ID: 1096389268

View in Genome Browser
Species Human (GRCh38)
Location 12:51217064-51217086
Sequence TGGAAGGGTGGGTCAGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 3, 2: 5, 3: 62, 4: 519}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389268_1096389277 2 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127
1096389268_1096389278 3 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389268_1096389287 21 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389268_1096389280 12 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389268 Original CRISPR TGGAAGGGTGGGTCAGTGAT GGG (reversed) Intronic
900509498 1:3051820-3051842 TGGATGGGTGGGTGAGTGTATGG - Intergenic
900509571 1:3052137-3052159 TGGATGGGTGGGTGAGTAAGTGG - Intergenic
900535665 1:3175959-3175981 TGGATGGATGGGTGAGTGAGTGG - Intronic
900573480 1:3371500-3371522 TGGATGGGTGGGTGAGTGGGTGG - Intronic
900573500 1:3371563-3371585 TGGAAGGATGGGTGAGTGGGTGG - Intronic
900649885 1:3725575-3725597 TGGATGGGTGGGTGGGTGAATGG + Intronic
900731506 1:4264596-4264618 TGGAAGGGTGGATAGGTGAATGG + Intergenic
901862941 1:12086472-12086494 TGGATGGGTGGGTGGGTGAGGGG - Intronic
902202622 1:14845188-14845210 TGGATGGATGGGTGAGTGAGTGG + Intronic
902552779 1:17229218-17229240 GGGCAGGGTGGGTCAGGGTTGGG - Intronic
902650793 1:17836208-17836230 TAGGAGGGTGGGTAAGGGATAGG + Intergenic
902651099 1:17838161-17838183 TGGGAGGGTGGATGAGTGATAGG + Intergenic
903186243 1:21630964-21630986 GGGAAAGGTGGGGCAGAGATGGG - Intronic
903277483 1:22231250-22231272 TGGATGGGTGGGTGTGTGAGTGG - Intergenic
903277521 1:22231439-22231461 TGGATGGGTGGGTGAATGAATGG - Intergenic
903294253 1:22333603-22333625 TGGGTGGGTGGATGAGTGATTGG + Intergenic
903359856 1:22770120-22770142 TGGAATGTTGGGTAAGTGAATGG + Intronic
903770993 1:25764236-25764258 TGGAAGGCTGCGCCATTGATGGG - Intronic
903950028 1:26991372-26991394 GGGAAGGGAGGTTCAGTGAGGGG - Intergenic
904370333 1:30044094-30044116 TGGAAGGTGGGGTCAGTGATAGG - Intergenic
904391083 1:30186558-30186580 TGGATGGGTGGGTGGGTGAATGG - Intergenic
904804708 1:33122701-33122723 GGGAAGGATGGGTCTGTGATAGG - Intergenic
904950534 1:34234762-34234784 TGGAAGGAGGGGTCATTCATTGG + Intergenic
905274632 1:36809220-36809242 TGGATGGGTGGGTGAGTGGTTGG - Intronic
908481484 1:64544509-64544531 TGGGAGGGTGGGTCAGTGGATGG + Intronic
908910910 1:69071703-69071725 AGGAAGGATGGGTCAGTGTCTGG + Intergenic
909172953 1:72318009-72318031 TGGCAGTGTGGGTCAGGGAGGGG + Intergenic
909297159 1:73965423-73965445 TGGAAGGGGTGGACTGTGATTGG + Intergenic
910430377 1:87154219-87154241 TGGAATGGTGAGTCAGTGAATGG + Intronic
910596387 1:88985211-88985233 TGGAAGAGTGAGTAAGTGAAGGG + Intronic
911883230 1:103267917-103267939 TGGCAGCGTGGGTCAGGGAGGGG - Intergenic
912438592 1:109680568-109680590 TGGAAGGGTGGGTGAGCAGTGGG + Intronic
912441113 1:109699013-109699035 TGGAAGGGTGGGTGAGCAGTGGG + Intronic
912695927 1:111842223-111842245 GGTGAGGGTGGGTCAGTGCTGGG + Intronic
912727918 1:112075837-112075859 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
912727947 1:112075937-112075959 GGGATGGGTGGGTAAGGGATGGG + Intergenic
913106160 1:115615928-115615950 TGGATGGGTGGGAGAGTGCTGGG + Intergenic
915921345 1:159978056-159978078 TGGTGGGGTGGGGCAGTGGTGGG - Intergenic
916925899 1:169520548-169520570 TCGAAGGGTAGGTCTGTTATAGG + Exonic
917404359 1:174687504-174687526 TGGATGGGTTGGTCAGTTAATGG - Intronic
917788329 1:178483440-178483462 TGTAGGGGTGAGTCAGGGATTGG - Intergenic
919241465 1:194921953-194921975 TGGAAGCATGGGTCAGGGAGGGG - Intergenic
919805047 1:201376526-201376548 TGGAAGTGGGGGTCAGAAATAGG + Intronic
921134654 1:212249238-212249260 CGGAAGGGTGGCTCACAGATGGG + Intergenic
922029229 1:221781943-221781965 TGGAAGTCGGGGTAAGTGATGGG + Intergenic
922675627 1:227547298-227547320 TGGAAGGGGAGGTTGGTGATGGG + Intergenic
922964362 1:229675631-229675653 TGGATGGGTGGGTGAGTGAGTGG - Intergenic
923907097 1:238397254-238397276 TGGAAGTGTGGGTGAAGGATTGG + Intergenic
924100559 1:240598919-240598941 TGGATGGGTGGGTAAGTGAATGG - Intronic
924520868 1:244805048-244805070 TGGAAGGCGGGGTCAGTGAACGG - Intergenic
1063114218 10:3062483-3062505 TGAAAGGGTGAGTCAGTGAATGG - Intergenic
1063123938 10:3123991-3124013 GGGGCGGGTGGGTCAGTGCTGGG - Intronic
1063371255 10:5524424-5524446 TGAAAGGGTGGATGAGTGAATGG + Exonic
1063984101 10:11483123-11483145 TGGAAGGGTGGCTGCGGGATGGG - Intronic
1064296011 10:14079811-14079833 TGGGAAGGTGGGCCAGGGATGGG + Intronic
1064982590 10:21179464-21179486 TGGAGCGGGGGGTCATTGATTGG - Intergenic
1065741421 10:28800503-28800525 TGGAGGGGTGTGTGACTGATGGG - Intergenic
1066167371 10:32801811-32801833 TGGCAGCGTGGGTCATAGATTGG + Intronic
1066370005 10:34812742-34812764 TGAGAGGGAGGGTCAGAGATGGG - Intronic
1067289141 10:44928714-44928736 TGGATGGATGGGTGAGTGAATGG - Intronic
1067557232 10:47281303-47281325 TGGAAGGGTGGGAAAGTGGGAGG - Intergenic
1068741289 10:60474459-60474481 TGAAAATGGGGGTCAGTGATAGG + Intronic
1068971984 10:62968598-62968620 TGGAAGGGTGGGTAAGGAATTGG - Intergenic
1069192656 10:65508911-65508933 TGGCAGCGTGGGTCAGGGAGGGG + Intergenic
1069948995 10:72006704-72006726 AAGATGGGTGGGTCAGGGATTGG + Intronic
1070362113 10:75700766-75700788 TGGATGGGTGGGTGGGTGAATGG + Intronic
1071134567 10:82438286-82438308 AGGAAGGATGGGTCAGGGTTAGG + Intronic
