ID: 1096389269

View in Genome Browser
Species Human (GRCh38)
Location 12:51217065-51217087
Sequence CTGGAAGGGTGGGTCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389269_1096389287 20 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389269_1096389277 1 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127
1096389269_1096389278 2 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389269_1096389280 11 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389269 Original CRISPR CTGGAAGGGTGGGTCAGTGA TGG (reversed) Intronic
901571648 1:10165758-10165780 CTGGAAAGGGTGGTCAGGGAAGG - Intronic
901862942 1:12086473-12086495 TTGGATGGGTGGGTGGGTGAGGG - Intronic
902078426 1:13805097-13805119 CTGTAAGGCTGGGCCTGTGATGG - Intronic
902435131 1:16393493-16393515 CTGGCAGGGCCGGCCAGTGATGG + Intronic
902535858 1:17119019-17119041 GTGAAAGGGAGGGTCTGTGAGGG + Intronic
903189704 1:21649871-21649893 CTGGGAGGGTGGTGCAGTGCAGG - Intronic
903942896 1:26943874-26943896 ATGGAGGGGTGAGTGAGTGAAGG - Intronic
903950029 1:26991373-26991395 GGGGAAGGGAGGTTCAGTGAGGG - Intergenic
904699069 1:32347529-32347551 CTGGGAGAGTGGGTAAGAGAGGG + Intergenic
904820736 1:33242163-33242185 CTGCAGGGGTGGATCAGGGAGGG + Intergenic
904973619 1:34438574-34438596 GTGGATGAGTGGCTCAGTGATGG - Intergenic
906688623 1:47778405-47778427 CAGGAAGGCAGGGTCAGTGAGGG + Intronic
906689732 1:47784690-47784712 CTGGATGGGAGGGCCAGTGGAGG + Intronic
906785557 1:48612405-48612427 CTGGATGGCTGGGGCAGAGAAGG + Intronic
907717841 1:56944174-56944196 GGAGAAGGGTGGGTCAGGGAGGG - Intronic
908056660 1:60294512-60294534 CTGGAGGTGGGGGTCAGGGAAGG - Intergenic
908250469 1:62261577-62261599 CAGTAGGGGTGGGTTAGTGAAGG - Intronic
909172952 1:72318008-72318030 ATGGCAGTGTGGGTCAGGGAGGG + Intergenic
910373489 1:86543540-86543562 GAGGAAGGGAGGGTCAGTGAGGG + Intergenic
910596386 1:88985210-88985232 TTGGAAGAGTGAGTAAGTGAAGG + Intronic
911883231 1:103267918-103267940 ATGGCAGCGTGGGTCAGGGAGGG - Intergenic
912829618 1:112940643-112940665 CTGGAAAGGATGGTCAGAGATGG + Intronic
915400536 1:155618620-155618642 CTGGAAGGGATGTTCAGCGAAGG - Intergenic
915418061 1:155757626-155757648 CTGGAAGGGATGTTCAGCGAAGG - Intronic
915444459 1:155966888-155966910 CTGGGAGGGTGGGGTAGAGAGGG + Intronic
915921346 1:159978057-159978079 CTGGTGGGGTGGGGCAGTGGTGG - Intergenic
916289807 1:163152519-163152541 CTGGGTAGGTGGGTCAGTTAAGG - Exonic
916498935 1:165369892-165369914 CTGGAAGAGTGGGTCTGGGATGG - Intergenic
916839840 1:168588266-168588288 CTGACTGGGTTGGTCAGTGAAGG + Intergenic
917662312 1:177189352-177189374 CTGGGAGGTTTGGTCACTGAAGG - Intronic
918393885 1:184094484-184094506 ATGGAAGGGTGGGTCCCGGAAGG + Intergenic
918740833 1:188128564-188128586 CAGGAAGGGTGGGACACCGAAGG - Intergenic
919111431 1:193224141-193224163 CAGGAAGGGTGGGGGAGTGGAGG - Intronic
919241466 1:194921954-194921976 ATGGAAGCATGGGTCAGGGAGGG - Intergenic
919914204 1:202129998-202130020 CGGGAAGGGTGGTGCAGTGGGGG - Exonic
920765702 1:208831705-208831727 CTGGAAGGGTGTAGCAGAGAGGG + Intergenic
921134653 1:212249237-212249259 CCGGAAGGGTGGCTCACAGATGG + Intergenic
921386715 1:214577273-214577295 CTGCAAGGGTGGGTCTCTCATGG + Intergenic
922081195 1:222298593-222298615 CTGTCAGGGAGGGTCAGGGAGGG + Intergenic
923277945 1:232414967-232414989 CTTAAAATGTGGGTCAGTGAGGG - Intronic
923664886 1:235991063-235991085 ATGGCAGAGGGGGTCAGTGAGGG + Intronic
924392642 1:243580281-243580303 GTGGAAGGGTGAGTCACAGAGGG - Intronic
924423010 1:243926547-243926569 CTGGAGGGGTGGGTGGGTGCAGG - Intergenic
1063606487 10:7527090-7527112 CTGGAAGTGAGGGTCAGAGGAGG + Intergenic
1064929888 10:20613594-20613616 CTGGAAGGGTGGCTCACCCATGG - Intergenic
1065081060 10:22130083-22130105 CTGGAAGAAAGGGTAAGTGATGG - Intergenic
