916-169916938 AGGCTGGGTCGGAGATGGGCTGG - Intronic
966946001 3:184777469-184777491 ACAGTGGGTCAGCGATGGGCTGG + Intergenic
967981588 3:195069193-195069215 AGGGTGAGTATGTGATGGGCTGG + Exonic
968084607 3:195868701-195868723 AGGTTGGTTCTGTGATGGAAAGG + Exonic
968132368 3:196199017-196199039 AGGATGGGGCAGTGGTGGGGAGG - Intronic
968169112 3:196494523-196494545 AGTCTAGTTCAGTGATGGGAGGG - Intronic
968688797 4:1979052-1979074 AGGATGGCTCAGTGGTGGGGAGG - Exonic
969230689 4:5828225-5828247 AGGGTGGGTGGATCATGGGAGGG - Intronic
969687528 4:8683971-8683993 TGGGTGGGTGAGTGAGTGGATGG + Intergenic
971058652 4:22941873-22941895 CAGGTGGCTCAGTGATGTGAGGG + Intergenic
972366451 4:38379903-38379925 TGGGTGGGTCAGTGAGCGAATGG + Intergenic
974007200 4:56570627-56570649 TGGGTGGGTCAGTGAGGGAGTGG + Intronic
974587372 4:63896518-63896540 ACTATGGGTCAGTGATGGAAGGG + Intergenic
975460848 4:74651259-74651281 GGGGAGGGCCAGGGATGGGAGGG + Intergenic
976405790 4:84659459-84659481 ATGATGGGGCAGGGATGGGATGG + Intergenic
979324429 4:119362101-119362123 AGGTTGGTTCTGTGATGGGAAGG + Intergenic
981028783 4:140102796-140102818 AGACTGAGGCAGTGATGGGATGG - Intronic
981936666 4:150246819-150246841 AGGGTGGGTCAGTCAGGCGCAGG + Intronic
982081368 4:151793452-151793474 ATGGTGGGTCAGAGAGAGGAAGG + Intergenic
983242264 4:165246798-165246820 AGGTTGGTTCTGTGATGGGAAGG + Intronic
984247919 4:177297681-177297703 AGAGGGGGTCAGTTTTGGGAGGG - Intergenic
985054937 4:186027825-186027847 AAGGTGGTTCAGTTCTGGGAAGG + Intergenic
985218190 4:187675156-187675178 TGGGTGGGACAGATATGGGAGGG + Intergenic
986826810 5:11531280-11531302 AGAGGGAGTCAGGGATGGGAGGG + Intronic
988928798 5:36015558-36015580 AGTCTGGGTCTGTGATGGGAGGG - Intergenic
991215363 5:64153507-64153529 AGGGTGGGCATTTGATGGGAAGG - Intergenic
991377278 5:65978968-65978990 ACTGTGGGTCGGTGATGGGGAGG + Intronic
993101183 5:83541652-83541674 AGGGAGGCTCAGTTATGTGAAGG - Exonic
993668489 5:90730687-90730709 TGGGTGGGCCAGTGATGATAAGG + Intronic
993791444 5:92216334-92216356 AGCATGGGTCAGGGAGGGGATGG - Intergenic
993838474 5:92845636-92845658 AAGATGTGTCAGTGATGGGATGG - Intergenic
995303204 5:110610268-110610290 AAGGTGGGTGGGTGAAGGGAGGG + Intronic
996668111 5:126084315-126084337 GGGGTGGGGGAGGGATGGGAAGG + Intergenic
997235775 5:132271294-132271316 TGGCTGGGTCAGCGCTGGGAGGG - Exonic
998164519 5:139835349-139835371 AGGATGGGTGAGTGAATGGATGG - Intronic
998174657 5:139894377-139894399 TGGGTGGGACAGGGGTGGGAAGG - Intronic
998203230 5:140141824-140141846 AGGGAGGGACATGGATGGGAGGG + Intergenic
999242554 5:150136295-150136317 TGGGTGGGAGAGAGATGGGAGGG + Intronic
999843087 5:155449823-155449845 CCGCTGGGTCTGTGATGGGAGGG + Intergenic
1000522794 5:162318758-162318780 AGTCTGGGCCTGTGATGGGAGGG - Intergenic
1001536444 5:172501500-172501522 AGCGTGGGTAGGTGGTGGGATGG + Intergenic
1002562241 5:180090397-180090419 GGGGAGGGTCCGTGAGGGGAAGG + Intergenic
1002642166 5:180635475-180635497 TGGGTGGGTGGGTGGTGGGATGG + Intronic