1073342189 10:102753813-102753835 TGGAAGGGTGGGTCCTAGAATGG + Intronic
1074003356 10:109393869-109393891 AGGAAGGATGGGTCAGGGTTAGG - Intergenic
1074757609 10:116636685-116636707 TGGATGGTTGGGTGGGTGATGGG + Intronic
1075120038 10:119658266-119658288 TGAAAGGGTGGGCCAGCGAAGGG - Intronic
1076278189 10:129223855-129223877 TGTGTGGGTGGGTAAGTGATTGG + Intergenic
1076278205 10:129223926-129223948 TGTGTGGGTGGGTAAGTGATTGG + Intergenic
1076578014 10:131483737-131483759 TGGAAGGATGAGTCAGTGGATGG + Intergenic
1076837463 10:133028398-133028420 TGGATGGGTGGATGGGTGATTGG + Intergenic
1076840324 10:133042136-133042158 GGGAAGGCTGGGTCCGGGATGGG + Intergenic
1077159434 11:1106031-1106053 TGGAAGGATGGGTGGGTGAGTGG - Intergenic
1077172132 11:1171701-1171723 TGGATGAGTGGGTGAGTGAGTGG - Intronic
1077248492 11:1550493-1550515 TGGACGGGTGGAGAAGTGATGGG - Intergenic
1077294837 11:1821414-1821436 TGGATGAGTGGGTGAGTGAGCGG + Intergenic
1077310199 11:1885142-1885164 TGGATGGGAGGGACATTGATTGG - Intronic
1077312105 11:1893458-1893480 TGGATGGATGGGTTAGTGAATGG + Intergenic
1077357665 11:2126222-2126244 TGGATGAGTGGGTGAGTGAGTGG + Intergenic
1077357777 11:2126704-2126726 TGGATGGGTGGGTGAGTGGATGG + Intergenic
1077357808 11:2126840-2126862 TGGATGAGTGGGTGAGTGAGTGG + Intergenic
1078540279 11:12207475-12207497 TTGAAGTGTGGGTAAGAGATGGG + Intronic
1078746509 11:14120555-14120577 TGGGAGGGTGGGCAAGTGGTGGG - Intronic
1083606614 11:63982712-63982734 TGGAAGGGTGGGCCACACATGGG - Intronic
1083828452 11:65216450-65216472 TGGGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828505 11:65216730-65216752 TGGGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828513 11:65216754-65216776 TGGGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828525 11:65216798-65216820 TGGGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828539 11:65216846-65216868 TGGGTGGGTGGGTAAGTGAGTGG + Intergenic
1083879823 11:65542883-65542905 TGGATGGGTGGGTGAGTGGAAGG + Intronic
1083927023 11:65813806-65813828 TGGAAGAATTGGTCAGAGATGGG - Intergenic
1084161871 11:67354578-67354600 GGAAAGGGTGGGTCAGAGATTGG + Intronic
1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG + Intergenic
1084576520 11:69992134-69992156 TGGATGGATGGATGAGTGATGGG + Intergenic
1084697447 11:70764174-70764196 TGGATGGGTGGGTGGGTGAATGG - Intronic
1084750743 11:71203106-71203128 TGCAAGGGTGGGTCAGCTTTTGG + Intronic
1085876999 11:80420256-80420278 TGGGAGGGTCGGTGAGTGAGTGG - Intergenic
1086578394 11:88367457-88367479 CGGAAGTGTGGGTGAATGATAGG + Intergenic
1087017485 11:93567957-93567979 GGAAAGGGTGGGTGAGGGATGGG - Intergenic
1087048950 11:93867373-93867395 TGGAGGGGTGGCTCAGGGTTTGG + Intergenic
1088588736 11:111382367-111382389 TGGAATGGTGGGTGGGTGATGGG - Intronic
1089844946 11:121451440-121451462 AGGCAGGGTGGCTCAGTGCTTGG + Intergenic
1090210004 11:124912342-124912364 TGGGAGTGTGGGTCAGGGAGGGG + Intergenic
1090745984 11:129705086-129705108 TGGTAGGGAGGCTCAGTGGTGGG + Intergenic
1091669987 12:2446027-2446049 TGGATGGGTGGGTAAGTGGGTGG + Intronic
1093522507 12:20067159-20067181 AGGAAGGATGGGTCAGGGTTAGG - Intergenic
1094318409 12:29157521-29157543 TGGAAGGATGAGTAAGTGGTTGG - Intronic
1095690363 12:45081598-45081620 TGTAAGGATGGGTCTCTGATGGG + Intergenic
1096072366 12:48782471-48782493 AGGAAGGGCGGGTGAGTCATGGG - Intronic
1096389268 12:51217064-51217086 TGGAAGGGTGGGTCAGTGATGGG - Intronic
1096442714 12:51658956-51658978 TGGAATGCTGGGTCAGAGAATGG - Intronic
1096976296 12:55700883-55700905 TGGAAGGGTGAGTCACTCCTCGG - Exonic
1097263930 12:57735479-57735501 AGGAGGGGTGGCTCAGTGTTGGG - Intronic
1097798631 12:63889228-63889250 TGGAAGGACGAGTGAGTGATTGG + Intronic
1099062150 12:77925077-77925099 TTGAAGGGTGGGGGAATGATGGG + Intronic
1100244082 12:92739077-92739099 TGGAAGGCAGGGTGAGAGATGGG - Intronic
1100352150 12:93794792-93794814 TGGCAGGGTGGGGCAGACATAGG - Intronic
1102802035 12:115743823-115743845 TGGATGGGTGGGTCGGTGGATGG + Intergenic
1102998863 12:117370025-117370047 TGGATGGATGGGTCAGTGGGTGG - Intronic
1103027209 12:117583342-117583364 TGGATGGGTGGGTGAGTGAGTGG + Intronic
1103027222 12:117583386-117583408 TGGATGGGTGGGTGAGTGAGTGG + Intronic
1103181328 12:118914514-118914536 TGCCAGGGTGAATCAGTGATTGG + Intergenic
1103908400 12:124339123-124339145 TGGATGGGTGGGTGGGTGGTTGG - Intronic
1103908506 12:124339543-124339565 TGGATGGATGGGTGGGTGATAGG - Intronic
1104092479 12:125527536-125527558 TGGAAGGGTGGATGGGTGGTTGG - Intronic
1104092525 12:125527684-125527706 TGGAAGGGTGGCTGGGTGGTTGG - Intronic
1104888108 12:132124021-132124043 TGGGTGGGTGGGTGAGTGAATGG - Intronic
1104896213 12:132166285-132166307 TGGATGGATGGGTGGGTGATGGG - Intergenic
1104896414 12:132167073-132167095 TGGATGGATGGGTGGGTGATGGG - Intergenic
1104925691 12:132313069-132313091 TGGATGGGTGGGTGAGTGGGTGG - Intronic
1104925781 12:132313377-132313399 TGGATGGGTGAGTGAGTGAGTGG - Intronic
1104925798 12:132313449-132313471 TGGATGGGTGGGTGAGTGGATGG - Intronic
1104925812 12:132313498-132313520 TGGATGGGTGGGTGGGTGAATGG - Intronic
1104925956 12:132313981-132314003 TGTATGGGTGGGTGGGTGATGGG - Intronic
1104925971 12:132314025-132314047 TGGATGGGTGGGTGAGTGGATGG - Intronic
1104925990 12:132314089-132314111 TGGATGGGTGGGTGGGTGAGTGG - Intronic