1065174207 10:23061217-23061239 CTGAAAGGTTGGGTCAGGGAGGG + Intergenic
1067356958 10:45538019-45538041 CTGGAAGGGTGAGTGAGATAGGG - Intronic
1067448833 10:46368968-46368990 CTGGACAGGTGAGTCAGTGAGGG - Intergenic
1067531904 10:47080372-47080394 CTGGATTAGGGGGTCAGTGAGGG + Intergenic
1067588539 10:47491797-47491819 CTGGACAGGTGAGTCAGTGAGGG + Intergenic
1067635665 10:47999888-47999910 CTGGACAGGTGAGTCAGTGAGGG + Intergenic
1067721401 10:48730253-48730275 CTGGAAGGCTGGGTGAGTCTGGG + Intronic
1069192655 10:65508910-65508932 ATGGCAGCGTGGGTCAGGGAGGG + Intergenic
1069588461 10:69627061-69627083 TATGAAGGGTGGTTCAGTGATGG - Intergenic
1070132223 10:73663895-73663917 CTGGACAGGTGAGTCAGCGAGGG + Intergenic
1070435697 10:76390632-76390654 CTGGATGGGAGGGGCAATGAAGG - Intronic
1071609459 10:87020180-87020202 CTGGACAGGTGAGTCAGCGAGGG - Intergenic
1071721523 10:88151443-88151465 CTGGATGGAGGGGTCAGTTAAGG - Intergenic
1072631863 10:97151878-97151900 CTGGGAGAGTGAGGCAGTGAAGG + Intronic
1072720043 10:97774806-97774828 CTGGAGGGGTGGGAGAGTCAGGG - Intergenic
1073084959 10:100882421-100882443 CTGGTGGGGAGGGGCAGTGAGGG + Intergenic
1075120039 10:119658267-119658289 CTGAAAGGGTGGGCCAGCGAAGG - Intronic
1075732079 10:124642391-124642413 TTTCAAGGGTGGGGCAGTGAAGG + Intronic
1075868064 10:125744587-125744609 CTGGAGGGGGCAGTCAGTGAGGG + Intronic
1076035886 10:127197651-127197673 CTGGAGAGGTGGGTGGGTGAAGG - Intronic
1076840079 10:133041466-133041488 CGGGAAGGCTGGGTCCGGGAAGG + Intergenic
1076840107 10:133041537-133041559 CGGGAAGGCTGGGTCCGGGAAGG + Intergenic
1076840160 10:133041683-133041705 CGGGAAGGCTGGGTCCGGGAAGG + Intergenic
1076840281 10:133042023-133042045 CGGGAAGGCTGGGTCCGGGAAGG + Intergenic
1076840302 10:133042079-133042101 CGGGAAGGCTGGGTCCGGGAAGG + Intergenic
1076840323 10:133042135-133042157 CGGGAAGGCTGGGTCCGGGATGG + Intergenic
1077384176 11:2261216-2261238 CTGGAAGGGGTGCTCAGGGAGGG + Intergenic
1077506210 11:2931017-2931039 CAGGTAGGGTGGGTGGGTGAGGG + Intergenic
1078378203 11:10814574-10814596 GAGGAAGGGTGGATCAGAGATGG + Intronic
1080208720 11:29760124-29760146 CAGAAAGGATGGGTCAGTGGTGG + Intergenic
1080838357 11:35961314-35961336 CTGGAGGTGTGGGAGAGTGATGG + Intronic
1083190515 11:61048635-61048657 CTGAATGGATGGGTCAGGGAAGG - Intergenic
1083606615 11:63982713-63982735 CTGGAAGGGTGGGCCACACATGG - Intronic
1083927024 11:65813807-65813829 CTGGAAGAATTGGTCAGAGATGG - Intergenic
1084545411 11:69812826-69812848 CTTGAGGGGTGGGTCACTGAAGG + Intronic
1085714007 11:78855804-78855826 CTGAAAGGGTGGGTCTGAGAGGG + Intronic
1086421424 11:86641035-86641057 CTGGGGGGGGGGGTCAATGAAGG + Intronic
1088588737 11:111382368-111382390 TTGGAATGGTGGGTGGGTGATGG - Intronic
1089624058 11:119740149-119740171 CTGGGAGGGAGGGGCAGGGAGGG + Intergenic
1090194108 11:124800253-124800275 GTGGAAGGGTCGGACAGCGATGG + Exonic
1090210003 11:124912341-124912363 ATGGGAGTGTGGGTCAGGGAGGG + Intergenic
1091562694 12:1627157-1627179 CTGGGAGGGATGGTCAGGGAAGG + Intronic
1091933407 12:4415419-4415441 CTGTAAGGGTGGGAGAATGAGGG + Intergenic
1092001978 12:5040180-5040202 CTGGCAGGGTGTGTCAGACAAGG + Intergenic
1093122797 12:15293115-15293137 CTGGAACTGTGTGTTAGTGAGGG - Intronic
1093290118 12:17309129-17309151 TTGGAAAGGTGAGTCAGGGAGGG + Intergenic
1096121050 12:49089748-49089770 CTGGAAGGGAGGGAGAGGGAGGG - Exonic
1096389269 12:51217065-51217087 CTGGAAGGGTGGGTCAGTGATGG - Intronic
1096977082 12:55705565-55705587 CTGGAAGGCTGGCTCAGCCAGGG + Intronic
1102042463 12:109809417-109809439 ATGGATGGATGGATCAGTGAGGG - Intronic
1102923593 12:116810582-116810604 TTGGAAAGGTGGGTCAGGGTGGG - Intronic
1103859132 12:123997899-123997921 CTGGGAGGGAGGCTCAGAGACGG + Intronic
1103892817 12:124252764-124252786 CGGCAAAGGTGGGTCAATGAGGG - Intronic