1003075825 6:2982976-2982998 ATGGTGTGTCAGGGATGGGCTGG + Intergenic
1003166282 6:3681641-3681663 GGTGTGGGTCAGTGAGGGAATGG + Intergenic
1003279782 6:4681249-4681271 TGGGTGGGTCAGTGGTGTTATGG - Intergenic
1003618102 6:7673258-7673280 AGGGTGGGGCCGTGAAGGGAGGG + Intergenic
1004527882 6:16426278-16426300 AGGGTGGGGCACTTGTGGGAAGG + Intronic
1006510799 6:34520076-34520098 GGGAGGGGTGAGTGATGGGAGGG + Intronic
1006803902 6:36776513-36776535 AGCCTGGGGCAGTGGTGGGAGGG + Intronic
1007980975 6:46157852-46157874 AGAGTGTTTCAGTGGTGGGAAGG + Intergenic
1008591643 6:52999284-52999306 GGGGTGGGGGAGTGAGGGGAGGG + Intergenic
1010379210 6:75206668-75206690 CGCGGGGCTCAGTGATGGGATGG + Intergenic
1010828270 6:80498909-80498931 GGGGAGGGTCAGGGAAGGGAGGG - Intergenic
1010900507 6:81422560-81422582 ACTCTGGGTCTGTGATGGGATGG - Intergenic
1011464283 6:87639570-87639592 AGGCTGGGTCAGGCCTGGGAGGG - Intronic
1013337070 6:109174304-109174326 AGCCTGGATCTGTGATGGGATGG - Intergenic
1013378860 6:109546137-109546159 GGGGTGGGTCAGGGAGGGGTGGG + Intronic
1014120395 6:117718912-117718934 AGGGTGTGTGTGTGAAGGGATGG + Intergenic
1014332879 6:120093024-120093046 AGTGTTGATCAGTGGTGGGATGG + Intergenic
1014766153 6:125408972-125408994 AGGGTGGGTGAATTATGGCATGG - Intergenic
1015592367 6:134834070-134834092 AGGGTGGGTTAGGGGAGGGAGGG + Intergenic
1015842712 6:137491034-137491056 AGAGTGGGGTAGCGATGGGAGGG + Intergenic
1017132982 6:151123845-151123867 TGGGTGAGTCAGTGATGAGTGGG - Intergenic
1018203247 6:161414063-161414085 GGGGAGGGTCAGTGAGGGCAGGG + Intronic
1018503537 6:164439684-164439706 AGGGAGGGTCAGGGGTGCGACGG + Intergenic
1019423354 7:962119-962141 AGGAGGGGTCAGGGAGGGGAGGG - Intronic
1020454860 7:8360223-8360245 AGGGAAGGCCAGTTATGGGAAGG + Intergenic
1020837043 7:13166966-13166988 AGGATGGGGCTGTGGTGGGAGGG - Intergenic
1022466060 7:30653864-30653886 AGAGTGAGTCAGGGAAGGGAAGG - Intronic
1023560408 7:41467827-41467849 AGGGTGGGGAAGTGTGGGGAGGG - Intergenic
1024230137 7:47357656-47357678 AGGGTGGGCCTGGGAGGGGAAGG - Intronic
1024231608 7:47367718-47367740 AGAGCAGCTCAGTGATGGGAGGG - Intronic
1024703589 7:51932214-51932236 AGGTTGGGACATTGAGGGGAAGG - Intergenic
1024797840 7:53038735-53038757 AGGTTGGGTCAGAAATGGAATGG + Intergenic
1026863806 7:73810670-73810692 AGGGAGGGGCAGTGGAGGGAGGG - Intronic
1027053233 7:75032607-75032629 AGGGTGAGGCAGGGTTGGGATGG - Intronic
1027907193 7:84200067-84200089 AGGGTGGGTCAGGGCATGGAGGG - Intronic
1028164329 7:87520547-87520569 AGAATGGGTCACTGATGAGAAGG - Intronic
1029973646 7:104813566-104813588 AGGGTGAGTCAGGCATGGAATGG + Intronic
1029980188 7:104871403-104871425 TGGGTGGGTCAGTGAGTGAATGG + Intronic
1030152526 7:106421221-106421243 AGTGTGGGGCAGTGAGTGGAAGG + Intergenic
1030205085 7:106944603-106944625 AGGGTATGTAAGTGATGGAAGGG - Intergenic
1030761437 7:113357291-113357313 AGGTTGGATCAGTTTTGGGATGG + Intergenic
1031361295 7:120851811-120851833 ATTGTGGGTCTGTGATGGGAAGG - Intronic