1104942443 12:132401417-132401439 TGGATGGGTGGGTGGGTTATTGG - Intergenic
1104942451 12:132401441-132401463 TGGATGGGTGGGTGGGTTATTGG - Intergenic
1104942499 12:132401628-132401650 TGGATGGGTGGGTGGGTTATTGG - Intergenic
1104942517 12:132401692-132401714 TGGATGGGTGGGTGGGTGAATGG - Intergenic
1104954648 12:132458130-132458152 TGGACGGGTGGGTGGGTGATGGG + Intergenic
1104992630 12:132634744-132634766 CGGGAGGCTGGGTCTGTGATGGG - Intronic
1105050797 12:133048930-133048952 TGGGTGGGCTGGTCAGTGATGGG + Intronic
1105756823 13:23473397-23473419 TGGAAGGGTGGGAAAGGGAGGGG - Intergenic
1106633489 13:31502602-31502624 TGGTAGGATAGGTCAATGATTGG + Intergenic
1107080048 13:36365074-36365096 TGGAAGTGTGGGGCATTGGTGGG - Intronic
1107688300 13:42926082-42926104 TGGATGGGTGGGTGAATGAATGG + Intronic
1108160403 13:47632724-47632746 AGGAAGGATGGGTCAGGGTTAGG - Intergenic
1110676483 13:78252461-78252483 TGGAAGGGTCTGCCAGAGATGGG + Intergenic
1111016523 13:82388401-82388423 TGGAAGCATGGGTCAGGGAGGGG + Intergenic
1113912703 13:113851534-113851556 TGAATGGGTGGGTGAGTGAGTGG + Intronic
1113934041 13:113984084-113984106 TGGATGGATGGGTGAGTGATGGG - Intronic
1113934092 13:113984319-113984341 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934099 13:113984346-113984368 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934119 13:113984454-113984476 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934126 13:113984481-113984503 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934133 13:113984508-113984530 TGGATGGATGGGTGAGTAATGGG - Intronic
1113934140 13:113984535-113984557 TGGATGGGTGGGTGAGTGATGGG - Intronic
1113934160 13:113984620-113984642 TGGATGGATGGGTGAGTGATAGG - Intronic
1113934187 13:113984751-113984773 TGGATGGATGGGTGAGTAATGGG - Intronic
1113934194 13:113984778-113984800 TGGATGGGTGGGTCAGTGATGGG - Intronic
1113934394 13:113986082-113986104 TGGATGGATGGGTGAGTGATGGG - Intronic
1113934432 13:113986266-113986288 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934452 13:113986374-113986396 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934459 13:113986401-113986423 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934466 13:113986428-113986450 TGGATGGATGGGTGAGTAATGGG - Intronic
1113934473 13:113986455-113986477 TGGATGGGTGGGTCAGTGATGGG - Intronic
1113934503 13:113986595-113986617 TGGACAGATGGGTGAGTGATCGG - Intronic
1113934528 13:113986724-113986746 TGGAAGGATGGGTGAGTGATGGG - Intronic
1113934541 13:113986778-113986800 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934738 13:113988072-113988094 TGGATGGATGGGTGAGTGATGGG - Intronic
1113934776 13:113988256-113988278 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934796 13:113988364-113988386 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934803 13:113988391-113988413 TGGACGGATGGGTGAGTGATGGG - Intronic
1113934810 13:113988418-113988440 TGGATGGATGGGTGAGTAATGGG - Intronic
1113934817 13:113988445-113988467 TGGATGGGTGGGTGAGTGATGGG - Intronic
1113934837 13:113988530-113988552 TGGATGGATGGGTGAGTGATAGG - Intronic
1113934869 13:113988686-113988708 TGGATGGATGGGTGAGTAATGGG - Intronic
1113934876 13:113988713-113988735 TGGATGGGTGGGTCAGTGATGGG - Intronic
1113934912 13:113988879-113988901 TGGACAGATGGGTGAGTGATGGG - Intronic
1113934947 13:113989035-113989057 TGGACAGATGGGTGAGTGATGGG - Intronic
1113934956 13:113989087-113989109 TGGACAGATGGGTGAGTGATCGG - Intronic
1113934994 13:113989267-113989289 TGGACGGATGGGTGAGTGATGGG - Intronic
1113935006 13:113989321-113989343 TGGAAGGATGGGTGAGTGATGGG - Intronic
1113935018 13:113989374-113989396 TGGACGGATGGGTGAGTGATGGG - Intronic
1113935030 13:113989424-113989446 TGGACGGATGGGTGAGAGATGGG - Intronic
1113935048 13:113989504-113989526 TGGACGGATGGGTGAGTGATGGG - Intronic
1113935089 13:113989684-113989706 TGGAAGGATGGGTGAGTGACGGG - Intronic
1113935096 13:113989711-113989733 TGGACGGTTGGGTGAGAGATGGG - Intronic
1114367715 14:22047789-22047811 GGGAAAGGTGGGTCAGGGATAGG + Intergenic
1114530044 14:23389776-23389798 AGGAAGAGAGGGTCAGAGATGGG + Intronic
1115532183 14:34337634-34337656 TGGGAGGCTGGGTTGGTGATTGG - Intronic
1116560919 14:46377339-46377361 AGGAAGGATGGGTCAGAGTTAGG + Intergenic
1117216476 14:53557531-53557553 TGGCAGCCTGGGTCAGGGATGGG - Intergenic
1117757095 14:58986759-58986781 TGGAAAGATGGGGCAGAGATTGG - Intergenic
1118941959 14:70346782-70346804 TGGAGGGGTGGCTCAGGGTTTGG - Intronic
1120556341 14:85933001-85933023 TGGCAGTGTGGGTCAGGGAGGGG + Intergenic
1120744311 14:88140154-88140176 TGGAAGGGTGTGCTAGAGATGGG - Intergenic
1120856027 14:89213159-89213181 TGGAAGGTTGGGGGAGAGATGGG - Intronic
1121099782 14:91242511-91242533 TGGAAGGGTGGGTGGGTGGGTGG + Intronic
1121254501 14:92521265-92521287 TGGAAGGGTAGGTGAGTGGATGG - Intronic
1121485134 14:94308870-94308892 TGGATGGGTGAGTGAGTGAATGG - Intronic
1121530062 14:94646172-94646194 TGGATGGGTGGGTAAGTGAGTGG + Intergenic
1121889084 14:97572466-97572488 TGGAAGGTTGGGGTACTGATGGG - Intergenic
1122636964 14:103134580-103134602 TGGATGGGTGGGTGGGTGAGTGG - Intronic
1122741708 14:103875391-103875413 TGCATGGGTGGGTGAGTGAATGG + Intergenic
1122923749 14:104890579-104890601 TGGATGGATGGGTGAGTGAGTGG + Intronic
1124704907 15:31955741-31955763 TGGAAAATTGGGTCACTGATTGG - Intergenic