1104030926 12:125065457-125065479 CTGGCGGGCTGGGTCAGCGACGG - Exonic
1104631776 12:130408680-130408702 CTGAAGGGGTGGGGCTGTGAAGG + Intronic
1104679170 12:130737296-130737318 CTGGAAGGATGGGTGAATGCAGG - Intergenic
1104806447 12:131592343-131592365 CCGGAAGGGTGGGGCAGTGTTGG - Intergenic
1104954647 12:132458129-132458151 GTGGACGGGTGGGTGGGTGATGG + Intergenic
1105756824 13:23473398-23473420 CTGGAAGGGTGGGAAAGGGAGGG - Intergenic
1105843818 13:24278078-24278100 TTGGAAGGAAGGGTTAGTGAGGG + Intronic
1106302121 13:28477250-28477272 TTGGAAGGGTAGGTCCCTGATGG - Intronic
1106560454 13:30841057-30841079 CTGTAAGGCAGGGTCAGGGAAGG + Intergenic
1107139968 13:36987937-36987959 CTGGAGCGGTGGGTGAGTTAAGG - Intronic
1110084921 13:71365608-71365630 CGAGATGGGTGGGTCAATGAAGG + Intergenic
1110604622 13:77417800-77417822 CTAGAACGGTGGGTCTGGGAGGG - Intergenic
1111016522 13:82388400-82388422 ATGGAAGCATGGGTCAGGGAGGG + Intergenic
1112035542 13:95493217-95493239 CTGGGTGGGTGGGGCAGGGAAGG - Intronic
1113934024 13:113984015-113984037 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934042 13:113984085-113984107 ATGGATGGATGGGTGAGTGATGG - Intronic
1113934093 13:113984320-113984342 GTGGACGGATGGGTGAGTGATGG - Intronic
1113934100 13:113984347-113984369 GTGGACGGATGGGTGAGTGATGG - Intronic
1113934120 13:113984455-113984477 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934127 13:113984482-113984504 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934141 13:113984536-113984558 ATGGATGGGTGGGTGAGTGATGG - Intronic
1113934166 13:113984647-113984669 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113934195 13:113984779-113984801 ATGGATGGGTGGGTCAGTGATGG - Intronic
1113934377 13:113986013-113986035 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934395 13:113986083-113986105 ATGGATGGATGGGTGAGTGATGG - Intronic
1113934433 13:113986267-113986289 GTGGACGGATGGGTGAGTGATGG - Intronic
1113934453 13:113986375-113986397 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934460 13:113986402-113986424 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934474 13:113986456-113986478 ATGGATGGGTGGGTCAGTGATGG - Intronic
1113934529 13:113986725-113986747 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113934542 13:113986779-113986801 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934548 13:113986805-113986827 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113934721 13:113988003-113988025 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934739 13:113988073-113988095 ATGGATGGATGGGTGAGTGATGG - Intronic
1113934777 13:113988257-113988279 GTGGACGGATGGGTGAGTGATGG - Intronic
1113934797 13:113988365-113988387 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934804 13:113988392-113988414 ATGGACGGATGGGTGAGTGATGG - Intronic
1113934818 13:113988446-113988468 ATGGATGGGTGGGTGAGTGATGG - Intronic
1113934843 13:113988557-113988579 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113934877 13:113988714-113988736 ATGGATGGGTGGGTCAGTGATGG - Intronic
1113934995 13:113989268-113989290 ATGGACGGATGGGTGAGTGATGG - Intronic
1113935007 13:113989322-113989344 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113935019 13:113989375-113989397 ATGGACGGATGGGTGAGTGATGG - Intronic
1113935024 13:113989398-113989420 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113935043 13:113989478-113989500 ATGGAAGCATGGGTGAGTGATGG - Intronic
1113935049 13:113989505-113989527 ATGGACGGATGGGTGAGTGATGG - Intronic
1113935055 13:113989531-113989553 ATGGAAGGATGGGTGAGTGATGG - Intronic
1113935090 13:113989685-113989707 ATGGAAGGATGGGTGAGTGACGG - Intronic
1114560003 14:23582747-23582769 CTGGAAGGCTGGCTCACTCAGGG - Intergenic
