ID: 1096389270

View in Genome Browser
Species Human (GRCh38)
Location 12:51217075-51217097
Sequence CCAGGCGTTGCTGGAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389270_1096389287 10 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389270_1096389292 26 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389270_1096389277 -9 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127
1096389270_1096389291 25 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389270_1096389278 -8 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389270_1096389280 1 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389270 Original CRISPR CCAGGCGTTGCTGGAAGGGT GGG (reversed) Intronic
900626347 1:3610422-3610444 CCTGGCCTTGCTGGCAGGGGTGG - Intronic
903377710 1:22876924-22876946 GCAGGCGTAGCTGGCAGGCTTGG - Intronic
904476491 1:30768408-30768430 TCCGGGGTTGCTGGAAGGGAAGG + Intergenic
905203284 1:36328170-36328192 ACAGGCCTTGATGGAAGGTTGGG + Exonic
905563726 1:38946927-38946949 CCAAGAGCTGCTGGAGGGGTGGG - Intergenic
906095615 1:43222003-43222025 CCAGCTGGTGCTGGAAGGGATGG + Intronic
906319018 1:44805392-44805414 CCAGGAGTTGCGGGAAGGTCTGG + Intronic
908208605 1:61877021-61877043 CCAGGCTTTGCTCGAAGACTGGG + Intronic
909532869 1:76700554-76700576 CCTGGCTTGGCAGGAAGGGTAGG - Intergenic
915304485 1:154969849-154969871 CCAGGCAAAGCTGGAAGGGAAGG + Intronic
919490354 1:198198202-198198224 CCAGGCGGTGGTGGAAAGGCTGG - Intronic
921148330 1:212379890-212379912 CCAGGAGTTCCTGCAAAGGTGGG - Exonic
923124281 1:231021939-231021961 CCTGGTGTTTCTGGAAGTGTGGG - Intronic
923388860 1:233493518-233493540 TAAGGAGTTGCTGGGAGGGTAGG - Intergenic
1062804213 10:404657-404679 GCAGGCCATGCTGGAAAGGTCGG + Intronic
1063035897 10:2286355-2286377 CCAGGGGTTGGGGGAAGGGAGGG - Intergenic
1063167643 10:3478611-3478633 CCAGGCATTGCTGGAACTGATGG + Intergenic
1063189220 10:3678438-3678460 CCACTCTTTCCTGGAAGGGTGGG - Intergenic
1066022479 10:31318531-31318553 CCAGGCGTCCCTGGAAGGGAAGG + Intronic
1066048964 10:31618186-31618208 CCTGGCCCTGCAGGAAGGGTGGG - Intergenic
1069740637 10:70685032-70685054 CCAGCCCTTGCTGGAATGGGAGG - Intronic
1069879511 10:71583095-71583117 CCAGGCATTGCAGGAGGAGTAGG + Intronic
1075274335 10:121079786-121079808 CCAGGTATTGCTGGAAGATTTGG + Intergenic
1075656148 10:124162486-124162508 GCAGCAGTTGCTGGAAGGGAGGG + Intergenic
1076262153 10:129075709-129075731 CCAGAGGTTCCTGGAAGGCTGGG - Intergenic
1076427592 10:130378764-130378786 CTAGGCCTTGCAGGATGGGTGGG - Intergenic
1076569039 10:131420346-131420368 CCTGGTCTTGATGGAAGGGTGGG + Intergenic
