ID: 1096389272

View in Genome Browser
Species Human (GRCh38)
Location 12:51217076-51217098
Sequence CCCAGGCGTTGCTGGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389272_1096389278 -9 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389272_1096389292 25 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389272_1096389280 0 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389272_1096389277 -10 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127
1096389272_1096389291 24 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389272_1096389287 9 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389272 Original CRISPR CCCAGGCGTTGCTGGAAGGG TGG (reversed) Intronic
900436411 1:2633250-2633272 CCCAGGGGCTGCTGGGAGGAAGG + Intergenic
900590189 1:3456010-3456032 CCCCAGTCTTGCTGGAAGGGAGG + Intronic
900954173 1:5876476-5876498 CCAACGCCTTGCTGGCAGGGAGG + Intronic
901216507 1:7558308-7558330 CCCAGGCATGGCAGGAAGAGGGG + Intronic
902395453 1:16130125-16130147 CCCAGGTGAAGCTGGTAGGGGGG - Intronic
902504093 1:16928297-16928319 CCCAGCTGTTGGGGGAAGGGAGG - Intronic
903763477 1:25716145-25716167 CCTACACGTAGCTGGAAGGGAGG + Intronic
904246773 1:29193681-29193703 CCCAGGCTTTGCTTTCAGGGTGG + Intronic
904309937 1:29622486-29622508 CCCAGGGCTTCCTGGAATGGGGG - Intergenic
904723492 1:32529200-32529222 TCCAGGAGATGCTGCAAGGGAGG + Intronic
905648203 1:39639441-39639463 CCCAGGCGGTGCTGGAGGGCTGG + Intronic
907528901 1:55073039-55073061 CCCAGGGGCTGGGGGAAGGGAGG + Intronic
908208603 1:61877020-61877042 CCCAGGCTTTGCTCGAAGACTGG + Intronic
909803451 1:79844455-79844477 GCAAGGCCTTGCTGGAATGGAGG + Intergenic
910360539 1:86410708-86410730 CGCAGCTGCTGCTGGAAGGGTGG + Intergenic
912633388 1:111268365-111268387 GCCAGGGGATGCAGGAAGGGTGG + Intergenic
918261606 1:182801356-182801378 CTCAGGCCTTGCTGGGAGGCAGG - Intronic
919806925 1:201385884-201385906 CCCAGGAGCTGCAGGAAGAGGGG + Intronic
920312989 1:205059304-205059326 GCCAGGCGTGGCTGGAGGGAGGG + Intronic
922157793 1:223053574-223053596 CCCAGGCGTGGAGGGAATGGAGG + Intergenic
922193279 1:223338622-223338644 TCCAGGAGTAGCTGGAAGAGAGG + Intronic
923124283 1:231021940-231021962 CCCTGGTGTTTCTGGAAGTGTGG - Intronic
924288365 1:242511342-242511364 CCCAGGAGTTGCTGAATGTGGGG + Intronic
1063035899 10:2286356-2286378 GCCAGGGGTTGGGGGAAGGGAGG - Intergenic
1063189222 10:3678439-3678461 CCCACTCTTTCCTGGAAGGGTGG - Intergenic
1064745574 10:18475159-18475181 CCAGGGCCGTGCTGGAAGGGTGG - Intronic
1064988186 10:21231892-21231914 CCCAGGCATGGCAGGATGGGAGG + Intergenic
1065429110 10:25635746-25635768 CACAGGGGTTGCTGATAGGGAGG + Intergenic