1116561820 14:46389252-46389274 CTGGAAGGATGGGTGTGAGAGGG + Intergenic
1117785700 14:59282111-59282133 GGGGAAAGGTGGGACAGTGAAGG - Intronic
1118149335 14:63172899-63172921 TTGGAAGAGTGAGTCAGGGAGGG + Intergenic
1119187202 14:72651312-72651334 CCGGAAGGCAGGGTCAGGGAGGG - Intronic
1119379369 14:74218729-74218751 CTGGCAGGCAGGGTCAGGGATGG - Intergenic
1119675204 14:76548287-76548309 CAGGAAGGGTTGGGCAGGGAGGG - Intergenic
1119817079 14:77579324-77579346 TTGGAAGGGTGAGGGAGTGAGGG - Intronic
1120556340 14:85933000-85933022 ATGGCAGTGTGGGTCAGGGAGGG + Intergenic
1120595062 14:86423093-86423115 CTAGAGGGGTGGGACAGAGAGGG + Intergenic
1121292754 14:92791041-92791063 CTGGAAGGCTGTGTCAGTTCAGG - Intergenic
1121861220 14:97320662-97320684 CTGGGTGGGTGTGTCTGTGAGGG + Intergenic
1121889085 14:97572467-97572489 CTGGAAGGTTGGGGTACTGATGG - Intergenic
1123405769 15:20018689-20018711 CAGGCAGGGTTGGGCAGTGAGGG - Intergenic
1123515099 15:21025337-21025359 CAGGCAGGGTTGGGCAGTGAGGG - Intergenic
1123701524 15:22917860-22917882 CCGCAAGGCTGGGTCATTGAAGG + Exonic
1124665101 15:31585611-31585633 CTGGAAGGGTAGAGGAGTGAAGG - Intronic
1125464670 15:39939048-39939070 CTGGACAGGTAGGTCAGTGAAGG - Intronic
1128421029 15:67491790-67491812 AAGGAAGGGTGGGGCAGGGAGGG - Intronic
1129515068 15:76152301-76152323 GTGGAGGGGTGGGTCGCTGAGGG + Intronic
1129868083 15:78924114-78924136 TGGGCAGGGTGGGTCAGGGAAGG + Intronic
1131226295 15:90627020-90627042 TTGGAAGGGATGCTCAGTGATGG + Intronic
1131776124 15:95800804-95800826 GTGGTAGGGTGGGTCAGGGAAGG + Intergenic
1132641045 16:978724-978746 CTGAAGGGGTGGGGCAGGGATGG + Intronic
1132702874 16:1229527-1229549 CTGGAAGGGTGGGGAAGGGCTGG - Intronic
1133399450 16:5473940-5473962 ATGGATGGGTGGGTGGGTGATGG + Intergenic
1135966836 16:27042523-27042545 CTGGAAGGGTGGGGAAGTTCGGG - Intergenic
1138454317 16:57112638-57112660 CTGGTACTGTGGGTCAGTGGTGG - Intronic
1138655765 16:58490429-58490451 CAGGGAGGGAGGGGCAGTGAGGG - Intronic
1140597761 16:76436213-76436235 ATGGCAGTGTGGGTCAGGGAGGG + Intronic
1141500920 16:84443519-84443541 CAGGAAGGGAGGGTGAGTGCAGG - Intronic
1141904397 16:87014228-87014250 CTGGGTGGGTGAGTGAGTGAGGG - Intergenic
1142128722 16:88422625-88422647 ATGGATGGGTGGGTGAGTGATGG + Intergenic
1142255683 16:89012654-89012676 ATGGAAGGGTGGGTGGGTGGAGG - Intergenic
1143175605 17:4953249-4953271 CTGGAAGGGTGAGTTTGAGAAGG - Intronic
1144876562 17:18400195-18400217 CTAGAATGGTGGGTCAGACAAGG - Intergenic
1145155664 17:20544225-20544247 CTAGAATGGTGGGTCAGACAAGG + Intergenic
1146686318 17:34843877-34843899 CAGGAAGGGTGGGTGAGGCAGGG + Intergenic
1147203609 17:38821137-38821159 ATGGAAGGGTGGGTGAGGCAGGG - Intronic
1147609221 17:41791923-41791945 CTGGAAAGTAGGGTCAGTGTTGG - Intergenic
1147763712 17:42818681-42818703 CTGGAAGTGTGGGAGAGTCAGGG + Intronic
1148189149 17:45666750-45666772 ATGGAAGGATGTGACAGTGATGG - Intergenic
1149031115 17:52083561-52083583 TTGGAAGGGTGGGAGAGTGAGGG - Intronic
1149550342 17:57535003-57535025 CTGGAGGGGAGGGACAGGGAGGG + Intronic
1151984485 17:77533350-77533372 CTGGGGGGGTGGGTAAGGGAGGG + Intergenic
1152079404 17:78177098-78177120 CTGGACGGGTGGGGAAGTGCCGG - Intronic
1152754274 17:82080651-82080673 CTGGAAGCGGTGGTCAGTGCTGG - Intronic
1153195155 18:2587047-2587069 CTGGAAAGGTGTATCACTGATGG - Intronic
1154502265 18:15002826-15002848 CAGGAAGAGTGTGCCAGTGAAGG - Intergenic
1155573502 18:27220634-27220656 ATGGCAGTGTGGGTCAGGGAAGG - Intergenic
1156233977 18:35183329-35183351 GTGGGAGGCTGGGTCAGTCACGG - Intergenic
1156535040 18:37854290-37854312 CTCTAAGGGAGGGTCAGAGATGG + Intergenic
1157638337 18:49184977-49184999 TTGGAAGGGGTGGTCAGGGAAGG + Intronic
1157701193 18:49762397-49762419 CTTGAAGGGTGGCTCAGGGAGGG - Intergenic