1076581229 10:131513352-131513374 CCAGGGGGAGCTGGAAGGCTCGG - Intergenic
1076801699 10:132833948-132833970 CCTGGCGTTCCCGGATGGGTGGG + Intronic
1077038398 11:506604-506626 CCGGGCGTTGGGGGAAAGGTGGG - Intronic
1077914678 11:6603669-6603691 CCAGGCGCGGCTAGAAGGGCAGG + Intergenic
1079260383 11:18872884-18872906 CCATGCGATGGTGGAAGGGTCGG + Intergenic
1080452349 11:32388881-32388903 CCAGGTGTGCCTGGAAGAGTTGG - Exonic
1080895854 11:36448375-36448397 CCAGGCAGGGATGGAAGGGTGGG - Intronic
1081565327 11:44257386-44257408 CCAGGCGCTTCTGGAAAGGAAGG - Intergenic
1082162793 11:48902020-48902042 CCAGGCGATGCTGCAGGTGTCGG + Intergenic
1082263547 11:50096343-50096365 CAAGGAGGTGCTGGGAGGGTAGG + Intergenic
1083482082 11:62955672-62955694 CCTGACATTGCTGGTAGGGTGGG - Intronic
1085475302 11:76785132-76785154 CCTGGTGTTGGAGGAAGGGTAGG - Intronic
1086547449 11:88014634-88014656 CCAGGCCTTGCCAGCAGGGTAGG - Intergenic
1090016166 11:123088198-123088220 CCATGCCCAGCTGGAAGGGTAGG + Intronic
1091445459 12:542290-542312 CCAGGTGTGGCTGGTGGGGTGGG - Intronic
1091669231 12:2440578-2440600 CCAGGTATGGCTGGAGGGGTGGG - Intronic
1092247216 12:6870399-6870421 CCTGGCTTGGCAGGAAGGGTAGG - Exonic
1095163197 12:38941022-38941044 CCAGGGCTTGGAGGAAGGGTTGG - Intergenic
1096389270 12:51217075-51217097 CCAGGCGTTGCTGGAAGGGTGGG - Intronic
1096572015 12:52528906-52528928 CCAGGCCATCCTGGAAGGGAGGG + Intergenic
1096783960 12:54006647-54006669 CCAGGGGTTGCGGGACTGGTGGG + Intronic
1101352694 12:103946951-103946973 CCAGCCTTTGCGGGAAGGTTGGG - Intronic
1102005805 12:109588509-109588531 CCAGGCGTTGCTGGTGTGCTGGG + Intronic
1102099755 12:110269405-110269427 TCAAGCCTTGCTGGAATGGTCGG + Intergenic
1103721622 12:122978488-122978510 CCAGGCCCTGCTGGAAGAGCTGG + Exonic
1104309295 12:127639822-127639844 CCAGGCGTAACTGGATGTGTGGG - Intergenic
1104733491 12:131121983-131122005 CCAGGAGCTGCTGGTATGGTGGG + Intronic
1112503248 13:99957785-99957807 CCAGTCTCTGCAGGAAGGGTAGG + Intergenic
1112998842 13:105607821-105607843 CTAGGCCTTGCTGGTATGGTTGG + Intergenic
1114617314 14:24075237-24075259 CCAGGAGATGCAGGAAGGGACGG + Exonic
1114951429 14:27759606-27759628 CCAAGTGTTCCTGGAAGGGATGG + Intergenic
1115877096 14:37873353-37873375 CAAGGTGTTGGTGGAAGGGCTGG + Intronic
1118869371 14:69728175-69728197 CCAGGTGTGGTTGGAAGGGAGGG + Intronic
1119711602 14:76826530-76826552 CCAGGGCTTGCTGGGAGGGAAGG + Exonic
1122151014 14:99726284-99726306 CCAGGAGTAGCTGCAGGGGTGGG + Intronic
1122483595 14:102063658-102063680 CCAGGCGTGGCTGCAGGGGCGGG - Intergenic
1122836399 14:104432977-104432999 CCAGGTGCTGCTGGGAGGGCTGG - Intergenic