1067313512 10:45138986-45139008 CCCAAGCTTAGCTGGAAGGGGGG - Intergenic
1068942106 10:62690387-62690409 GCCAGGTGTGGCTGGGAGGGAGG - Intergenic
1070696692 10:78569269-78569291 CCCAGATGTTGCAGGAAGGAGGG + Intergenic
1074536107 10:114329599-114329621 CCCAGGCATTGCTTGCTGGGTGG - Intronic
1075656147 10:124162485-124162507 GGCAGCAGTTGCTGGAAGGGAGG + Intergenic
1076178262 10:128385388-128385410 CCAAGGCGCTGCTGGAGAGGGGG + Intergenic
1076801697 10:132833947-132833969 CCCTGGCGTTCCCGGATGGGTGG + Intronic
1077067351 11:648079-648101 CCCAGGCGGTGCTGGGAGCAGGG + Intronic
1077232913 11:1466359-1466381 CCCAGGCCTTGCTGGGACGGAGG - Intergenic
1077247136 11:1545123-1545145 CCCAGGCATTGCTGGAGGGCAGG + Intergenic
1078415214 11:11159304-11159326 CCCAGGAGATGCTGGAGGAGTGG + Intergenic
1079079666 11:17405447-17405469 CCGAGGTGTCTCTGGAAGGGGGG + Intronic
1079111299 11:17606601-17606623 CCTTGGCGTTGGTGGAAGGTCGG - Intronic
1084559572 11:69895299-69895321 GCCAGGCAGTGATGGAAGGGAGG - Intergenic
1087861899 11:103168310-103168332 CCCTAGCGTTGCCAGAAGGGGGG + Intronic
1091194528 11:133719932-133719954 CACAGGCGATGATGGAGGGGAGG + Intergenic
1091445461 12:542291-542313 CCCAGGTGTGGCTGGTGGGGTGG - Intronic
1091853868 12:3723382-3723404 TCCAGGGTTGGCTGGAAGGGTGG - Intronic
1093925240 12:24902914-24902936 CCCGGGCGTTTGCGGAAGGGGGG - Intronic
1095540761 12:43306086-43306108 CCCAGGAGTGGGTGGGAGGGAGG + Intergenic
1096389272 12:51217076-51217098 CCCAGGCGTTGCTGGAAGGGTGG - Intronic
1096572013 12:52528905-52528927 CCCAGGCCATCCTGGAAGGGAGG + Intergenic
1100898582 12:99213254-99213276 CCCAGGAGGTGCTGGAAGCCTGG + Intronic
1102473425 12:113173487-113173509 CCCAGGTGTAGCTGACAGGGAGG + Intronic
1102861817 12:116342609-116342631 CCCATCCCTTGCTGCAAGGGAGG - Intergenic
1103614436 12:122143187-122143209 CCCAGGCCCTGCAGGAAGAGAGG - Exonic
1104309297 12:127639823-127639845 CCCAGGCGTAACTGGATGTGTGG - Intergenic
1104564688 12:129870268-129870290 CCCAGGCGTGGCTGGCATGGTGG - Intronic
1104955170 12:132461225-132461247 CTCAGGAGCAGCTGGAAGGGGGG - Intergenic
1105759750 13:23503166-23503188 TCCAGGGGTTGCTGGAAGTTGGG - Intergenic
1106104994 13:26724852-26724874 ACCAGGGGTTGGTGGGAGGGAGG - Intergenic
1109508642 13:63338443-63338465 CCCAGGAGCTCCTGGAATGGAGG + Intergenic
1112901624 13:104363913-104363935 GCCAGGGGTTGGGGGAAGGGTGG + Intergenic
1116929756 14:50678417-50678439 CCCAGGTGTTGTTGGCAGGGTGG - Intergenic
1117911832 14:60644026-60644048 CCCAGGCGGAGCTGGGAGAGTGG + Exonic
1118869369 14:69728174-69728196 GCCAGGTGTGGTTGGAAGGGAGG + Intronic
1119265021 14:73259403-73259425 CGCAGGGGTTGCTGGTATGGGGG - Exonic
1121144810 14:91574364-91574386 CCCAGGCGTTTCTGGGATGCTGG + Intergenic