1157872988 18:51247451-51247473 TTGGCAGGGTGGGGCAGTGGGGG - Intergenic
1158000336 18:52611123-52611145 CAGGAGGGGGGGGTCACTGAAGG - Intronic
1158027828 18:52923051-52923073 CTGAAACCCTGGGTCAGTGAAGG - Intronic
1158458714 18:57629599-57629621 CTGGACCAGTGGGTCAGTCAGGG - Intergenic
1160032451 18:75274151-75274173 CAGGAAGGGTGGGGGAGTGATGG + Intronic
1161604961 19:5209697-5209719 GTGGTAGTTTGGGTCAGTGAAGG - Intronic
1161727910 19:5941054-5941076 CTGGAAGGGTGGGCCAGGCTCGG - Intronic
1163462254 19:17446125-17446147 GTGGATGGGTGGGTGAGGGATGG - Intronic
1163610891 19:18301032-18301054 CTGGAGGGGTGGGGCAAGGAGGG + Intergenic
1163675490 19:18653613-18653635 ATGGATGGGTGGGTGGGTGAAGG - Intronic
1164154973 19:22588453-22588475 CTGGAGAGGTGGGTGAGAGATGG + Intergenic
1164492327 19:28726972-28726994 TTGGAAAGGTGGGTCAGTGGTGG + Intergenic
1164732949 19:30519643-30519665 CTGGAAGGGCAGGTCAGAGGTGG + Intronic
1165467581 19:35984122-35984144 GAGGAAGAGTGGGTCAGTGTGGG - Intergenic
1166012254 19:39951190-39951212 CTGGTATGGTGGGGAAGTGAAGG + Intergenic
1166368214 19:42287764-42287786 CTGGTGGGGTGGGTGAGTGAAGG + Intronic
1166561121 19:43733003-43733025 CTGGAAAGTTGGGGCAGGGAGGG + Intronic
1166582030 19:43909469-43909491 CAGGAAAGGTGGGACTGTGAAGG - Intergenic
1166701286 19:44883221-44883243 CAGGCAGGGTGGGTCAGGCAGGG + Intronic
1167144012 19:47671561-47671583 CTGGAAGGATGGGTCTGTGTGGG + Intronic
1167174955 19:47859149-47859171 CTGGCAGGGTGGGCCAGGGTGGG + Intergenic
1167281058 19:48568812-48568834 CTGGAAGGGTGGGCCGCTCAGGG + Intronic
1167420665 19:49401174-49401196 CTGGAAGGGTGTGGAAGTGGTGG - Intronic
925139387 2:1539561-1539583 CCGCAAGGGTGGGGCGGTGACGG + Intronic
925803207 2:7622780-7622802 TTGCAAGGTTGGGTCAGAGAAGG + Intergenic
925902183 2:8516537-8516559 CTGGAAGGGTGTGTGAGGGGTGG - Intergenic
926835187 2:17011367-17011389 CTGGAAGTGTGGGGGAGTCATGG + Intergenic
927380744 2:22476697-22476719 CTGCAAGGGTGGGTCCCTCATGG + Intergenic
927613185 2:24563065-24563087 TTGAAAGAGTTGGTCAGTGATGG + Intronic
928900990 2:36317270-36317292 CTAGAATGGAGGGTCAGGGATGG + Intergenic
929962800 2:46509012-46509034 CTGGAAGGGAGGGTAACAGAAGG - Intronic
930210952 2:48635955-48635977 GTGGAAAGGTGAGTCACTGAGGG + Intronic
931136042 2:59402444-59402466 CTAGATGGGTGGATCACTGAAGG - Intergenic
932839459 2:75068033-75068055 CTGGAAGGGTGTATCAGTCAGGG + Intronic
933336547 2:80966764-80966786 GTGGAAAGGTGGGTCACAGAGGG - Intergenic
934731770 2:96663371-96663393 CTGGAAGGTGAGGTCAGTGGAGG + Intergenic
935743961 2:106174860-106174882 TTGGAAGGGTGGCCCAGGGATGG - Intronic
938080430 2:128367199-128367221 CTGGGAGCTTGGGCCAGTGAGGG + Intergenic
942725464 2:179002049-179002071 CTGGGAGGGTGGATCAGTTGAGG - Intronic
943501314 2:188693152-188693174 ATGCAATGGTGGGTCAGGGAAGG + Intergenic
945972316 2:216242968-216242990 ATGGAAGGATGGATAAGTGAAGG - Intergenic
946664639 2:222035971-222035993 CTGGCAGGGTGGCTGAATGATGG - Intergenic
948245059 2:236475125-236475147 CTGGAAGGGCAGGTGGGTGAGGG - Intronic
948673778 2:239585099-239585121 CTGAAAGGGTGGGTCAGCTGTGG - Exonic
948756852 2:240165117-240165139 CTGGAAGGGCGGGACAGTGGTGG + Intergenic
948823958 2:240565526-240565548 CTGGGAGGGTGGCTCAGACACGG - Intronic
948839677 2:240642779-240642801 GTGGGAGGGTGGCTCAGTGCTGG - Intergenic
948887293 2:240890661-240890683 CTTGAAGGGTGGGCCCATGAGGG - Intronic
1169162292 20:3391349-3391371 CTGGGAGTGTGGGTCATTGTGGG - Intronic
1169873914 20:10275443-10275465 CTGGGCTGGGGGGTCAGTGACGG - Exonic
1171112721 20:22499392-22499414 CTCGAATGGTGGCTCTGTGATGG - Intergenic
1171245572 20:23607467-23607489 TAGGAAGGGGGTGTCAGTGAGGG + Intergenic
1171247549 20:23624521-23624543 TGGGAAGGGTGAGTCACTGAAGG + Intergenic
1172701116 20:36854283-36854305 AGGGAAAGGTGGGGCAGTGATGG + Intronic