1125681208 15:41531357-41531379 GAGAAGGCTGGGTCATTGATGGG - Intronic
1126149104 15:45506299-45506321 TGGTGGGGTGGGACAGGGATGGG - Intronic
1126841273 15:52719608-52719630 TGGAAGAATGGGACAGTGCTCGG + Intergenic
1127053085 15:55105240-55105262 TGGAGGGCTGGGTCATAGATTGG - Intergenic
1128240999 15:66100897-66100919 TGGGTGGGTGGGTGAGTGAGTGG + Intronic
1129181812 15:73882469-73882491 AGGAAGGGTGGGCTACTGATAGG - Intronic
1130513151 15:84605592-84605614 GGGAAGGGTGGGTGAGGGCTTGG + Intronic
1131065329 15:89431034-89431056 TGGGAGGGTGGGTCCCAGATTGG - Intergenic
1132641046 16:978725-978747 TGAAGGGGTGGGGCAGGGATGGG + Intronic
1132726973 16:1343108-1343130 TGGGAGGGTGGGGCAGGGAAAGG + Intronic
1132998191 16:2835069-2835091 TGGATGGGTGAGTCAGTAAATGG + Intronic
1133399451 16:5473941-5473963 TGGATGGGTGGGTGGGTGATGGG + Intergenic
1133909888 16:10056273-10056295 TGGAAAGGTGGATGAGTGAAAGG - Intronic
1133925573 16:10189447-10189469 TGAAAAGGTGGGTAAGAGATTGG + Intergenic
1134893811 16:17865748-17865770 TGGAAGGATGGGTAAGTTTTTGG + Intergenic
1135159061 16:20077399-20077421 TGGAAGGATAGGTAAGTGATAGG + Intergenic
1136279205 16:29198102-29198124 TGGATGGGTGGGTGAGTGGATGG + Intergenic
1136295510 16:29299280-29299302 TGGATGGATGGGTGAGTGAATGG + Intergenic
1137272255 16:46909621-46909643 TGAAAGGCTAGGTCAGGGATGGG + Intronic
1137359061 16:47796650-47796672 TTGGAGGGTGGGTCAATTATTGG + Intergenic
1138547712 16:57729523-57729545 TGGATGGATGGGTGAGTGAGTGG + Intronic
1138547733 16:57729595-57729617 TGGATGGATGGGTGAGTGAGTGG + Intronic
1138547888 16:57730178-57730200 TGGAAGAGTGGGTGAGTGGATGG + Intronic
1139430086 16:66906440-66906462 TGGATGGGTGGGTTGGTAATCGG - Intergenic
1140067674 16:71625344-71625366 TGGATGGGTGGATGAGTGAATGG + Intergenic
1140067713 16:71625472-71625494 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
1140067746 16:71625566-71625588 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
1140067777 16:71625690-71625712 TGGACGGGTGGGTGAGTGGGTGG + Intergenic
1140067790 16:71625729-71625751 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
1140067797 16:71625749-71625771 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
1140597762 16:76436214-76436236 TGGCAGTGTGGGTCAGGGAGGGG + Intronic
1140651823 16:77096672-77096694 TGGATGGGTGGGACAGGGGTAGG - Intergenic
1140771185 16:78205577-78205599 TGGATGGGTGGGTGAGTGGAAGG - Intronic
1140894652 16:79314405-79314427 TGGAAGTCTGGGTCTGCGATGGG + Intergenic
1141823888 16:86465752-86465774 TGGGTGGGTGGGTGAGTGAATGG + Intergenic
1141982445 16:87558925-87558947 TGGATGGATGGGTGAATGATGGG - Intergenic
1142083595 16:88164203-88164225 TGGATGGGTGGGTGAGTGGATGG + Intergenic
1142128580 16:88422118-88422140 TGGATAGATGGGTGAGTGATGGG + Intergenic
1142128683 16:88422484-88422506 TGGATAGATGGGTGAGTGATGGG + Intergenic
1142128715 16:88422598-88422620 TGGAAGGGTGGATGAGTGGGTGG + Intergenic
1142128850 16:88423161-88423183 TGGATGGGTGGGTGATGGATGGG + Intergenic
1142248302 16:88979711-88979733 TGGATGGGTGGGTAGATGATGGG + Intergenic
1142248540 16:88980666-88980688 TGGATGAGTGGATCAGTGAATGG + Intergenic
1142255691 16:89012673-89012695 TGGAAGGGTGGGTGGGTGCATGG - Intergenic
1142866888 17:2796584-2796606 TGGGAGGGTGGGGGAATGATGGG + Intronic
1143457386 17:7076997-7077019 TGGATGGGAAGGTCAGTGCTGGG + Intronic
1143934919 17:10473608-10473630 TGGAAGGGTTGGACTCTGATGGG + Intergenic
1144105106 17:11977206-11977228 TGGAAGGGTGGCTCAGAAAGAGG + Intergenic
1145345390 17:21986755-21986777 TGGAAGGGAAGGTCAGGGAATGG + Intergenic
1147181804 17:38691195-38691217 AGGAAGGGTGGGTCTGGGGTGGG + Intergenic
1147609220 17:41791922-41791944 TGGAAAGTAGGGTCAGTGTTGGG - Intergenic
1148088533 17:45008930-45008952 GGGCGGGGTGGGTCAGTGGTCGG + Intergenic
1149031114 17:52083560-52083582 TGGAAGGGTGGGAGAGTGAGGGG - Intronic
1149856425 17:60087083-60087105 TGGAGGGCTGGGTAAGTGTTAGG + Intergenic
1151973251 17:77469947-77469969 TGGATGGGTGGGTGAGTGGATGG - Intronic
1152141627 17:78540492-78540514 TGGATGGGTGGGTGGGTGACTGG + Intronic
1152232437 17:79120715-79120737 TGGAAGGGTGGGTGGGTGGATGG + Intronic
1152301658 17:79498517-79498539 TGGATGGATGGGTGAGTGAGTGG - Intronic
1152301692 17:79498662-79498684 TGGATGGATGGGTGAGTGAGTGG - Intronic
1152301719 17:79498783-79498805 TGGAAGGGTGGGTGAGTGGATGG - Intronic
1152312445 17:79559381-79559403 TGGATGGGTGGATAAGTGAATGG + Intergenic
1152312575 17:79559891-79559913 TGGATGGGTGGGTGGGTGAGTGG + Intergenic
1152767106 17:82147658-82147680 TGGAAGGGTGGGTGGGTGAATGG + Intronic
1152767302 17:82148366-82148388 TGGATGGGTGGGTGGGTGAATGG + Intronic
1152767346 17:82148506-82148528 TGGATGGGTGGGTGGGTGAATGG + Intronic
1152767406 17:82148729-82148751 TGGATGGGTGGGTGGGTGAATGG + Intronic
1153351050 18:4081526-4081548 TTGAAAGGTGGGTGAGGGATGGG - Intronic
1155560459 18:27070867-27070889 TGGTAGGTTTGGTCAGTGCTGGG + Intronic
1155573501 18:27220633-27220655 TGGCAGTGTGGGTCAGGGAAGGG - Intergenic
1156369310 18:36458420-36458442 AGGAAGGGTAGGTGAGTGGTTGG - Intronic
1157924877 18:51752651-51752673 TGGAAGCCTGGCTCAGTGTTTGG + Intergenic
1158736059 18:60081264-60081286 TGGATGTGTGGGTGAGTGGTGGG + Intergenic
1160255580 18:77245756-77245778 TGAAAAAGTGAGTCAGTGATAGG + Intergenic
1160479707 18:79227449-79227471 TGGGTGGGTGGGTGAGTGAGTGG + Intronic
1160681793 19:415039-415061 TGGATGGCTGGGTTACTGATGGG + Intergenic