1121206038 14:92168423-92168445 CCAGGGCTTTGCTGGAAGTGAGG + Exonic
1121991483 14:98561960-98561982 CCAATGCATTGCTGGAATGGAGG - Intergenic
1122151012 14:99726283-99726305 CCCAGGAGTAGCTGCAGGGGTGG + Intronic
1122307371 14:100774239-100774261 CCCAGGAGCTGTTGGAAGGAAGG + Intergenic
1122483597 14:102063659-102063681 CCCAGGCGTGGCTGCAGGGGCGG - Intergenic
1122612810 14:102997372-102997394 TCCAGTGGTGGCTGGAAGGGGGG - Intronic
1123126939 14:105953635-105953657 CCCAGGAGTTGCTGGGAGCCAGG - Intergenic
1123407402 15:20029455-20029477 CCCAGGAGTTGCTGGGAGCCAGG - Intergenic
1123516729 15:21036111-21036133 CCCAGGAGTTGCTGGGAGCCAGG - Intergenic
1123713099 15:23005204-23005226 CCCAGGGGCTGCTGGACTGGAGG + Intronic
1124160153 15:27260802-27260824 CCCAGGTGTTGCTGGGTGGCAGG + Intronic
1125484956 15:40105404-40105426 CCCAGCCGGTTCTGGGAGGGAGG - Intronic
1126796060 15:52261340-52261362 CCCTGGCATTGCTGCAGGGGTGG - Intronic
1130684061 15:86021834-86021856 GCCAGGCCCTGGTGGAAGGGTGG + Intergenic
1131050068 15:89341854-89341876 CCCAGGAGTGGCTGGGATGGTGG + Intergenic
1132498295 16:274010-274032 CCCAGCCGGGGCGGGAAGGGTGG + Intronic
1132554334 16:566024-566046 GCCAGGCCCTGCTGGGAGGGAGG - Intergenic
1132611594 16:819456-819478 CCCAGGAGATGCTGGAGTGGGGG + Intergenic
1132652721 16:1028881-1028903 CCCAGGCTCTGCAGGAAGAGGGG - Intergenic
1133327998 16:4953737-4953759 TCCAGGGGCTGCGGGAAGGGAGG + Intronic
1134489474 16:14685519-14685541 ACCAGGTGTTGGTGGTAGGGAGG + Intronic
1137035221 16:35564445-35564467 CCCAGGTGTTGCGGGCAGGAGGG - Intergenic
1137763255 16:50957711-50957733 CCCAGGTGTTTCTGGAAGGTTGG + Intergenic
1137902476 16:52283758-52283780 CCCAGGCCTTGAAGGATGGGTGG - Intergenic
1139711556 16:68780166-68780188 CCTAAGACTTGCTGGAAGGGAGG - Intronic
1141733250 16:85836100-85836122 CCCTGGCCTTTCTGGAAGAGAGG + Intergenic
1141890347 16:86922364-86922386 CCCGGGAGTGGCTGGGAGGGTGG + Intergenic
1143116015 17:4582263-4582285 CCCAGGCCTTGGTGGGAGGTTGG + Intergenic
1143284787 17:5781060-5781082 CCCAGGGGGTGGTGAAAGGGAGG + Intronic
1144622012 17:16823873-16823895 CCCAGGGGCTGATGGGAGGGTGG - Intergenic
1144644025 17:16956843-16956865 CCCAGGGGTTGGAGGATGGGAGG + Intronic
1145767059 17:27465922-27465944 CCCAGGCCTTGGTGGGAGTGGGG - Intronic
1145942291 17:28748909-28748931 CCCAGGCCATGGGGGAAGGGAGG - Intronic
1146637679 17:34518436-34518458 CCCTGGAGTTGCAGGAATGGAGG + Intergenic
1146955385 17:36934189-36934211 CCCTGGCGTCTCTGCAAGGGGGG - Intergenic
1147533572 17:41302621-41302643 ACAAGACGTTGCTGGAAGGCGGG + Exonic
1148214964 17:45829501-45829523 CCCAGTAGCTGCTGGAATGGTGG + Intronic
1148352557 17:46951217-46951239 CACAGGCTTGGCTGGAACGGCGG + Intronic