1127300687 15:57650752-57650774 CCAGGCCTTGTAGGATGGGTTGG + Intronic
1129700875 15:77768176-77768198 GCAGGGGTTGCTGGGAGGCTGGG - Intronic
1130736651 15:86557384-86557406 CCAGGGGTTGCTGGTAGCTTAGG + Intronic
1132498297 16:274011-274033 CCAGCCGGGGCGGGAAGGGTGGG + Intronic
1133281863 16:4671199-4671221 CCAGGTGCTGCTGGTTGGGTGGG + Intronic
1133594306 16:7275885-7275907 CCAGGGGTTGCTGTAAGACTTGG + Intronic
1136030625 16:27500054-27500076 CCAGGCATTGCTGGAGGGAGTGG - Intronic
1136625997 16:31462570-31462592 CCAGGGGCTGCTGGGAGGTTGGG - Exonic
1136669032 16:31839486-31839508 CCAGGCCTTCCTGGAAGGCTTGG + Intergenic
1138478271 16:57284652-57284674 CCAGGCGCTGCAGGAGGCGTCGG + Exonic
1140516007 16:75542393-75542415 CCATGGGATGCTGGAGGGGTGGG + Intronic
1141694792 16:85614183-85614205 CCAGGCGGAGCAGGAAGGGCCGG - Intronic
1141890349 16:86922365-86922387 CCGGGAGTGGCTGGGAGGGTGGG + Intergenic
1143770849 17:9167729-9167751 CCAAGAGTTGCTGGATGGGGAGG + Intronic
1143941885 17:10551124-10551146 CCTGGAATTGCTGGGAGGGTTGG - Intergenic
1144622010 17:16823872-16823894 CCAGGGGCTGATGGGAGGGTGGG - Intergenic
1144641037 17:16936773-16936795 CCAGGCTCAGCTGGAAGTGTTGG + Intronic
1145931248 17:28687398-28687420 CAAGGCCTGGCTGTAAGGGTGGG - Exonic
1148214966 17:45829502-45829524 CCAGTAGCTGCTGGAATGGTGGG + Intronic
1150289991 17:63975586-63975608 CCAGAGGATGCGGGAAGGGTAGG - Intergenic
1151476247 17:74345768-74345790 CCAGGCTTTACTGGAAGGGAGGG - Intronic
1152621747 17:81368377-81368399 CGAGGTGGTGCAGGAAGGGTGGG + Intergenic
1152667595 17:81580268-81580290 CCAGGCCAGGCTGGAAGGCTGGG - Intronic
1152996435 18:410905-410927 CCAGGCTTTGCTGGCATGGGTGG - Intronic
1156553672 18:38043972-38043994 CCAGGAGTTGGTGGCAGGCTTGG - Intergenic
1158440206 18:57468563-57468585 CCAGGCCTTGATGGATGGGGAGG - Intronic
1160482250 18:79252400-79252422 CTCGGCGCTGCAGGAAGGGTGGG - Intronic
1160504400 18:79418893-79418915 CCAGGCGTGTGTGGAAGGGCTGG + Intronic
1160858145 19:1226577-1226599 GCAGGCCTTGCGGGCAGGGTTGG - Exonic
1161640744 19:5421173-5421195 CCGGGCCTGGCTGGAGGGGTGGG + Intergenic
1161984467 19:7646159-7646181 CCTGGTGTGGCTGGTAGGGTGGG - Intronic
1165042816 19:33081093-33081115 CCCGGTGATGCTGGAAGGCTGGG - Exonic
1165184299 19:34003698-34003720 CCAGCCGTTCCTGGAAGGTGGGG + Intergenic
1167292191 19:48630454-48630476 GCAGGCGCTGCTGGAAGTGCTGG - Exonic
926813771 2:16780159-16780181 CCTGGCTCTGCTGGCAGGGTGGG - Intergenic
927622865 2:24680556-24680578 CCAGGGGCTGCGTGAAGGGTTGG + Intronic
929066999 2:37987523-37987545 CCAGGGGTTGCGGGGAGGGAGGG + Intronic