1160696936 19:489385-489407 TGGGAGGGCGGGTCAGAGGTCGG - Intronic
1160767781 19:816113-816135 TGGATGGATGGGTGGGTGATGGG - Intronic
1160926639 19:1549804-1549826 TGGATGGGTGGGTAGGTGAATGG - Intergenic
1160926739 19:1550136-1550158 TGGATGGGTGGGTGGGTGAATGG - Intergenic
1160958342 19:1705686-1705708 TGGACGGATGGGTCAATAATTGG + Intergenic
1160960223 19:1717646-1717668 TGGAGGGTTGGGTGAGTGAGTGG + Intergenic
1160977723 19:1802101-1802123 TGGGTGGATGGGTGAGTGATGGG - Intronic
1160977756 19:1802197-1802219 AGGGTGGGTGGGTGAGTGATGGG - Intronic
1160977770 19:1802234-1802256 TGGGTGGATGGGTGAGTGATGGG - Intronic
1161090572 19:2357990-2358012 TGGATGGGTGGGTGAGTGGGTGG - Intergenic
1161227647 19:3154521-3154543 TGGATGGGTGGGTCGGTGGGTGG + Intronic
1161347667 19:3776312-3776334 TGGATGGGTGGGTGAATGAATGG + Intergenic
1161604960 19:5209696-5209718 TGGTAGTTTGGGTCAGTGAAGGG - Intronic
1161868915 19:6855507-6855529 TGGAAGGGTGGGTGGATGAATGG - Intronic
1161916059 19:7229108-7229130 TGGATGGATGGGTGAGTGAATGG + Intronic
1162140101 19:8580483-8580505 TGGAGGGGTAGGGCAGTGCTGGG + Exonic
1163028385 19:14527671-14527693 GGCAAGGGTGAGTCAGTGCTTGG - Intronic
1163095030 19:15051011-15051033 TGGAAGGGTGAGTGGGTGAATGG + Intronic
1163350591 19:16774268-16774290 TGGAAGGGTGGGTAGATGATTGG - Intronic
1163570924 19:18081889-18081911 TGGATGGGTGGATAAGTGAAAGG + Intronic
1163571467 19:18084733-18084755 TGGATGGGTGGGTAAATGAATGG - Intronic
1163609933 19:18295489-18295511 TGGATGGGTGGGTGAGTGGATGG - Intergenic
1163675489 19:18653612-18653634 TGGATGGGTGGGTGGGTGAAGGG - Intronic
1163675509 19:18653676-18653698 TGGAAGGGTGGGTGGGTGGGTGG - Intronic
1163675523 19:18653712-18653734 TGGAAGGGTGGGTGGGTGGGTGG - Intronic
1163675549 19:18653784-18653806 TGGAAGGGTGGGTGGGTGGATGG - Intronic
1164052213 19:21593049-21593071 GGGCAGGGTGGGCCAGTGGTTGG + Intergenic
1165467580 19:35984121-35984143 AGGAAGAGTGGGTCAGTGTGGGG - Intergenic
1165759037 19:38309916-38309938 TGGATGGGTGGGTGAGTGGGAGG - Intronic
1165759171 19:38310508-38310530 TGGATGGGTGGGTGGGTGAATGG - Intronic
1166368215 19:42287765-42287787 TGGTGGGGTGGGTGAGTGAAGGG + Intronic
1166679379 19:44757793-44757815 TGGAAGGCGGGGTCAGAGCTAGG - Intronic
1166935633 19:46330761-46330783 TGGATGGGTGGATCAGTGGATGG + Intronic
1167598161 19:50438103-50438125 TGGATGGATGGGTGAGTGAATGG - Intronic
1168708548 19:58483676-58483698 CGGAAGGGTAGGTCAGAGAGAGG + Intronic
925880110 2:8345369-8345391 TGGAAGGCTGGGTCAGGGGGAGG + Intergenic
926151816 2:10429589-10429611 TGGATGGGTGGGTGAATGGTTGG + Intergenic
926151875 2:10429777-10429799 TGGATGGGTGGGTGATTGGTTGG + Intergenic
926402196 2:12508987-12509009 GGGAAGGGTGGGTGGGGGATGGG - Intergenic
927154294 2:20212817-20212839 TGGCAGGGTGGGGCTGTGCTTGG - Intronic
929048197 2:37811316-37811338 TGGAAGGGTGGGAGTGTGAGAGG - Intergenic
929410248 2:41691235-41691257 TGGGAGGGTGGTTGAATGATGGG + Intergenic
929447184 2:42010794-42010816 TGGATGGTTGGGGTAGTGATGGG - Intergenic
929753399 2:44740927-44740949 AGGAGGGGTTGGTCAGAGATTGG + Intronic
929753947 2:44747979-44748001 AGGCTGAGTGGGTCAGTGATGGG - Intronic
931721891 2:65072652-65072674 TGGAAGTGTCAGACAGTGATGGG + Exonic
935458256 2:103295842-103295864 TGGAAGTGTGTGTCTGTGTTTGG + Intergenic
935686699 2:105690043-105690065 TGGAAGAGTGGGTGAATGGTTGG + Intergenic
935743960 2:106174859-106174881 TGGAAGGGTGGCCCAGGGATGGG - Intronic
937268499 2:120632345-120632367 TGGATGGGTGGGTGAGTGGATGG + Intergenic
937977078 2:127588812-127588834 TGGATGGGTGGGTGAGTGGATGG + Intronic
937977124 2:127588989-127589011 TGGATGGATGGGTGAGTGAGTGG + Intronic
937977139 2:127589032-127589054 TGGATGGGTGGGTGAGTGGATGG + Intronic
937977366 2:127589822-127589844 TGGAAGGATGGGTGAGTGGGTGG + Intronic
938108213 2:128547466-128547488 TGGATGGGTGGGTGAGTGGATGG - Intergenic
940188974 2:151018410-151018432 TGGAATGTTGATTCAGTGATTGG - Intronic
940610255 2:155981035-155981057 TAGAAGGGTGAGTGAGTGAAAGG + Intergenic
941683005 2:168419225-168419247 TGGAAGGGTGGGTAGGAGAGAGG + Intergenic
942534557 2:176949484-176949506 TGGAAGTGTGGGAAAGAGATTGG - Intergenic
943386427 2:187208362-187208384 TGTAAGGGTGGGACACTGGTAGG - Intergenic
944606144 2:201353119-201353141 TGGGAGTGTGGGTGAGAGATTGG + Intronic
948366404 2:237457731-237457753 TGGATGGGTGGATGAGTGAATGG + Intergenic
948366426 2:237457807-237457829 TGGATGGGTGGATGAGTGAATGG + Intergenic
948673777 2:239585098-239585120 TGAAAGGGTGGGTCAGCTGTGGG - Exonic
948762075 2:240198538-240198560 TGGACGGGATGGGCAGTGATGGG - Intergenic
948839676 2:240642778-240642800 TGGGAGGGTGGCTCAGTGCTGGG - Intergenic
1169266152 20:4168320-4168342 TGGAAGGCTGGGTCTGTTTTGGG + Intronic
1169650129 20:7857864-7857886 AGTAAGAGAGGGTCAGTGATAGG + Intergenic
1171247550 20:23624522-23624544 GGGAAGGGTGAGTCACTGAAGGG + Intergenic
1172196227 20:33093487-33093509 TGGATGGGTGGGTGAGTGGGTGG - Intronic
1172196251 20:33093590-33093612 TGGATGGGTGGGTGGGTGAGTGG - Intronic
1172579676 20:36036966-36036988 TGGAGGGCTGGGGCAGTGAGAGG + Intergenic
1172800247 20:37571288-37571310 TGGGAGGGCAGGTAAGTGATGGG + Intergenic
1173154917 20:40600693-40600715 TGTCAGGGTGGGTCAAGGATTGG + Intergenic
1173615560 20:44400976-44400998 TGGAGGGGTGGGTGAGTCAAGGG + Intronic
1173863162 20:46297389-46297411 TGGAACGGGGGCTCAGGGATGGG + Intronic