1172800246 20:37571287-37571309 CTGGGAGGGCAGGTAAGTGATGG + Intergenic
1173615559 20:44400975-44400997 TTGGAGGGGTGGGTGAGTCAAGG + Intronic
1174230292 20:49040779-49040801 CTGGAAGGGCAGGTCAAAGATGG + Intergenic
1174292314 20:49517876-49517898 CTGGAAGGATGGGTCAGTCCTGG - Intronic
1174302746 20:49594124-49594146 ATGGAAGGGAGGCTCAGAGAGGG - Intergenic
1175520647 20:59600582-59600604 CTGCAAAGGTGGCTCAGGGATGG - Intronic
1175775452 20:61650465-61650487 CTGGAAGCGTGGGTAAATGCTGG + Intronic
1175898985 20:62352630-62352652 GGGGAGGGGCGGGTCAGTGATGG - Intronic
1178261193 21:31101123-31101145 CTGGGGTGGTGGGGCAGTGAGGG + Intergenic
1179574566 21:42299751-42299773 CGAGAGGGGTGGGTCAGTAAGGG - Intergenic
1180075102 21:45458088-45458110 CTGGAATGGAGGGGCAGGGAGGG + Intronic
1181357137 22:22305187-22305209 CTGGAAGGGTGGGTTGTTGCAGG + Intergenic
1181362561 22:22349356-22349378 TTGGAGGTGTGGGACAGTGAGGG + Intergenic
1182014398 22:27026828-27026850 GTGGAAGGGTGGGTTTGTGTAGG + Intergenic
1182925889 22:34124436-34124458 AGGGAAGGGTGGGACTGTGAAGG - Intergenic
1183717972 22:39545266-39545288 CTGGAGGCATGAGTCAGTGAGGG + Intergenic
1184277104 22:43415147-43415169 CTGGAAGGGATGCTCACTGATGG - Intronic
1184414290 22:44343162-44343184 CTGGGATGGTTGGTCAGTGGAGG + Intergenic
1184640550 22:45867874-45867896 CTGGAAGGAGGGGACAGGGAGGG - Intergenic
1185085837 22:48740615-48740637 CTGAGAGTGTGGGCCAGTGACGG - Intronic
949147853 3:724752-724774 TTGGAAGGGTCGGGCAGAGAGGG + Intergenic
949943537 3:9172818-9172840 CTAGAAGGGTGAGACAGAGACGG + Intronic
950165131 3:10791604-10791626 CTGGCTGGGTTGGTCAGTCAGGG + Intergenic
950541795 3:13617541-13617563 CTGGATGGGTGGATGAATGAAGG - Intronic
950638793 3:14334512-14334534 CTGGAAGGTGGGGACACTGATGG - Intergenic
952285680 3:31967173-31967195 CTGGAAAGATGTCTCAGTGAGGG - Intronic
953055103 3:39381678-39381700 CTGGAAGGGTGAGGGAGTGGAGG + Intergenic
953275340 3:41490343-41490365 CTGGAAGTGTGGGTCTGTGCTGG - Intronic
953733312 3:45468678-45468700 CTGAAAAGGTGGGTCAGAGGGGG + Intronic
953972108 3:47355842-47355864 AGGGAGGGGTCGGTCAGTGACGG - Intergenic
954580525 3:51700671-51700693 CTGGGTGGGTGGGTCAAGGAGGG - Intronic
954871963 3:53774226-53774248 CTGGGGGGCTGGGTCAGGGAAGG - Intronic
954921380 3:54194067-54194089 CGGGAAGGGTGTGTGAGTGGTGG + Intronic
956966342 3:74465713-74465735 CTGGCAGGGTGGGGCAATGGAGG - Intronic
959161041 3:102724758-102724780 CTGGAAGGGCGGGGCCGTCATGG + Intergenic
959253424 3:103978000-103978022 CTGGGCGTGTGGTTCAGTGATGG - Intergenic
959754004 3:109875050-109875072 GTGGAAGGGTGAGTCACAGAGGG - Intergenic
960423683 3:117480308-117480330 CTCAAAGGGTGTGTGAGTGAAGG + Intergenic
960617885 3:119612933-119612955 CTGGAAGGGTGGGTGTGTGGTGG + Intronic
960902436 3:122565712-122565734 CTGGAATGGTGGGTTGGCGATGG - Intronic
961132428 3:124481586-124481608 ATGCAAGGTTGGGTCATTGATGG - Intronic
961410372 3:126716146-126716168 CTGGAACTGGGAGTCAGTGAAGG - Intronic
961802376 3:129461629-129461651 CTGCCAGGGTGAGTCAGGGAAGG - Intronic
962665543 3:137650498-137650520 GTGGAATGGTGGGTAGGTGAGGG - Intergenic
966085126 3:176061656-176061678 CAGGCAGGCTGAGTCAGTGAAGG - Intergenic
966686106 3:182697672-182697694 CTAAAAGGGTGGGTTACTGATGG + Intergenic
966974242 3:185070808-185070830 CTGACACGGTGGGTCAGTGCGGG + Intergenic
967724923 3:192852792-192852814 CTGGAAGTGGGGGTCAGTGGTGG - Intronic
968741181 4:2332487-2332509 CTGGAAGGGGGACTCAGTGCAGG - Intronic
968931194 4:3580389-3580411 ATGGAAAGGTGGGTGGGTGATGG - Intronic
969627048 4:8311035-8311057 CTGGGAGAGGGGCTCAGTGATGG - Intergenic
970396916 4:15677635-15677657 CTGGGAGGGTGGCACAGAGAGGG + Intronic
970695746 4:18674966-18674988 CTGGAAGGGTTGCACAGGGAAGG + Intergenic
971168033 4:24204449-24204471 CTGAAAGGGAGGGACAGGGAAGG + Intergenic