1031716198 7:125111597-125111619 TGGGTGTGTCAGTGAGTGGATGG + Intergenic
1032119489 7:129145612-129145634 AGTTTGGGGCAGTGCTGGGATGG - Intronic
1032319864 7:130876082-130876104 GGGGTGGTTGAGTGATGGGGCGG - Intergenic
1034278106 7:149832916-149832938 AGGGTGGGTCTGGGCAGGGAGGG + Intergenic
1034467944 7:151240709-151240731 GGGGTGGGTCAGTGTGGGGCAGG + Intronic
1034711531 7:153196287-153196309 ATAGTGGGTCAGTGGTTGGATGG + Intergenic
1035099731 7:156386555-156386577 AGGGTGGGACAGGGAAGAGAGGG - Intergenic
1035317781 7:158007457-158007479 AGGGTGTGACAGTGATGGAGGGG + Intronic
1035559356 8:593368-593390 AGGGGGGCCCAGTGAGGGGAGGG + Intergenic
1035766730 8:2112401-2112423 GGTGGGGGTCAGGGATGGGAGGG + Intronic
1036255877 8:7206354-7206376 TGGTTGAGTCAGTGAAGGGATGG + Intergenic
1036889364 8:12585881-12585903 TGGTTGAGTCAGTGAAGGGATGG + Intergenic
1037451721 8:19022367-19022389 AGGGTGGGTGAGAGAGGGCAAGG - Intronic
1037469254 8:19191406-19191428 AGGGGGGGTGAGAGAGGGGAAGG - Intergenic
1037947253 8:22997163-22997185 AGGGTGGGACATGGATGGGGCGG + Intronic
1038314039 8:26467526-26467548 AGGGTGGGTCAGGAGGGGGAGGG - Intronic
1038702318 8:29860150-29860172 AGAGGAAGTCAGTGATGGGATGG - Intergenic
1039373318 8:37009094-37009116 AGGATGGATCAGGGAAGGGAGGG + Intergenic
1039566887 8:38558245-38558267 AGGGCGGGTCAGGGAGGGGGTGG + Intergenic
1040092246 8:43410153-43410175 AGGGTATCTCAGTGATGGGCAGG + Intergenic
1040687077 8:49886677-49886699 TGGGTGGTTGAGTGAAGGGATGG + Intergenic
1041449708 8:57994309-57994331 GGGGTGGGTCAGGGATGGGGTGG + Intergenic
1041460867 8:58109828-58109850 AGGGCAGGTTAATGATGGGAAGG - Intronic
1041628597 8:60059438-60059460 ATGGGGTGTCTGTGATGGGAAGG + Intergenic
1043078868 8:75739294-75739316 AGGTTGGGTCAGAGTTGAGAAGG + Intergenic
1043390200 8:79784399-79784421 AGGGTGGGAGAGGGAAGGGAAGG + Intergenic
1044257371 8:90081782-90081804 AGGGAGGGACAGAGAAGGGAGGG - Intronic
1045305489 8:100952920-100952942 AGTGTGGCTGAGTGATGGGGAGG + Exonic
1045852159 8:106715300-106715322 AGGGTGGCTCAGGGACAGGAGGG + Intronic
1047401028 8:124547656-124547678 AGGGTGGGTGAGGGATGGGGAGG + Intronic
1047614748 8:126555325-126555347 GGGATGGGCCAGTGAGGGGATGG + Exonic
1047632706 8:126725727-126725749 AGCTTGGTTCAGTGATGGGTTGG - Intergenic
1047862635 8:128985120-128985142 ATGGTGGGACAAAGATGGGAAGG - Intergenic
1048317020 8:133370053-133370075 AGGGTGGAGCAGGGAGGGGAGGG - Intergenic
1048633894 8:136274666-136274688 AGAGTGAGTCAGGGAAGGGAAGG - Intergenic
1049440444 8:142607190-142607212 AGGGTGGGGAAGTGAAGGGAGGG + Intergenic
1049440455 8:142607219-142607241 AGGGTGGGGAAGTGAAGGGAAGG + Intergenic
1049449556 8:142653190-142653212 AGGGTGGCTTAGTCGTGGGAAGG - Intergenic
1052018848 9:23501654-23501676 TTTGTGGGTCACTGATGGGATGG - Intergenic
1052974596 9:34401515-34401537 AGGGTGGGCCTGGGATAGGATGG - Intronic
1053363340 9:37505092-37505114 AGGCCGGGTCAGTGAAGGGAGGG + Intergenic