1174302745 20:49594123-49594145 TGGAAGGGAGGCTCAGAGAGGGG - Intergenic
1174512105 20:51061151-51061173 TGGATGGGTGGGTGAGTGGATGG - Intergenic
1174546545 20:51329823-51329845 TGGATGGGTGGGTCGGTGGGTGG + Intergenic
1174564630 20:51456081-51456103 TGGAAGGGTGGGTGTGTGGATGG + Intronic
1175279828 20:57795524-57795546 TGGCAGTGTGGATCGGTGATGGG + Intergenic
1175818018 20:61893620-61893642 TGGATGGGTTGGTGAGTGGTTGG + Intronic
1175818043 20:61893726-61893748 TGGATGGGTGGGTGAGTGGATGG + Intronic
1175818057 20:61893777-61893799 TGGATGGGTGGGTGAGTGGATGG + Intronic
1175898984 20:62352629-62352651 GGGAGGGGCGGGTCAGTGATGGG - Intronic
1177701555 21:24645681-24645703 TGGAAAGGTGGGAGAGTGGTGGG + Intergenic
1178942705 21:36920370-36920392 TGGGAAGGTGGGGCAGAGATGGG + Intronic
1180182418 21:46123923-46123945 TGGATGGTTGGGTAGGTGATGGG + Intronic
1180848066 22:18995201-18995223 TGGAAGGGTGAGTCAGCCCTGGG + Intergenic
1181584862 22:23847602-23847624 TGGAGGGCTGGGTGAGTGTTTGG - Intergenic
1181750592 22:24986627-24986649 TGGATGGGTGGGTGGGTGGTTGG - Intronic
1181822587 22:25487447-25487469 TGGATGGATGGGTGAGTGAATGG + Intergenic
1181822699 22:25487900-25487922 TGGAAGGGTGGGTGGATGAATGG + Intergenic
1182014399 22:27026829-27026851 TGGAAGGGTGGGTTTGTGTAGGG + Intergenic
1182087027 22:27568419-27568441 TGGAAGGTCGGGGCAGTAATGGG + Intergenic
1183374108 22:37452940-37452962 TGGAATGGGAGGTCAGTGACTGG + Intergenic
1183392972 22:37556322-37556344 TGGAAGGGTGGGTAAGTAAGTGG + Intergenic
1183741236 22:39669704-39669726 TGGATGGGTGGGTGAGTGGGAGG + Intronic
1184321264 22:43743873-43743895 TGGATGGGTGGGTGAGTGGATGG + Intronic
1184444537 22:44539637-44539659 TGGATGGGTGGGTGAGTGGATGG + Intergenic
1184444638 22:44540031-44540053 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
1184744598 22:46449038-46449060 TGGAGGGGTGGGTGAATGAGTGG - Intronic
1184991154 22:48170840-48170862 TAGAAGCCTGGGTGAGTGATTGG - Intergenic
1185027203 22:48421742-48421764 TGGATGGGTGGGTTAGTGGATGG + Intergenic
1185027222 22:48421838-48421860 TGGATGGGTGGGTTAGTGGATGG + Intergenic
1185352924 22:50347341-50347363 TGGAAAGGGGAATCAGTGATTGG - Intronic
950144888 3:10641944-10641966 TGGATGGGTGAGTGAGTGAATGG - Intronic
950146203 3:10651655-10651677 TGGAAGGGTGGGTGAATGGCTGG + Intronic
950541268 3:13614690-13614712 TGGATGGGTGGGTGAGTGAATGG - Intronic
950541758 3:13617362-13617384 TGGATGGGTGGATGAGTGAATGG - Intronic
950541877 3:13617804-13617826 TGGATGGATGGGTGAGTGAGTGG - Intronic
951118321 3:18891987-18892009 TGGAAGGATGGGTAAGCTATAGG - Intergenic
951869164 3:27341194-27341216 AGGAAGGGTGGGTGAGTGCAAGG + Intronic
952900716 3:38109939-38109961 AGGAAAGGTGGGTCTGTGGTTGG + Intronic
954750193 3:52809236-52809258 TGGGTGGGTGGGTGAGTGAATGG - Intergenic
954954849 3:54510159-54510181 ATGAAGGGTGGGTGAGTGAGTGG + Intronic
954954874 3:54510250-54510272 ATGAAGGGTGGGTCGGTGAGTGG + Intronic
955034502 3:55253113-55253135 TGGAAGAGTGAGTCAGAGATTGG + Intergenic
955756896 3:62233947-62233969 GAGCAGGGTGGGTGAGTGATGGG - Intronic
956314496 3:67919499-67919521 TGGGAGGGTGGGAGAGGGATGGG - Intergenic
956873685 3:73442059-73442081 TGGCATGGTGGGGCAGTGGTGGG + Intronic
958911508 3:99999411-99999433 TGGATGGGTGGGTGAGTGGTTGG + Intronic
959418364 3:106104288-106104310 AGGAAGGATGGGTCAGGGTTGGG + Intergenic
960477249 3:118144875-118144897 AGGAAGGATGGGTCAGAGTTAGG + Intergenic
960617886 3:119612934-119612956 TGGAAGGGTGGGTGTGTGGTGGG + Intronic
961132427 3:124481585-124481607 TGCAAGGTTGGGTCATTGATGGG - Intronic
961736390 3:129004435-129004457 TGGACGGGTGGGTAGGTGAGTGG - Intronic
961736399 3:129004475-129004497 TGGATGGGTGGGTGAGTGAGTGG - Intronic
961736404 3:129004495-129004517 TGGATGGGTGGGTGGGTGAGTGG - Intronic
962220858 3:133563729-133563751 TGGCAGGGTGGGGCAGGGGTAGG - Intergenic
964358816 3:155873030-155873052 GGGAAAGGTGGTTCAGTGGTAGG - Intronic
967131309 3:186473205-186473227 TGGAAGGGAGAGTCAGAGGTTGG + Intergenic
967724922 3:192852791-192852813 TGGAAGTGGGGGTCAGTGGTGGG - Intronic
968598492 4:1497640-1497662 TGGAAGGGTGGATGATGGATGGG + Intergenic
968762058 4:2447707-2447729 TGGGTGGGTGGGTGAGTGAATGG + Intronic
968762126 4:2448078-2448100 TGGATGGGTGGGTGAGTGGGTGG + Intronic
968928127 4:3560709-3560731 TGGATGGGTGGGTGGGTGAATGG - Intergenic
969501570 4:7556676-7556698 TGGAAGGGTAGGTGGGTGACTGG - Intronic
969524105 4:7695485-7695507 TGGATGGGTGGGTGGGTGAGTGG + Intronic
969524112 4:7695505-7695527 TGGATGGGTGGGTGGGTGAGTGG + Intronic
969687527 4:8683967-8683989 TGGGTGGGTGGGTGAGTGAGTGG + Intergenic
970155108 4:13133734-13133756 AGGAAGGATGGGTCAGAGTTAGG - Intergenic
970614205 4:17752404-17752426 TGGTTGGGTGGGTCAATGAGTGG + Intronic
971199152 4:24496250-24496272 TGGATGGCTGGGTAAGTGGTAGG + Intergenic
971816605 4:31498996-31499018 TGGAAGGGTGGGTGAGTTTCTGG - Intergenic
972733313 4:41815988-41816010 TGGATGGGTGGATGAGTGAGTGG + Intergenic
974557808 4:63474215-63474237 TGAAAGGGTGGGTTAGTGGGTGG - Intergenic
977130171 4:93226347-93226369 TGCAATGGTGGGACAGTCATAGG + Intronic
978715403 4:111836828-111836850 GAGAAGGATGGGTTAGTGATGGG - Intergenic
982613979 4:157616688-157616710 TCTGAGGATGGGTCAGTGATAGG - Intergenic
983386084 4:167063671-167063693 TGGAAGGGTGGGACGGTGTGAGG - Intronic
984199742 4:176703468-176703490 GGGAAGTGTGGGTCAGTTGTGGG + Intronic