929571636 2:43026687-43026709 CCACGGGCTGCTGGGAGGGTAGG - Intergenic
929990564 2:46782677-46782699 CCACACGTTCCTGGAAAGGTGGG + Intergenic
934485916 2:94710095-94710117 CCAAGTGTTCCTGGAAGGGATGG - Intergenic
936255802 2:110909761-110909783 CCAGGCGTCGCTGGCATGGCGGG + Intronic
936457154 2:112683720-112683742 CCAGTAGTTGCTGGAAGAGGTGG + Intergenic
936982795 2:118279508-118279530 GCAGGGGTTCCTGGAAGTGTGGG + Intergenic
937363441 2:121244558-121244580 CCAGGCGTTGCTTGGGGAGTTGG - Intronic
940337951 2:152548071-152548093 CGAGGGATTCCTGGAAGGGTAGG + Intronic
940977757 2:159965304-159965326 CCAGGTGTTGCAGGGAGGGAAGG - Intronic
942287043 2:174429781-174429803 CCAGGGGTTGGAGGGAGGGTGGG - Intergenic
945251271 2:207768219-207768241 CCTGGCGGGCCTGGAAGGGTGGG + Exonic
946405084 2:219488228-219488250 CCAGGTGCTGCTGGAGGGGGAGG + Exonic
946671722 2:222111919-222111941 CCAGGGGTTGGAGGAAGGGATGG + Intergenic
947549718 2:231037625-231037647 CCAGGCGTTGGTGGAAGCGGCGG + Exonic
1169091355 20:2863083-2863105 CCAGGTGCTGCTGGACAGGTAGG + Exonic
1170365127 20:15589681-15589703 CCAGGGATTGCTGGAAGGAAGGG - Intronic
1172091420 20:32435515-32435537 CCAGGCAATGCAGGAGGGGTGGG - Exonic
1172518654 20:35553469-35553491 CCAGGGGTTGAAGGCAGGGTTGG + Intronic
1172895773 20:38299056-38299078 CCAGGGGTGGGTGGAAGGGAGGG - Intronic
1175078516 20:56396989-56397011 ACATGGGTTGCTGGAAGGTTAGG - Intronic
1175217746 20:57400430-57400452 CCAGGCCATGCCGGGAGGGTTGG - Intronic
1175598157 20:60252130-60252152 CAAGGCGTGGGTGGTAGGGTGGG - Intergenic
1175795003 20:61765850-61765872 CCCGGGGCTGCTGGAAGGGGTGG - Intronic
1175838534 20:62011998-62012020 CCAGGCTGTTCTGGAAGGGGTGG - Intronic
1175895532 20:62334119-62334141 CCAGGCGTGGCTGGCAGGGAGGG - Intronic
1178322010 21:31612977-31612999 CCAGGACTTGCTGGAGGGTTGGG + Intergenic
1178736771 21:35159696-35159718 TTAGGTGTTGCTGGAAAGGTAGG + Intronic
1179303445 21:40133806-40133828 CCAGCAGTTGCTGGAAGGGCTGG - Intronic
1183775347 22:39960421-39960443 CCAGGTGCTTCTGGAAGGGCAGG + Intronic
1184018067 22:41800740-41800762 CCAGTCGGTGCAGGAAGGGCAGG - Exonic
1184362992 22:44030172-44030194 CCAGGCGTTGCTGGGGGGAAAGG - Intronic
1184430605 22:44439802-44439824 CCAGCTGGTGCTGGCAGGGTAGG - Intergenic
1184740990 22:46429010-46429032 CCAGGAGCTCCTGGCAGGGTCGG - Intronic
951760648 3:26143980-26144002 GCAGGGGTGGCTGGAAGGCTGGG - Intergenic
953972110 3:47355852-47355874 CCAGGCCTTGAGGGAGGGGTCGG - Intergenic
954409406 3:50363928-50363950 CGAGGGGTTGGTGGGAGGGTTGG - Intronic
954476502 3:50751414-50751436 CCAGGCATTGGGGGAAGGGGAGG - Intronic