1053430967 9:38041490-38041512 AGGCTGGATGGGTGATGGGAAGG + Intronic
1053724912 9:40989802-40989824 AGGGTGGGGGAGAAATGGGAAGG - Intergenic
1054341058 9:63862199-63862221 AGGGTGGGGGAGAAATGGGAAGG + Intergenic
1056273548 9:84970570-84970592 AGGGTGAGTCAGCGCTGGGCAGG + Intronic
1056942122 9:90964789-90964811 AGGGTGAGTCAGTCGGGGGAAGG + Intergenic
1057256544 9:93553229-93553251 AGGGTGGGTAAAGGATGAGAAGG + Intronic
1057452201 9:95174797-95174819 AGGGTGCCTCAGTGATGGGCAGG + Intronic
1058961086 9:109993610-109993632 AGGGGGAGTCCGTGTTGGGAGGG + Intronic
1059023088 9:110597267-110597289 CCTGTGGGTCTGTGATGGGAGGG + Intergenic
1060490931 9:124083551-124083573 GTCGTGGTTCAGTGATGGGATGG - Intergenic
1060606545 9:124919747-124919769 GGGGTGGTTCTGTGATGTGAGGG + Intronic
1060656759 9:125377187-125377209 AGGCTGGTTCAGGGAGGGGATGG + Intergenic
1061583851 9:131554310-131554332 GGGGTGGGACAGTGCGGGGAGGG + Intergenic
1061800756 9:133112416-133112438 AGGGTGGGTCTGTCCTGGGCAGG - Intronic
1061808934 9:133151379-133151401 AGGGAGGGGCAGTGCTGGCAGGG - Intergenic
1061846845 9:133392909-133392931 TGGGTGGGTCAGTGGATGGATGG + Intronic
1062046707 9:134427684-134427706 AGGGTGGGTATGTGCTGGGAGGG + Intronic
1062113005 9:134792286-134792308 AGTGTGGGGCAGGAATGGGAAGG + Intronic
1062149457 9:135010010-135010032 TGGTGGGGTCAGTGTTGGGAAGG + Intergenic
1062217081 9:135395005-135395027 AGGGTGGGTGAATGAGGGGGTGG + Intergenic
1062665380 9:137668321-137668343 TGGGTGGGTGAGTGGTGGGTGGG - Intronic
1062722883 9:138053638-138053660 AGGGTGGGGCCATGAGGGGAAGG - Intronic
1203783414 EBV:113992-114014 AAAATGGGTCAGTGATGGAAAGG + Intergenic
1203449904 Un_GL000219v1:102188-102210 AGGGTGGGGGAGTAATGGGAAGG + Intergenic
1186185049 X:7012546-7012568 AGGCAGGGTGGGTGATGGGAAGG + Intergenic
1187097398 X:16162580-16162602 AGGGGGGCTCTGTGATGAGAGGG + Intergenic
1187410795 X:19049032-19049054 AGGATGGCTGAGTGAGGGGAGGG - Intronic
1190066980 X:47248146-47248168 AGGGAGGGTCACTGCTGGAAGGG - Exonic
1192222021 X:69203718-69203740 AGGGAGGGAGAGTGATGGGGTGG + Intergenic
1192433107 X:71125862-71125884 AGGGAGGGTCAAGGAAGGGATGG - Intronic
1192849179 X:74935985-74936007 AGATTGTGTCAGTTATGGGATGG + Intergenic
1194337056 X:92660722-92660744 AGTGTGGGACAGTCTTGGGATGG + Intergenic
1194968192 X:100313737-100313759 TGGATGGGTCGGTGATGAGAAGG + Intronic
1195681917 X:107553565-107553587 AGGGTGGGACAGAGTTGGAAAGG + Intronic
1195684382 X:107572305-107572327 GGTGAGGGACAGTGATGGGAGGG + Intronic
1197113380 X:122802353-122802375 AGGGTAGTACAGTGTTGGGAAGG + Intergenic
1198247783 X:134847792-134847814 AGGGAGGGGCAGGGATGGTAGGG - Intronic
1198554629 X:137779935-137779957 AGGGTGGGGCAGAGTGGGGATGG - Intergenic
1198756472 X:139987596-139987618 AGGGTGTGGCAGTTAAGGGAAGG - Intergenic
1198991597 X:142520793-142520815 ACTCTGGGTCTGTGATGGGAGGG + Intergenic
1199943055 X:152642728-152642750 AGGGTGGGACAGTGATGGGCTGG + Intronic
1200645491 Y:5777458-5777480 AGTGTGGGACAGTCTTGGGATGG + Intergenic