985547618 5:517937-517959 TGGAAGGGTGGATGAGCGAATGG - Intronic
985560565 5:584051-584073 TGGATGGGTGGGTGAGTGGGTGG + Intergenic
985560772 5:584774-584796 TGGATGGGTGGGTGAGTGGATGG + Intergenic
985560895 5:585198-585220 TGGATGGGTGGGTGAGTGGATGG + Intergenic
985705865 5:1401041-1401063 TGGCAGTGTGAGTCAGTGGTGGG - Intronic
985821091 5:2160838-2160860 TGGATGGGTGGGTAGGTGAAAGG - Intergenic
985837201 5:2280275-2280297 TGGATGGGTGGGGGAGTGAGTGG + Intergenic
985837354 5:2280927-2280949 TGGATGGGTGGGTGGGTGAGTGG + Intergenic
985874692 5:2585785-2585807 TGGATGGGTGGATGAGTGTTAGG + Intergenic
986020263 5:3795112-3795134 TGGATGGGTGGATAAGTGAATGG + Intergenic
987067943 5:14308308-14308330 TGGATGGGTGGTTGGGTGATTGG - Intronic
987068102 5:14309060-14309082 TGGGTGGGTGGGTAAGTGGTGGG - Intronic
987453869 5:18119608-18119630 AGGAAGGATGGGTCAGAGTTAGG - Intergenic
987607071 5:20150511-20150533 GGGAAGGATGGGGCTGTGATAGG + Intronic
987887728 5:23832304-23832326 TATAAAGGTGGGTCAGTGGTGGG - Intergenic
987927528 5:24362339-24362361 TGGAAGTATGGGTGAGTGATTGG - Intergenic
988212901 5:28229332-28229354 TTCAAGGCTGGTTCAGTGATTGG - Intergenic
990288641 5:54326811-54326833 TAGTAGGGTGGGTCAGAGAATGG - Intergenic
990745250 5:58952425-58952447 TGGAAGGGTGTGTGGGTGGTGGG + Intergenic
995428079 5:112046353-112046375 TGGAAGCATGGGTCAGGGAGAGG + Intergenic
995691420 5:114830079-114830101 TGCAAGGGTGGGGCACTGGTGGG - Intergenic
995916021 5:117245884-117245906 TGAAAGGGAGGATCAGTGTTGGG - Intergenic
996045061 5:118862673-118862695 AGGAAGGTTGGGTAAATGATAGG - Intronic
998164520 5:139835353-139835375 TGGGAGGATGGGTGAGTGAATGG - Intronic
999426153 5:151489244-151489266 GGGAAGGGTGGCTGAGTGAGAGG + Exonic
999954688 5:156687653-156687675 GGGAAAGGAGGGTCAGTGAATGG - Intronic
1000407721 5:160906451-160906473 TGGAAGGAGGAGTCAGTGAAAGG + Intergenic
1000824325 5:166025775-166025797 TGGAAAGGTGGGTCAGTTGCTGG - Intergenic
1001397580 5:171428218-171428240 AGGAATGTTGGGTCAGTGAGTGG + Intronic
1001751448 5:174134606-174134628 TGGATGGGTGGGTGGATGATGGG - Intronic
1001788832 5:174437192-174437214 AGGAAGGATGGGTCAGGGTTAGG - Intergenic
1001828779 5:174767832-174767854 TGGAAGGATGGGTGGGTGGTTGG - Intergenic
1001855770 5:175009421-175009443 TGGATGGATGGGTCAGTGGATGG + Intergenic
1001855802 5:175009565-175009587 TGGATGGGTGGGTGGGTGAGTGG + Intergenic
1001883200 5:175263332-175263354 TGAAAGGGTGGGAGGGTGATGGG + Intergenic
1002067608 5:176660001-176660023 TGGGAGGGTGGGTGAGTGGATGG - Intergenic
1002067634 5:176660112-176660134 AGGAAGGGTGGGTGGGTGACTGG - Intergenic
1002563571 5:180098166-180098188 TGGGTGGGTGAGTCAGTGGTCGG + Intergenic
1002642165 5:180635471-180635493 TGGATGGGTGGGTGGGTGGTGGG + Intronic
1002760324 6:196832-196854 TGGAAGGGTGGATGGGTGAATGG + Intergenic
1002917942 6:1544140-1544162 TGGATGGGTGGGTCGGTGGATGG + Intergenic
1003452406 6:6247544-6247566 GGGAAGGGTGGGCCAGGCATAGG - Intronic
1003972637 6:11313577-11313599 TGGATGGGTGGGTGGGTGAATGG + Intronic
1005493384 6:26367892-26367914 GGGAAGTGTGGGGAAGTGATAGG + Intronic
1005502620 6:26443284-26443306 GGGAAGTGTGGGGAAGTGATAGG + Intronic
1007594405 6:43042718-43042740 TGGAAGGGTGGGTCATTTGGAGG + Intronic
1007980974 6:46157848-46157870 TGGAAGAGTGTTTCAGTGGTGGG + Intergenic
1008468253 6:51854667-51854689 AGGAAGGATGGGTCAGAGTTAGG + Intronic
1008517846 6:52335092-52335114 GGGAAGGGTGGGTGAGGGAGGGG - Intergenic
1009532494 6:64837846-64837868 AGGAAGGGTGGGAGAGTGAGAGG + Intronic
1015662562 6:135591621-135591643 TGGGAGGGTGGGTGGATGATGGG - Intergenic
1017821318 6:158050902-158050924 TGGAAAGGTGGGAAAGGGATGGG - Intronic
1017977456 6:159370624-159370646 TGGCAGTGTGGGTCAGGGAGGGG + Intergenic
1019115533 6:169758415-169758437 TGGTGGGGTGGATAAGTGATGGG + Intronic
1019510761 7:1416183-1416205 TGGATGGGTGGGTGAGTGGATGG + Intergenic
1019567238 7:1690354-1690376 TGGATGGGTGGGTGGGTGAATGG + Intronic
1019784922 7:2969762-2969784 TGGAAGAGTGAGTGAGTGAATGG - Intronic
1020019261 7:4852878-4852900 TGCAAGGGTGGGACAGGCATAGG - Intronic
1022078545 7:26997760-26997782 TGGCAGTGTGGGTCAGGGAGGGG - Intergenic
1023318109 7:38962128-38962150 TGGAAGGATTGGACAGTAATGGG - Intergenic
1023329633 7:39100982-39101004 TGGAAAGGCGGGTCAGAGCTGGG - Intronic
1026446332 7:70487922-70487944 TGGAAGGCTGGGGCGGTGGTGGG + Intronic
1026531292 7:71199633-71199655 TGGATGGGTGGGTCGGTGGATGG - Intronic
1027262851 7:76477353-76477375 TGAAAGGGTGGGCAAGTGCTAGG + Intronic
1027314233 7:76975462-76975484 TGAAAGGGTGGGCAAGTGCTAGG + Intergenic
1029117045 7:98242896-98242918 TGGATGGGTGGGTGAGTGGGTGG - Intronic
1030718134 7:112835292-112835314 TGGATGGGTAGGTGGGTGATAGG - Intronic
1031659654 7:124406008-124406030 TGGCAGGGTGATTCAGTCATTGG + Intergenic
1032331187 7:130981809-130981831 TGGAAGGGTGAGACAGTGGGAGG + Intergenic
1032373296 7:131382640-131382662 AGGAAGGCTGGGGCAGTGAGTGG - Intronic
1034270365 7:149800775-149800797 TGGATGGGTGGGTGAGTGGGTGG - Intergenic
1035225587 7:157430470-157430492 TGGATGGGTGGGTCGGTGGATGG - Intergenic
1035230751 7:157464122-157464144 GGGAAGGGAGGGACAGGGATAGG - Intergenic
1035318543 7:158013687-158013709 TGGATGGGTGGGTGGGTGAATGG - Intronic
1035330159 7:158091625-158091647 TGGGTGGGTGGGTGAGAGATAGG + Intronic
1035330248 7:158091987-158092009 TGGGTGGGTGGGTGAGGGATAGG + Intronic