971237316 4:24854469-24854491 CTGGAAGGGGGGATCATTCAAGG + Intronic
971257009 4:25023647-25023669 CTGGAAGTGTTGGGCAGGGATGG - Intronic
971466159 4:26964117-26964139 CTGGGAGATTGGGTCAGAGAAGG + Intronic
971950059 4:33332944-33332966 CAGGAAGGGTGGGTCAGCGCAGG - Intergenic
972286911 4:37657878-37657900 CTGGGAGGGTGGGTCAGCCTGGG + Intronic
972730222 4:41787621-41787643 TGGGAAGGGTGGGTAAGGGAGGG + Intergenic
975608290 4:76178573-76178595 CTAGAAGGGAGGTTCAGTCAGGG + Intronic
979162206 4:117476643-117476665 CCTAAAGGGTGGTTCAGTGAAGG - Intergenic
980181528 4:129407258-129407280 CTGGAAGGATGGCTAAGTGGGGG + Intergenic
980572198 4:134634606-134634628 CTAGATGGGTGGATCAGTGGAGG - Intergenic
985705866 5:1401042-1401064 CTGGCAGTGTGAGTCAGTGGTGG - Intronic
985731087 5:1549285-1549307 CTGCACGGGTGGGCCAGTGACGG + Intergenic
985826418 5:2195055-2195077 TTGGAAGGGTTGGACAGGGATGG - Intergenic
988071448 5:26293852-26293874 CTGGAAGTCTTGGTCAGTGTGGG - Intergenic
993301976 5:86223012-86223034 CTGGAAGGGTGTGTGGGTGGGGG + Intergenic
993538539 5:89119066-89119088 CTGAAAGGCTGGGTCACTAAGGG + Intergenic
993767064 5:91873508-91873530 CTGAAAGTGTGTCTCAGTGAGGG - Intergenic
995531835 5:113099029-113099051 CTAGGTGGGTGGGTGAGTGACGG + Intronic
998033662 5:138894702-138894724 CAGGATGGGTGGGTCAGGGGAGG - Intronic
998581179 5:143377655-143377677 CTGATAGGGTGTATCAGTGAAGG - Intronic
999256413 5:150212094-150212116 CTGGAAGACTGGGCCAGGGAGGG - Intronic
999272822 5:150307551-150307573 CTGGAAGCGAGGGTCAGAGGGGG - Intronic
999351049 5:150872302-150872324 ATGGCAGCGTGGGTCAGGGAGGG - Intronic
999407251 5:151317217-151317239 CTAGATGGGTGGATCACTGAAGG + Intronic
1000019047 5:157303189-157303211 CTGACAGAGTGGGTCAGTGGTGG - Intronic
1000289948 5:159860931-159860953 CTGGGAGAGTTGGCCAGTGAGGG + Intergenic
1001833705 5:174811670-174811692 CTGGATGGGTGGGTTGGTGGTGG - Intergenic
1002143660 5:177161406-177161428 CTGGGAGGGTGGGGCAGGAAGGG + Intronic
1002636800 5:180612665-180612687 CAGGAAGGCTGGGGCACTGAAGG - Intronic
1004426850 6:15512604-15512626 CTGGAGGGGTCTGTCAGTAACGG - Intronic
1006313148 6:33275650-33275672 CTGGAAAGGTGGGTGAGGAAAGG + Intronic
1006896478 6:37474635-37474657 CTGAAAGGGGAGGTCAGAGATGG + Exonic
1007303565 6:40887098-40887120 CTGGCAGGAATGGTCAGTGAGGG - Intergenic
1007585145 6:42984788-42984810 CTGGACGGGAGGGTCAGTCTGGG - Intronic
1007764961 6:44154819-44154841 CTGGAAGTCTGTGTCCGTGAGGG - Exonic
1008517847 6:52335093-52335115 TGGGAAGGGTGGGTGAGGGAGGG - Intergenic
1009595904 6:65736092-65736114 CCAGAAGGGTGGGAGAGTGAGGG + Intergenic
1009683046 6:66923617-66923639 CTGGAAGTGTGGGTGACTCAAGG - Intergenic
1009974177 6:70655437-70655459 CTGGTAGGGAGGGTGAGGGAAGG - Intergenic
1011034976 6:82963734-82963756 CTGTGAGGGTGTGTCTGTGAAGG - Intronic
1011653803 6:89531556-89531578 CTGGAGGGATGGGGCAATGACGG - Intronic
1017977455 6:159370623-159370645 ATGGCAGTGTGGGTCAGGGAGGG + Intergenic
1018978235 6:168581930-168581952 TTGGAAAGGGGGGTCAGAGAAGG - Intronic
1019269524 7:139245-139267 CTGGAAGGGTGGGTTACTCCAGG + Intergenic
1019301255 7:305131-305153 CTCGTAGGGTGGGGCTGTGACGG + Intergenic
1019338349 7:495551-495573 CTGGCTGGGAGAGTCAGTGACGG - Intergenic
1021748408 7:23768111-23768133 CTGCATGGTTTGGTCAGTGATGG + Intronic
1021829674 7:24592269-24592291 CTGCTAGGTTGGGTCAGGGAAGG + Intronic
1022078546 7:26997761-26997783 ATGGCAGTGTGGGTCAGGGAGGG - Intergenic
1022957116 7:35391063-35391085 CTGGAAGGGTGTGGCAGAGACGG + Intergenic
1023022060 7:36019416-36019438 GTGGCAGGGTGGGACAGGGAAGG + Intergenic
1023967327 7:44969756-44969778 CAGGAAGATTCGGTCAGTGATGG + Exonic
1024006736 7:45229796-45229818 GTGGAGGGGTGTCTCAGTGAGGG + Intergenic
1024284952 7:47748831-47748853 CAGGAAGGGTGGGTTACTCAAGG + Intronic
1031152554 7:118071190-118071212 TTGGAAGTGTGGGTCTGTGAGGG + Intergenic
