ID: 1096389274

View in Genome Browser
Species Human (GRCh38)
Location 12:51217079-51217101
Sequence GGACCCAGGCGTTGCTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389274_1096389287 6 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389274_1096389291 21 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389274_1096389280 -3 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389274_1096389292 22 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389274 Original CRISPR GGACCCAGGCGTTGCTGGAA GGG (reversed) Intronic
900014889 1:141204-141226 GGACACAGGAGATGCTGGGAGGG + Intergenic
900045155 1:499813-499835 GGACACAGGAGATGCTGGGAGGG + Intergenic
900067352 1:741543-741565 GGACACAGGAGATGCTGGGAGGG + Intergenic
900397044 1:2457322-2457344 GGTCCCAGCCATGGCTGGAAAGG - Intronic
900982616 1:6055036-6055058 GGAGCCACGAGATGCTGGAAGGG + Intronic
901208811 1:7512973-7512995 GGTCCCTTGAGTTGCTGGAAAGG + Intronic
902151803 1:14449269-14449291 TGCCCCACGAGTTGCTGGAATGG + Intergenic
902633461 1:17719644-17719666 AGACACAGGCTTTGCTGGGAAGG + Intergenic
904004521 1:27356845-27356867 GGCCCCAGGCGGTGCCGGTATGG + Intronic
904042574 1:27593093-27593115 GGACACAGGCCTCGGTGGAACGG + Intronic
910488363 1:87741006-87741028 GGGCCCAGGGTTTGCTGGAGAGG + Intergenic
913114653 1:115685063-115685085 GGCCCCAGGGGTTGGGGGAAAGG - Intronic
915304482 1:154969845-154969867 GGGCCCAGGCAAAGCTGGAAGGG + Intronic
922101960 1:222484317-222484339 GGACACAGGAGATGCTGGGAGGG + Intergenic
922263040 1:223959439-223959461 GGACACAGGAGATGCTGGGAGGG + Intergenic
922536355 1:226383856-226383878 GAACACAGGCATAGCTGGAAAGG - Intronic
923571441 1:235118401-235118423 GGACCCAGGCATTGGGGAAAGGG - Intronic
923659068 1:235942883-235942905 GGAGCAAGGGGTTGCTTGAATGG + Intergenic
924310037 1:242731619-242731641 CCACCCAAGCTTTGCTGGAATGG - Intergenic
924344879 1:243064440-243064462 GGACACAGGAGATGCTGGGAGGG + Intergenic
1066022477 10:31318527-31318549 GAAACCAGGCGTCCCTGGAAGGG + Intronic
1066731454 10:38440635-38440657 GGACACAGGAGATGCTGGGAGGG - Intergenic
1067313516 10:45138989-45139011 GAACCCAAGCTTAGCTGGAAGGG - Intergenic
1067900871 10:50240254-50240276 GGAAGCTGGAGTTGCTGGAAGGG - Intronic
1068512080 10:57979379-57979401 GGACCCAGGACTAGCTGGTAGGG - Intergenic
1073267847 10:102239134-102239156 GGAGCCAGGGGTTGCTGGTGAGG - Intronic
1075604765 10:123796727-123796749 TGCCCCAGGCAGTGCTGGAAGGG + Intronic
1075788224 10:125064718-125064740 GGACACTGGCGTGGCGGGAATGG - Intronic
1076429214 10:130389891-130389913 GGACCAAGGGGGTGGTGGAATGG + Intergenic
1076971484 11:136304-136326 GGACACAGGAGATGCTGGGAGGG + Intergenic
1077232915 11:1466362-1466384 GTTCCCAGGCCTTGCTGGGACGG - Intergenic
1078094685 11:8289623-8289645 TGACCCTGGCCTGGCTGGAAGGG + Intergenic
1084011039 11:66348475-66348497 GGGCCCAGGGGTTGGTGGCACGG + Intronic
1085326361 11:75609787-75609809 GGACCCAGGCTGCACTGGAAAGG - Intronic