1149041118 17:52189505-52189527 TCCAGGTGCTGGTGGAAGGGAGG - Intergenic
1151476249 17:74345769-74345791 CCCAGGCTTTACTGGAAGGGAGG - Intronic
1152358785 17:79820342-79820364 CCTAGGCCTTGCTAGAAGGCTGG - Intergenic
1152611231 17:81315799-81315821 CCCAGGCGTTGCCCGGAGTGAGG + Intronic
1152811663 17:82385475-82385497 CCCAGGCCTAGCTGGCAGTGGGG - Intergenic
1153788000 18:8551964-8551986 CCCAGCCGTGACAGGAAGGGAGG + Intergenic
1156521245 18:37724038-37724060 CCCAGGAGTTGCTGCCAGGTGGG - Intergenic
1157868267 18:51205206-51205228 GCCAGGGGTTGGAGGAAGGGAGG + Intronic
1160272864 18:77403618-77403640 CCCTGGCCTTGCTGGAGGTGGGG + Intergenic
1161828584 19:6586369-6586391 CCCAGGCTATACTGGCAGGGGGG - Exonic
1162422751 19:10575083-10575105 TCCAGGGGTTGCTGAAAGGAAGG - Intronic
1163426233 19:17242561-17242583 CCCAGGCAGTGGTGGAGGGGGGG - Intronic
1163666877 19:18607406-18607428 CCCAGGCTTTGCTGGAAGAAAGG + Intronic
1163677651 19:18663309-18663331 CCCAAGGGTCTCTGGAAGGGTGG + Intronic
1163744280 19:19035613-19035635 CTCAGGGGTGGGTGGAAGGGAGG + Intronic
1164869781 19:31633161-31633183 CCTAGGCCTTGCTGGGAGGAAGG + Intergenic
1165042818 19:33081094-33081116 CCCCGGTGATGCTGGAAGGCTGG - Exonic
1165184297 19:34003697-34003719 TCCAGCCGTTCCTGGAAGGTGGG + Intergenic
1166305511 19:41935008-41935030 CACAGGCTTTTCTGGAGGGGAGG - Intergenic
1167002602 19:46755121-46755143 GCCAGGGGTTGCAGGCAGGGGGG - Intronic
1167431631 19:49458602-49458624 CCCAGTCATTAGTGGAAGGGAGG + Intronic
1167504499 19:49863946-49863968 TCCAGGTATGGCTGGAAGGGAGG - Exonic
925160561 2:1680840-1680862 CCCAGGCAGTGTGGGAAGGGGGG + Intronic
929066997 2:37987522-37987544 GCCAGGGGTTGCGGGGAGGGAGG + Intronic
929598650 2:43191547-43191569 CTCAGGCGGTGCTGGGAGGCTGG - Intergenic
930058205 2:47268183-47268205 CCCAGGCCCTCCTGGAAGGAGGG - Intergenic
930124062 2:47782946-47782968 CCCAGGCGTCGGCGGCAGGGCGG + Intronic
931441987 2:62296545-62296567 CCCAGGCTTCCCTGCAAGGGCGG + Intergenic
932346587 2:70999684-70999706 CCCAGGCCTTGCCTGAAGGAGGG + Intergenic
936255800 2:110909760-110909782 CCCAGGCGTCGCTGGCATGGCGG + Intronic
936711166 2:115132670-115132692 TCCAGCCGTAACTGGAAGGGAGG - Intronic
937053958 2:118915269-118915291 GCCAGGAGGTGCTGGAAGGAGGG - Intergenic
937308487 2:120886794-120886816 CCCAGACGTTGCTGGCTGGGTGG + Intronic
938368604 2:130755383-130755405 CCCAGGCGGGGCAGGACGGGAGG - Intergenic
939932757 2:148255026-148255048 CACAGCTGCTGCTGGAAGGGTGG + Intronic
940722649 2:157298747-157298769 CTCAGCCGTTACTGGAAGGAAGG - Intronic
945251269 2:207768218-207768240 CCCTGGCGGGCCTGGAAGGGTGG + Exonic
947713004 2:232326438-232326460 CCCTGGGGTGGCTGGAAGGTGGG - Intronic
947732688 2:232439894-232439916 CCCTGGGATGGCTGGAAGGGAGG - Intergenic