963290539 3:143482667-143482689 CCAGGAGTTGCTGGAAGGAGGGG - Intronic
966384867 3:179385602-179385624 TCTGGCGTTGCTGGAGTGGTAGG - Exonic
968047475 3:195632129-195632151 CAAGGCCTGGCTGGAAGAGTGGG + Intergenic
968307138 3:197657795-197657817 CAAGGCCTGGCTGGAAGAGTGGG - Intergenic
968614695 4:1572117-1572139 CCAGGCGTTGGTGGTGGGGCTGG - Intergenic
969435914 4:7189334-7189356 CCAGGCATTGCAGGAAGAGCCGG - Intergenic
970465500 4:16318599-16318621 CCAGGGGTTGCTGCAAGTGTTGG + Intergenic
972765581 4:42150815-42150837 CGAGGCGTTTCTGTAAGGCTCGG + Intronic
974332587 4:60499343-60499365 CCTGACGTTTCTGGTAGGGTCGG + Intergenic
975080954 4:70280276-70280298 CCTGGGGTTGCGGGAGGGGTGGG - Intergenic
979205456 4:118033319-118033341 CGAGGCGACGCTGGAAGGGTGGG - Intergenic
983951705 4:173649812-173649834 CCATGCGTTGCTGGAGGGGGTGG - Intergenic
984706112 4:182848297-182848319 CCATGCTTTGCCTGAAGGGTAGG + Intergenic
985519527 5:366897-366919 CAAGGAGTTACTGGAAGGGATGG + Intronic
985744137 5:1637035-1637057 CAAGGCTTGGCTGGAAGAGTGGG - Intergenic
985765826 5:1779110-1779132 CCAGGAGTTGCGGGAAGGCAAGG + Intergenic
987066850 5:14297994-14298016 CCATGCCTTGCTGCAAGGGGTGG + Intronic
988253544 5:28793127-28793149 CCAGGGGTTGATGGGAGGGAAGG + Intergenic
999932490 5:156448688-156448710 CCATGGGTTGCTTAAAGGGTGGG + Intronic
1001333315 5:170777541-170777563 TCAGGGGTTGCAGGAAGGCTGGG - Intronic
1001930332 5:175668388-175668410 CCAGCTGTTGCTCGCAGGGTGGG + Intronic
1005861803 6:29907851-29907873 CCAGGCCCTCCTGGAAGGGAAGG - Intergenic
1005873457 6:29994521-29994543 CCAGGCCCTGCTGGAAGGGCAGG - Intergenic
1007302278 6:40876351-40876373 CCAGGAGTTTCTGGAGGGGCAGG - Intergenic
1007626773 6:43251172-43251194 CCAGGCGGAGCTGGAGGGCTGGG - Intronic
1008381409 6:50842816-50842838 CCAGGCGGTCCTGGAATGGAGGG + Intronic
1011441847 6:87395701-87395723 CCAGGGGTTGGGGGAAGGGAGGG + Intronic
1013905914 6:115219357-115219379 CCAGGAGCTGCGGGAAGAGTAGG + Intergenic
1013972625 6:116039511-116039533 CCTGGCTTGGCAGGAAGGGTAGG - Intronic
1017000931 6:149996490-149996512 CCTGGCTTTGCAGGAAGGGGAGG + Intergenic
1017487604 6:154917526-154917548 CCATGCATTGCTGGGAGGGCTGG + Intronic
1019142263 6:169956320-169956342 CAAGGCCTGGCTGGTAGGGTCGG - Intergenic
1020035149 7:4959643-4959665 ACAGGGGGTGCTGGAGGGGTTGG + Intergenic
1020172765 7:5857868-5857890 CCAGGCATGGCAGGAAGTGTTGG + Intergenic
1020560633 7:9726492-9726514 CCAGGCGCTTCTGAAAGTGTGGG + Intergenic
1021206416 7:17786621-17786643 TCAGGCCCTGCTGGAAGGGCAGG + Intergenic
1024051053 7:45623731-45623753 CCAGACTGTGCAGGAAGGGTCGG + Intronic