1086192986 11:84102646-84102668 GGACCCAGGCATTTATTGAAAGG + Intronic
1087078869 11:94150876-94150898 GGACCAGGGCTTTGTTGGAATGG - Intronic
1088127721 11:106448954-106448976 GGACCTATGCGTTGCTGGGGAGG - Intergenic
1089856920 11:121553884-121553906 GGACCCAGGGGATGCTGAAGAGG - Intronic
1090077976 11:123591356-123591378 GGAGCCAGGCGTCGTTGGGAGGG + Intronic
1094829049 12:34291520-34291542 GCACCCATGGGTTGCTGGGAAGG + Intergenic
1096389274 12:51217079-51217101 GGACCCAGGCGTTGCTGGAAGGG - Intronic
1101730682 12:107424717-107424739 CCACCCAGCTGTTGCTGGAAGGG + Intronic
1103561618 12:121795917-121795939 GGACCCAGGCCGGGCTGGGAAGG - Intronic
1103604985 12:122079453-122079475 GGACCCCGGCACTGCTGGCAGGG - Intronic
1104564690 12:129870271-129870293 AAACCCAGGCGTGGCTGGCATGG - Intronic
1112006152 13:95255462-95255484 AGACACAGGCATCGCTGGAATGG + Intronic
1114490891 14:23101300-23101322 GGTCCCATGCCTTCCTGGAAAGG - Intergenic
1118869368 14:69728171-69728193 GGAGCCAGGTGTGGTTGGAAGGG + Intronic
1119264913 14:73259007-73259029 GCATCCAGGGGTTGCTGGCAGGG - Exonic
1120136152 14:80872069-80872091 GGATCCAGCTGTTTCTGGAAGGG - Intronic
1122290614 14:100678553-100678575 GGACCCAGGGGTGGCTTGAAGGG + Intergenic
1124886603 15:33693307-33693329 GGACCTGGGCGCTGCTGGAGTGG - Intronic
1126409407 15:48356527-48356549 GGACTCAGGAGTTGGTGGCAGGG + Intergenic
1129394317 15:75235880-75235902 GGACCCAGGAGATGGGGGAAGGG - Intergenic
1130292386 15:82614086-82614108 GGCCCCAGGGGCTGCTGGAAAGG + Intronic
1130614348 15:85390443-85390465 GGAGCCTGGTGTGGCTGGAATGG + Intronic
1130684060 15:86021831-86021853 GGAGCCAGGCCCTGGTGGAAGGG + Intergenic
1132611590 16:819453-819475 GAACCCAGGAGATGCTGGAGTGG + Intergenic
1134290589 16:12901036-12901058 GGACCCAGGCGGAGCTGGGAAGG - Intergenic
1135347415 16:21700958-21700980 TGGCCCAGGCGTTTCTGGAGAGG + Exonic
1135424549 16:22325821-22325843 AGAACCACGCGTTGCTGGAGCGG + Exonic
1142011371 16:87716455-87716477 GGACCCAAGAGTAGCTGTAAAGG - Intronic
1142448766 16:90161218-90161240 GGACACAGGAGATGCTGGGAGGG - Intergenic
1142458720 17:74071-74093 GGACACAGGAGATGCTGGGAGGG + Intergenic
1142756206 17:2017991-2018013 GGACTCAACCGTGGCTGGAAGGG + Intronic
1144714019 17:17421854-17421876 GGACCCAGGCGTTCCAGGGCAGG - Intergenic
1148858297 17:50591063-50591085 GGCCCCAGGCCTTGCGGGGACGG - Intronic
1151768701 17:76145806-76145828 GGGCCCAGGCGGGGCAGGAAAGG + Intronic
1151876551 17:76870388-76870410 GGAAGCAGGCGTCTCTGGAAAGG + Intronic
1152608785 17:81305717-81305739 GGAACCAGGGGGAGCTGGAAAGG + Intergenic
1152996439 18:410909-410931 CCACCCAGGCTTTGCTGGCATGG - Intronic
1153562821 18:6388539-6388561 GGAGCCAGGGGATGCTGGTACGG + Intronic
1154160052 18:11974371-11974393 GGACCAAGGCCTTGCAGGATAGG + Intergenic
1156346845 18:36264661-36264683 GCACCCAGAACTTGCTGGAAAGG - Intronic
1156681260 18:39591750-39591772 GGACCCTGGGGGAGCTGGAAGGG - Intergenic
1157331237 18:46705275-46705297 GGAGCCAGCTGGTGCTGGAAGGG - Intronic