1036255876 8:7206350-7206372 TGGATGGTTGAGTCAGTGAAGGG + Intergenic
1036889363 8:12585877-12585899 TGGATGGTTGAGTCAGTGAAGGG + Intergenic
1038170744 8:25129032-25129054 TGCAAGGGTGGGGCACTGGTGGG - Intergenic
1038461491 8:27720976-27720998 TGGATGGGTGGGTGAATGAATGG - Intergenic
1039749944 8:40469471-40469493 CAGAAGGGTGGGTGAGTGAAAGG + Intergenic
1042522382 8:69727204-69727226 TGGATGGGTGGGTGGGTGAGTGG + Intronic
1042802173 8:72731135-72731157 TGGAAGGGTGAGTGAGTGAGTGG + Intronic
1043441250 8:80278877-80278899 TGAAAGTGTGGGTGAGTGAGTGG + Intergenic
1046679018 8:117146882-117146904 GGGCAGGGTGGGTCAGTGAGTGG + Intronic
1047220817 8:122916892-122916914 AGGAAGGCTGGGTCAGGGAAGGG - Intronic
1047657360 8:126992451-126992473 TGGGTGGGTGGGTGAGTGAATGG + Intergenic
1048269017 8:133013324-133013346 TGGAAGGGTGGATGAGTGGTTGG + Intronic
1048269047 8:133013496-133013518 TGGAAGGGTGGATGAGTGGATGG + Intronic
1049236575 8:141515206-141515228 TGGATGGGTGGGTGGGTGAATGG - Intronic
1049374989 8:142285170-142285192 TGGATGGATGGGTGGGTGATGGG + Intronic
1049440442 8:142607186-142607208 GGGAAGGGTGGGGAAGTGAAGGG + Intergenic
1049440454 8:142607215-142607237 GGGAAGGGTGGGGAAGTGAAGGG + Intergenic
1049455367 8:142683773-142683795 TGGGAGGGTGGGTAGGTGTTGGG - Intergenic
1049582418 8:143418615-143418637 TGGAAGGGTGCGTGGGTGAGTGG - Intergenic
1049679937 8:143913630-143913652 TGGAAAGGTGGGTCCGTGCCTGG - Intergenic
1049773250 8:144393376-144393398 TGGAAGGGTGGGTGGGTGGGTGG + Intronic
1051343089 9:16129193-16129215 CGGAAGGGTGGGCCAGGGACAGG + Intergenic
1051519261 9:17966449-17966471 CAGAAGGGAGGGTCTGTGATCGG - Intergenic
1052861898 9:33442558-33442580 TGGAAGGAGGGGTCAGAGAAAGG - Intronic
1053363338 9:37505088-37505110 TGGGAGGCCGGGTCAGTGAAGGG + Intergenic
1053802994 9:41775819-41775841 TGGATGGGTGGGTGGGTGAATGG - Intergenic
1054142268 9:61539303-61539325 TGGATGGGTGGGTGGGTGAATGG + Intergenic
1054191284 9:61987129-61987151 TGGATGGGTGGGTGGGTGAATGG - Intergenic
1054462016 9:65470450-65470472 TGGATGGGTGGGTGGGTGAATGG + Intergenic
1054647084 9:67600588-67600610 TGGATGGGTGGGTGGGTGAATGG + Intergenic
1055056611 9:72029961-72029983 TGGTTGGGTGGGCAAGTGATTGG - Intergenic
1055129115 9:72754173-72754195 GGGAAGAGTGGGCCAGTGAGAGG - Intronic
1055203925 9:73703435-73703457 TAGAAGGTTGGGTTATTGATAGG - Intergenic
1056682425 9:88731020-88731042 TGGAAGGATGGGTGGATGATGGG - Intergenic
1060792575 9:126496402-126496424 TGAATGGGTGGGTGAGTGAGTGG - Intronic
1061387571 9:130299567-130299589 TGGATGGGTGGGTGAGTGAATGG - Intronic
1061387662 9:130299967-130299989 TAGATGGGTGGGTGAGTGAGCGG - Intronic
1061716021 9:132519305-132519327 TGGATGGGTGGGTGAATGAATGG + Intronic
1061846773 9:133392656-133392678 TGGATGGGTGGGTGGGTGAGTGG + Intronic
1061846844 9:133392905-133392927 TGGGTGGGTGGGTCAGTGGATGG + Intronic
1061932088 9:133838492-133838514 TGGATGGGTGGGTAAGTGGGTGG + Intronic
1062119256 9:134825233-134825255 TGGAAGTAAGGGTCAGTGTTAGG + Intronic
1062148489 9:135004718-135004740 TGGATGGGTGGATGAGTGAATGG + Intergenic
1062217079 9:135395001-135395023 TGGAAGGGTGGGTGAATGAGGGG + Intergenic
1062247776 9:135578331-135578353 TGGATGGGTGGGTGAGTGGGTGG - Intergenic
1062247845 9:135578677-135578699 TGGATGGGTGGGTGAGTGGGTGG - Intergenic
1185616157 X:1423548-1423570 TGGATGGGTGGGTGAGTGGGTGG - Intronic
1185616302 X:1424152-1424174 TGGATGGATGGATGAGTGATTGG - Intronic
1185846273 X:3440955-3440977 AGGAAGGATGGGTCAGGGTTAGG + Intergenic
1186385319 X:9105059-9105081 TGGAATCGTGGGTCAATGCTGGG + Intronic
1186481865 X:9902180-9902202 TGGATGGGAGGGTAAGTGGTTGG + Intronic
1187382385 X:18815384-18815406 TGGAAGAGTTTGTGAGTGATTGG + Intronic
1189021612 X:37347651-37347673 TGAAAGGGTAGGTCTATGATTGG - Intergenic
1189351028 X:40275860-40275882 TGGAAGGTTGGGTCAGTCAGTGG - Intergenic
1190559268 X:51671129-51671151 TGAGAGGGTGGGTGGGTGATTGG + Intergenic
1190565023 X:51722192-51722214 TGAGAGGGTGGGTGGGTGATTGG - Intergenic
1190569633 X:51768293-51768315 TGAGAGGGTGGGTGGGTGATTGG + Intergenic
1190650334 X:52563113-52563135 TGGAAGTGTGGGTGAGTGTGAGG - Intergenic
1192172846 X:68867574-68867596 TGGCAGGGTGGGGAAGTGAAGGG + Intergenic
1193675619 X:84448286-84448308 TGGATGGGTGGGTGAGTCCTTGG - Intronic
1193874676 X:86847733-86847755 TGGAAGGGTGGGAGAGTGGGAGG - Intergenic
1194491478 X:94555371-94555393 TGGAAGTGTGGGTCTGGGAGGGG - Intergenic
1195778758 X:108438000-108438022 TGGGAGGGAGGGTGAGTAATGGG + Intronic
1196149742 X:112360132-112360154 TGAAAGGATGAGTAAGTGATGGG - Intergenic
1196176471 X:112644215-112644237 TGGAAGGAGGGGCCAGAGATTGG - Intronic
1196867512 X:120083440-120083462 TGCAAGGCTGGGTAAGTGAAAGG - Intergenic
1196875589 X:120152841-120152863 TGCAAGGCTGGGTAAGTGAAAGG + Intergenic
1197113379 X:122802349-122802371 TGGAAGGGTAGTACAGTGTTGGG + Intergenic
1197746026 X:129932547-129932569 GGGAAGGGTGGGTCGGGGAGCGG - Intergenic
1197956210 X:131951288-131951310 TGGCAGTGTGGGTCAGGGAGGGG - Intergenic
1198176479 X:134160711-134160733 CTGAAGGTTGAGTCAGTGATAGG - Intergenic
1198813335 X:140559230-140559252 GGGAAGGGTGGGTAGGTGGTAGG - Intergenic
1199943054 X:152642724-152642746 GGGCAGGGTGGGACAGTGATGGG + Intronic
1200781585 Y:7221133-7221155 TGGATGTGTGGGTGAGTGGTTGG + Intergenic
1201743302 Y:17345817-17345839 TGGAGGGGTGGCTCAGGGTTTGG + Intergenic