1169827557 20:9786215-9786237 CCCATGCCCAGCTGGAAGGGAGG + Intronic
1170365129 20:15589682-15589704 GCCAGGGATTGCTGGAAGGAAGG - Intronic
1171189247 20:23147050-23147072 CCCAGTTGTTGCTTGAAGTGTGG - Intergenic
1172091422 20:32435516-32435538 CCCAGGCAATGCAGGAGGGGTGG - Exonic
1172091683 20:32437104-32437126 CAAAGGCCTTGCTGGAAGTGTGG + Exonic
1172526619 20:35603715-35603737 CCCAGGGGGTGTGGGAAGGGTGG - Intergenic
1172895775 20:38299057-38299079 TCCAGGGGTGGGTGGAAGGGAGG - Intronic
1174436348 20:50510020-50510042 CCCAGGCCCTGCAGGAAAGGAGG + Intergenic
1175895534 20:62334120-62334142 GCCAGGCGTGGCTGGCAGGGAGG - Intronic
1176194915 20:63832319-63832341 CCCGGGCGCGGCGGGAAGGGAGG + Intergenic
1178915273 21:36702403-36702425 CCCAGGCATTGCACGAATGGAGG - Intronic
1179817179 21:43914187-43914209 CCCAGGCCTCGCAGGCAGGGGGG - Intronic
1180012366 21:45059295-45059317 CTCAGGGCTTCCTGGAAGGGAGG - Intergenic
1180921449 22:19523555-19523577 CGCAGGCGTGGCTGGCAGGAGGG + Exonic
1181927966 22:26375590-26375612 CAGAGACGTCGCTGGAAGGGGGG + Exonic
1183656745 22:39190193-39190215 CCCAGACGTTGCTGGCTGGAGGG + Intergenic
1184037927 22:41927255-41927277 CCCAGGCGGTGCTGGTTGAGGGG - Intergenic
1184038256 22:41928687-41928709 CACAGGGGATGCTGGGAGGGAGG + Intergenic
950842766 3:15983421-15983443 CCCTGGACTTGCTGGGAGGGAGG + Intergenic
954783087 3:53074571-53074593 CCCAGGCCTAGCTGGATAGGTGG - Intronic
956064200 3:65379618-65379640 AGCAGGAGTTGCTGGAAGGAGGG - Intronic
959354170 3:105304379-105304401 CCCAGCTGCTGCTGGAAGGTCGG + Intergenic
963236551 3:142962747-142962769 CCCAGGCGCTGCTGCAAGTATGG + Exonic
963290541 3:143482668-143482690 ACCAGGAGTTGCTGGAAGGAGGG - Intronic
964225006 3:154388605-154388627 CACAGGCATTGCTGGGAAGGAGG - Intronic
964433044 3:156625144-156625166 CGCAGCTGCTGCTGGAAGGGTGG - Intergenic
968047474 3:195632128-195632150 CCAAGGCCTGGCTGGAAGAGTGG + Intergenic
968295959 3:197576874-197576896 CCCAAGCTGTCCTGGAAGGGAGG - Intergenic
968307139 3:197657796-197657818 CCAAGGCCTGGCTGGAAGAGTGG - Intergenic
968910042 4:3472956-3472978 CACAGGTGTGGCTGGCAGGGCGG + Intronic
969242099 4:5906004-5906026 CCCAGGTGCTGCTGTAAAGGAGG + Intronic
971250555 4:24970267-24970289 CACAGCTGTTGCTGGAAAGGTGG - Intronic
975762294 4:77631934-77631956 CACAGCTGCTGCTGGAAGGGTGG + Intergenic
979205457 4:118033320-118033342 CCGAGGCGACGCTGGAAGGGTGG - Intergenic
985744138 5:1637036-1637058 CCAAGGCTTGGCTGGAAGAGTGG - Intergenic
985824063 5:2180021-2180043 CGCAGCCGCTCCTGGAAGGGGGG - Intergenic
986806799 5:11314846-11314868 GCCAGGGGTGGCTGGTAGGGTGG + Intronic
998386935 5:141762543-141762565 CCCAAGCCTTGCTGGCAGGTGGG - Intergenic