1157764386 18:50285959-50285981 GGACCCAGGCAGGGCTGAAACGG + Intronic
1158440209 18:57468567-57468589 GGAGCCAGGCCTTGATGGATGGG - Intronic
1158928265 18:62293561-62293583 TGACCCAGGCATTGCTGTGAAGG - Intronic
1160648438 19:206584-206606 GGACACAGGAGATGCTGGGAGGG + Intergenic
1160742916 19:695537-695559 GGCTCCAGGCGTTGCTGGTGGGG - Intergenic
1161851445 19:6739882-6739904 GGACCCAGGGGTCGGTGGAAGGG - Intronic
1162070026 19:8147782-8147804 GGGGCCAGGCGTTGCAGGAGTGG + Intronic
1162148877 19:8631117-8631139 GGTACCAGGGGTTTCTGGAAGGG + Intergenic
1163155320 19:15437031-15437053 GGGCCCGGGCGTGGCTGGAGAGG + Exonic
1163426237 19:17242564-17242586 GGACCCAGGCAGTGGTGGAGGGG - Intronic
1163596875 19:18225631-18225653 GGTCACAGTCGTTTCTGGAAAGG + Intronic
1166377338 19:42335023-42335045 GGTCCCAGGGGCTGCGGGAAAGG - Exonic
1166406259 19:42524232-42524254 GGACACAGGTGTAGGTGGAATGG + Intronic
1167563953 19:50244430-50244452 GGAGACAGGTGTGGCTGGAAGGG - Intronic
925154788 2:1640726-1640748 GACCCCAGGTGTTGCTGGGAGGG - Intronic
925681419 2:6425644-6425666 GCACCCAGGTGTGGCTGAAAGGG - Intergenic
948134789 2:235628409-235628431 GGACCCAGGCAGGGCCGGAAAGG + Intronic
1169438107 20:5611128-5611150 GGGCCCGCGCGTTCCTGGAAAGG + Intergenic
1170426902 20:16244212-16244234 GGACCCAGGCTTTGCTTCAATGG + Intergenic
1171822374 20:29865174-29865196 GGGCCCAGGCGTCTCTGGCATGG + Intergenic
1174436346 20:50510017-50510039 GGGCCCAGGCCCTGCAGGAAAGG + Intergenic
1175895535 20:62334123-62334145 GGAGCCAGGCGTGGCTGGCAGGG - Intronic
1175994732 20:62807022-62807044 GGACCCAGGTGCTTCTGGCAGGG - Intronic
1176899414 21:14420904-14420926 GAACACAGGCCTGGCTGGAATGG + Intergenic
1179303448 21:40133810-40133832 GGTCCCAGCAGTTGCTGGAAGGG - Intronic
1179548424 21:42127192-42127214 GGTCCCGGGCGTTGCTAGACGGG - Exonic
1179548442 21:42127267-42127289 AGCCCCAGGCATTGCTGGATGGG - Intronic
1180163190 21:46007072-46007094 TGACCCAGGCGTTGGGGGATGGG - Intergenic
1181276162 22:21688569-21688591 GGACCCAGGAGTTGGTGGCGTGG + Intronic
1183361683 22:37386269-37386291 GGGCCCTGGGGTTTCTGGAATGG + Intronic
1183490592 22:38113540-38113562 GCTCCCAGGGGTTGCTGGGACGG + Exonic
1184094411 22:42308916-42308938 AGACCCAGGCGTGGGTGAAACGG + Intronic
1184417862 22:44362634-44362656 GGAGCCAGGCGCTGCTTGGAGGG - Intergenic
1184430608 22:44439806-44439828 GGACCCAGCTGGTGCTGGCAGGG - Intergenic
950471080 3:13186807-13186829 GGACTCAGGCTCAGCTGGAATGG + Intergenic
952756807 3:36876258-36876280 GGACCTGGGCGTTGGTGAAATGG - Intronic
953904329 3:46860922-46860944 GAACCCAGGGGTTGCAGGATTGG - Intronic
954783089 3:53074574-53074596 GGGCCCAGGCCTAGCTGGATAGG - Intronic
959613072 3:108316599-108316621 GGGCCCAGAGGATGCTGGAAAGG + Intronic
962690425 3:137891426-137891448 AGAGCCAGGCATTTCTGGAAAGG - Intergenic
968369410 3:198213531-198213553 GGACACAGGAGATGCTGGGAGGG - Intergenic
968503288 4:960957-960979 GTACCCAGGTGGTGCTGGCATGG - Intronic
