ID: 1096389270

View in Genome Browser
Species Human (GRCh38)
Location 12:51217075-51217097
Sequence CCAGGCGTTGCTGGAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389270_1096389292 26 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389270_1096389280 1 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389270_1096389287 10 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389270_1096389278 -8 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389270_1096389291 25 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389270_1096389277 -9 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389270 Original CRISPR CCAGGCGTTGCTGGAAGGGT GGG (reversed) Intronic