1000673422 5:164090640-164090662 CCTTGGGGTGGCTGGAAGGGAGG - Intergenic
1001333316 5:170777542-170777564 CTCAGGGGTTGCAGGAAGGCTGG - Intronic
1001447803 5:171799508-171799530 GCCAGGGGCTGCTGGAAGGAGGG + Intergenic
1001930330 5:175668387-175668409 CCCAGCTGTTGCTCGCAGGGTGG + Intronic
1002033348 5:176447259-176447281 CCCAGGCCTCTCTGGAAGGTGGG + Intergenic
1002691633 5:181054081-181054103 CCCAGGCTGGGCTGGAAGTGAGG - Intronic
1004256640 6:14070539-14070561 CCCAGCCATTTCTGGAATGGAGG + Intergenic
1005249741 6:23930817-23930839 TCCAGGCCTGGCTGGAAGGAAGG + Intergenic
1005682976 6:28225306-28225328 GCCCGGCGTTGCTAGAAGCGCGG - Exonic
1006101778 6:31690077-31690099 TCCAGGCTTTGCTGGAAGCACGG - Exonic
1006163320 6:32050246-32050268 CCCAGGCGAGGCTTGATGGGGGG + Intronic
1006164571 6:32056834-32056856 CCCAGGCGAGGCTTGATGGGGGG + Intronic
1006166521 6:32068638-32068660 CCCAGGCGAGGCTTGATGGGGGG + Intronic
1006528797 6:34631725-34631747 GCCAGGGGCTGCAGGAAGGGAGG + Intronic
1007248043 6:40476464-40476486 ACCAGGCATTGCTGGAAGTATGG - Intronic
1008381407 6:50842815-50842837 TCCAGGCGGTCCTGGAATGGAGG + Intronic
1011441845 6:87395700-87395722 GCCAGGGGTTGGGGGAAGGGAGG + Intronic
1012672716 6:102075733-102075755 CCCACGCCTAGCTGGAAGGTAGG + Intergenic
1013222130 6:108087485-108087507 CCCAGGCCTTTCAGGAATGGAGG + Intronic
1014514749 6:122365326-122365348 CACAGCTGCTGCTGGAAGGGTGG - Intergenic
1016941487 6:149485889-149485911 CCCAGGTGTTGGTGCTAGGGAGG + Intergenic
1017224865 6:152009102-152009124 CCCAGGGGGTGGGGGAAGGGAGG - Intronic
1018888845 6:167966117-167966139 GCCGGGCGTGGCTGGCAGGGGGG - Intronic
1020976720 7:15015680-15015702 GCCTGGAGTTGCTGGAATGGAGG + Intergenic
1022442990 7:30448891-30448913 CCCATGTGTTTCTGGATGGGGGG - Intronic
1023519391 7:41035354-41035376 CCCAGGGGTTCCTGGATGAGAGG - Intergenic
1024072758 7:45800312-45800334 CACAGGAGATGCTGGGAGGGTGG - Intergenic
1024650582 7:51399868-51399890 CACAGGAGATGCTGGGAGGGTGG + Intergenic
1024772410 7:52738727-52738749 TCCAGGGGTTGGAGGAAGGGAGG - Intergenic
1025054699 7:55755452-55755474 CACAGGAGATGCTGGGAGGGTGG + Intergenic
1025132769 7:56385677-56385699 CACAGGAGATGCTGGGAGGGTGG + Intergenic
1026197564 7:68186074-68186096 CCCACCGGTTGCTGGAAGGGTGG - Intergenic
1027267560 7:76502696-76502718 CTCAGGCCTGGCTGGAGGGGTGG - Intronic
1027319373 7:77002561-77002583 CTCAGGCCTGGCTGGAGGGGTGG - Intergenic
1028990871 7:97047371-97047393 CCTAGGAGTTGGGGGAAGGGAGG + Intergenic
1030357477 7:108558138-108558160 CCCATGTGTTGGAGGAAGGGGGG - Intronic
1030436596 7:109529720-109529742 CCCAGGCATGGCTGCAAGGGAGG + Intergenic
1030614899 7:111728967-111728989 CACAGACCTTGCAGGAAGGGCGG + Intronic