1034633713 7:152550787-152550809 CTGGCAGGGTGGGTTAGTGGGGG - Intergenic
1035330215 7:158091866-158091888 ATGGGTGGGTGGGTGAGTGAGGG + Intronic
1035834433 8:2733619-2733641 CTGCAAGGGTGAGGCAGAGAGGG + Intergenic
1035843607 8:2839566-2839588 CTGGATGGGTGGTACCGTGACGG - Intergenic
1036188000 8:6641929-6641951 CAGGAGGCCTGGGTCAGTGAGGG - Intronic
1036255875 8:7206349-7206371 ATGGATGGTTGAGTCAGTGAAGG + Intergenic
1036618768 8:10408725-10408747 GTGGGAGGGTGGGGGAGTGAGGG - Intronic
1036625378 8:10466976-10466998 CTGGAAGTATGGGACTGTGAAGG - Intergenic
1036889362 8:12585876-12585898 ATGGATGGTTGAGTCAGTGAAGG + Intergenic
1037804322 8:22050630-22050652 CTGGCAGGGAGGGACAGAGAAGG + Intronic
1038086380 8:24201895-24201917 CTGGAAGGATGCATCAATGACGG + Intergenic
1038097054 8:24325022-24325044 CTGCAAGGCTGGTTCATTGAGGG + Intronic
1045727032 8:105186015-105186037 CAGGAAGGGTGGGGCAGTACAGG + Intronic
1045985461 8:108245113-108245135 ATGGGAGGGGGGGGCAGTGAGGG - Intronic
1047088790 8:121550348-121550370 CTAGGAGGGAGGGTCAGGGAGGG - Intergenic
1047220818 8:122916893-122916915 AAGGAAGGCTGGGTCAGGGAAGG - Intronic
1047566305 8:126047452-126047474 GTGAAAGGGTGGATCAGAGAGGG + Intergenic
1047806771 8:128369248-128369270 CTGGAAGTGAGTGTCAGGGAAGG + Intergenic
1049440441 8:142607185-142607207 AGGGAAGGGTGGGGAAGTGAAGG + Intergenic
1049440453 8:142607214-142607236 AGGGAAGGGTGGGGAAGTGAAGG + Intergenic
1049455368 8:142683774-142683796 CTGGGAGGGTGGGTAGGTGTTGG - Intergenic
1050544898 9:6701427-6701449 CTGGGAGGCTGGGGCAGGGAGGG + Intergenic
1050619097 9:7433976-7433998 CAGGAAGGGTGGGTCAGCTTGGG + Intergenic
1053363337 9:37505087-37505109 CTGGGAGGCCGGGTCAGTGAAGG + Intergenic
1053405477 9:37871763-37871785 CTGTAAGGGTGGGGGAGTCAGGG - Intronic
1054458961 9:65451681-65451703 ATGGAAAGGTGGGTGGGTGATGG + Intergenic
1055641159 9:78320056-78320078 ATGGATGGGTGGGTCAATGGTGG - Intronic
1056655273 9:88503699-88503721 CAGGAAGAGTGGGTTAGGGAAGG + Intergenic
1057171338 9:92965035-92965057 CTGGCAGTGTGGGACAGTGGCGG + Intronic
1057414265 9:94847271-94847293 CTGGAAGGGTGGGTGGGGAATGG + Intronic
1059425299 9:114217299-114217321 CATGAAGGGTGCCTCAGTGAGGG - Intronic
1060277812 9:122195107-122195129 CTGGATGTCTGGGTCTGTGAAGG + Intronic
1061009012 9:127944408-127944430 CTGGGAGCCTGGGGCAGTGAGGG - Intronic
1061202162 9:129144127-129144149 CTGGAAGGGCAGGTGAGAGAAGG - Intronic
1061989123 9:134148566-134148588 TTGTTAGGGTGGGTCAGGGAGGG + Intronic
1062044114 9:134417376-134417398 GTGGGAGGGTGAGTGAGTGAGGG - Intronic
1062217078 9:135395000-135395022 ATGGAAGGGTGGGTGAATGAGGG + Intergenic
1062443293 9:136583069-136583091 TTGGCAGGGTGGGGCAGAGATGG + Intergenic
1062498217 9:136841525-136841547 CAGGAAGAGTGTGCCAGTGAAGG + Intronic
1187787566 X:22909859-22909881 CTGGAGGGGAGGGTCAGGAAAGG + Intergenic
1190066982 X:47248151-47248173 CTAGAAGGGAGGGTCACTGCTGG - Exonic
1191087912 X:56588539-56588561 CAGGAAGGGTGGGACAGTTCAGG + Intergenic
1192172845 X:68867573-68867595 CTGGCAGGGTGGGGAAGTGAAGG + Intergenic
1192767967 X:74161925-74161947 CTGCAAGGGTGCTTCAGTGAAGG + Intergenic
1194491479 X:94555372-94555394 ATGGAAGTGTGGGTCTGGGAGGG - Intergenic
1195923623 X:110004408-110004430 CTGGAAGGGAGGGGCAGCCAGGG - Intronic
1196018052 X:110960405-110960427 TTGCAAGGGTAGCTCAGTGAAGG - Intronic
1196613657 X:117742954-117742976 CAGGAAGGGTGGGGCAGTTCAGG - Intergenic
1197771413 X:130091995-130092017 CGGGAAGGGTGGGGCAGGGCAGG - Intronic
1197956211 X:131951289-131951311 ATGGCAGTGTGGGTCAGGGAGGG - Intergenic
1198167193 X:134069487-134069509 CAGGATGGGTGGGTTAGGGATGG + Intergenic
1199322384 X:146455740-146455762 CAGGAAGGGTGGGGCAGTTCAGG - Intergenic
1199943053 X:152642723-152642745 GGGGCAGGGTGGGACAGTGATGG + Intronic