1024772408 7:52738726-52738748 CCAGGGGTTGGAGGAAGGGAGGG - Intergenic
1026197562 7:68186073-68186095 CCACCGGTTGCTGGAAGGGTGGG - Intergenic
1029086017 7:98012386-98012408 CCAGGCATGGCAGGAAGTGTTGG - Intergenic
1030611025 7:111688864-111688886 CCACAGGTTCCTGGAAGGGTTGG + Intergenic
1033252678 7:139774901-139774923 CCAGGGCTTGCTTGAAGGATAGG - Intronic
1038004312 8:23417011-23417033 CCAGCTGTGGCTGGAAGGCTGGG - Intronic
1039404502 8:37301049-37301071 GCTGGGGTGGCTGGAAGGGTGGG - Intergenic
1041503629 8:58568843-58568865 CCAGGAGTTTCTAGAAGGGAAGG - Intronic
1043494373 8:80783885-80783907 CCAGGGGTTGGAGGAAGGGAGGG - Intronic
1045290177 8:100826202-100826224 CGAGGCACTGCTGGAAAGGTTGG + Intergenic
1048265167 8:132979197-132979219 CCAGGGCTTCCTGGAAGGGGTGG + Intronic
1049643766 8:143727141-143727163 CCAGGCGTGGCGGGAAGAGGTGG - Exonic
1052259867 9:26502030-26502052 CCAGGCCTTACTGGAATGTTTGG - Intergenic
1053174646 9:35913089-35913111 CCAGGAGTAGATGGATGGGTGGG - Intergenic
1053478475 9:38398913-38398935 CTAGGCTTGGCTTGAAGGGTGGG - Intergenic
1053671873 9:40374230-40374252 CCAAGTGTTCCTGGAAGGGATGG + Intergenic
1053921685 9:43000592-43000614 CCAAGTGTTCCTGGAAGGGATGG + Intergenic
1054382988 9:64514278-64514300 CCAAGTGTTCCTGGAAGGGATGG + Intergenic
1054512747 9:66002080-66002102 CCAAGTGTTCCTGGAAGGGATGG - Intergenic
1056632515 9:88305503-88305525 CCTGGAGCTGCTGGGAGGGTGGG - Intergenic
1058054263 9:100433791-100433813 CCAGGCCTTGCTTGTAGGGAGGG + Intronic
1060926111 9:127456525-127456547 CCAGTCTGTGCTGGAAGTGTTGG + Intronic
1061215971 9:129222286-129222308 TCAGCCCTTGCTGGGAGGGTGGG + Intergenic
1061586946 9:131575560-131575582 CCTGGCATTGCTGGCAGGGGAGG + Intergenic
1062285106 9:135769415-135769437 CCAGGAGGTGCTGGAGGGGACGG + Intronic
1187681191 X:21769453-21769475 GCAGGGGTGGCTGGAAGGCTGGG + Intergenic
1192205085 X:69090256-69090278 CCAGGCATAGCTGGGAAGGTAGG + Intergenic
1192221083 X:69197777-69197799 CAGGGCTTTGATGGAAGGGTAGG - Intergenic
1192632886 X:72790718-72790740 CCAGGAGTAGCTGGTAGGTTTGG - Intronic
1192648823 X:72930083-72930105 CCAGGAGTAGCTGGTAGGTTTGG + Intronic
1192664455 X:73073608-73073630 CCAGGGGTTGGTGGCAGGGTTGG - Intergenic
1193507406 X:82361808-82361830 ACGGGTGTTGCTGGAAGGGTAGG - Intergenic
1198096326 X:133383408-133383430 CCAGGAGTTGATGGAAGGAAGGG + Intronic
1198231085 X:134690334-134690356 TCAGGTGTTTCTGGAAGAGTGGG - Intronic
1199996511 X:153029831-153029853 CCAGGCGCTGCTGGACTGCTGGG + Intergenic
1200071729 X:153532540-153532562 CCAGGGGCTGCTGGAGGGGATGG - Intronic
1200768408 Y:7101250-7101272 CCAGGAAGTGCTGGAAGGGAGGG + Intergenic