ID: 1096389272

View in Genome Browser
Species Human (GRCh38)
Location 12:51217076-51217098
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389272_1096389287 9 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389272_1096389277 -10 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389277 12:51217089-51217111 AACGCCTGGGTCCCTACCCCCGG 0: 1
1: 0
2: 4
3: 13
4: 127
1096389272_1096389292 25 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389272_1096389291 24 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389272_1096389278 -9 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389272_1096389280 0 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389272 Original CRISPR CCCAGGCGTTGCTGGAAGGG TGG (reversed) Intronic