1030875860 7:114812513-114812535 GCCAGGAGTTGGGGGAAGGGAGG - Intergenic
1031329965 7:120452565-120452587 CCCAGGAGTTGCTGGAGGCCAGG - Intronic
1032496718 7:132368409-132368431 CCCAGGAGCTGCTGGCAGGAAGG - Intronic
1033635610 7:143209127-143209149 CCCAGGCCTTGCTGGAGAGAGGG - Intergenic
1035396581 7:158538937-158538959 CCCAGGACCTGCTGGAAGTGAGG + Intronic
1035456552 7:159013157-159013179 CCCAGGCTCTGCTGGGAGGAGGG + Intergenic
1036224267 8:6944684-6944706 CCCATGCATGGCTGGAGGGGTGG + Intergenic
1038013996 8:23497875-23497897 CTCTGGCTTTGGTGGAAGGGAGG - Intergenic
1039959764 8:42237474-42237496 CCCAGGCATTACGGGAAAGGAGG - Intergenic
1042120694 8:65485068-65485090 ACCAGGGGTTTCTGGAAGGAAGG + Intergenic
1043395036 8:79827682-79827704 CCCAGGGGCTGGTGGAGGGGAGG - Intergenic
1043494375 8:80783886-80783908 GCCAGGGGTTGGAGGAAGGGAGG - Intronic
1044085007 8:87933484-87933506 TCCAGGTGTTGCTGGATAGGTGG - Intergenic
1047957080 8:129984323-129984345 CCCAGGCAGGGCTGGCAGGGAGG + Intronic
1048207579 8:132427615-132427637 CCCAGGCCTTGCTGGAACAAAGG - Intronic
1049598004 8:143493257-143493279 CCCAGCCCTTGCTGGCAGGCAGG - Intronic
1051348280 9:16172235-16172257 CCCAGTCCTGGCTGGGAGGGTGG + Intergenic
1054260812 9:62863499-62863521 GCCAGGAGTTGCAGGATGGGAGG - Intergenic
1055162558 9:73148175-73148197 GCCAGGAGTTGGTGGCAGGGAGG - Intergenic
1057239067 9:93392484-93392506 CGCAGCTGCTGCTGGAAGGGTGG + Intergenic
1058054261 9:100433790-100433812 TCCAGGCCTTGCTTGTAGGGAGG + Intronic
1058892072 9:109370054-109370076 CCCATGCCTAGCTGCAAGGGAGG - Intergenic
1060103104 9:120857170-120857192 GCCTGGCCTTGCTGGAATGGAGG - Exonic
1061215970 9:129222285-129222307 CTCAGCCCTTGCTGGGAGGGTGG + Intergenic
1061218319 9:129234837-129234859 CCCAGCTGCTGCTGGCAGGGTGG + Intergenic
1062098814 9:134717364-134717386 CCCAGAGGCTGCTGGGAGGGTGG - Intronic
1062232883 9:135491993-135492015 CCCAGGCGTGGCTGTTGGGGAGG + Intergenic
1062290552 9:135792489-135792511 CCCAGGCTGTGCTGGAGGGTGGG + Exonic
1062444485 9:136587934-136587956 CCCAGCCCTGGCTGCAAGGGGGG + Intergenic
1062613125 9:137383835-137383857 CCCAGGCGGGGCTGGAGGGAGGG - Intronic
1062614703 9:137391095-137391117 CCGAGGCCCTGCTGGGAGGGGGG - Intronic
1187206400 X:17185856-17185878 CCAAGGCCTGGCTGGAAGAGAGG - Intergenic
1189377597 X:40477748-40477770 CACAGGCGTTCATGGAAGGTGGG + Intergenic
1191161220 X:57331315-57331337 CCCAGGTGTTGCTGGGAGCAAGG + Intronic
1192794928 X:74419214-74419236 TCCAGGCCTTGCAGGAACGGTGG + Intergenic
1196056659 X:111363316-111363338 CCCAGCCATTGGGGGAAGGGAGG + Intronic
1198096324 X:133383407-133383429 GCCAGGAGTTGATGGAAGGAAGG + Intronic
1200768406 Y:7101249-7101271 TCCAGGAAGTGCTGGAAGGGAGG + Intergenic