979257836 4:118623245-118623267 GGACACAGGAGATGCTGGGAGGG - Intergenic
979330513 4:119417317-119417339 GGACACAGGAGATGCTGGGAGGG + Intergenic
982215358 4:153078754-153078776 GGACACAGGAGCAGCTGGAAGGG - Intergenic
983951709 4:173649816-173649838 ATACCCATGCGTTGCTGGAGGGG - Intergenic
985590362 5:761399-761421 GGACCCAGGCTTTGGGGGTATGG + Intronic
991923575 5:71681801-71681823 GGACCCAAGCGTTTCTGGTTAGG + Intergenic
998171072 5:139872302-139872324 GGACCAGGGAGTGGCTGGAAGGG + Intronic
999191017 5:149747646-149747668 GGCCCCAGGCGCTGCTGGGCAGG - Intronic
1002728689 5:181319116-181319138 GGACACAGGAGATGCTGGGAGGG - Intergenic
1003092398 6:3115017-3115039 GGCTCCAGGCTTTGCTGGAGGGG + Exonic
1004564367 6:16781727-16781749 GGACCCAGGCGTAGGTGGCTGGG - Intergenic
1005813890 6:29535075-29535097 GGACCCAGGCTCTGTGGGAAGGG + Intergenic
1013155460 6:107489010-107489032 GGCCCCAGGCGTGGCAGGAGAGG + Intergenic
1016427537 6:143950301-143950323 GGAACCAGGGGTTGGGGGAAAGG - Intronic
1019157986 6:170051761-170051783 GGACCCAGGCAGGGCTGGAATGG - Intergenic
1019964454 7:4487244-4487266 GGACCCAGGTTTTAGTGGAAGGG + Intergenic
1020667777 7:11069309-11069331 GGACCCAGGGGCTTCTGGAAGGG + Intronic
1020976719 7:15015677-15015699 GGAGCCTGGAGTTGCTGGAATGG + Intergenic
1023399825 7:39784531-39784553 GGACACAGGAGATGCTGGGAGGG - Intergenic
1032122935 7:129169603-129169625 GGTCCCAGCGGCTGCTGGAAAGG - Intronic
1038240945 8:25807641-25807663 GGAGCCAGGGGCTGCTGGAGAGG - Intergenic
1038653751 8:29429740-29429762 GGATCCAGGGCTTGCTGGAGTGG + Intergenic
1039189670 8:34958733-34958755 AGACCGAGGCTTTGGTGGAAAGG + Intergenic
1039591874 8:38756821-38756843 GGACCCAGGCGGCCCTGCAAAGG - Intronic
1043920986 8:85983198-85983220 AGAGCCAGGCTTTGGTGGAATGG - Intergenic
1044232678 8:89797485-89797507 GGCCCTAGGTGTTACTGGAAAGG - Intergenic
1047898074 8:129388905-129388927 GGACACAGCAGTTGCTGGATGGG + Intergenic
1049396166 8:142402163-142402185 GGCGCCAGGTGTGGCTGGAAAGG + Intronic
1049580484 8:143408495-143408517 TGACCCAGGCCTGGCTGGGATGG + Intergenic
1049695819 8:143983846-143983868 GGACCCAGGAGGAGTTGGAATGG + Intronic
1050382322 9:5042735-5042757 GGACACAGGCATTGCTGCCAGGG + Intronic
1050528090 9:6563439-6563461 GGAGCCTGGGGATGCTGGAAAGG - Intronic
1052622831 9:30935920-30935942 GGCCCCAGGCCTGGCTGGGAAGG + Intergenic
1053367764 9:37535768-37535790 GGATCAAGGCCTTGCTTGAAAGG + Intronic
1056602173 9:88054888-88054910 GCACCCAGGGGGTGCTGGAGGGG + Intergenic
1061327898 9:129875192-129875214 GGACCCAGGAGGTGGTGGACAGG + Intronic
1062753749 9:138276215-138276237 GGACACAGGAGATGCTGGGAGGG - Intergenic
1203576264 Un_KI270745v1:10994-11016 GGACACAGGAGATGCTGGGAGGG - Intergenic
1187094879 X:16137309-16137331 GGACCCAGGTCATGCTGGAAAGG - Intronic
1187672365 X:21680803-21680825 GGACACAGGGTCTGCTGGAAGGG + Intergenic
1187719310 X:22134797-22134819 TAACCCAGGCCTTGCTGGGAAGG - Intronic
1188453034 X:30329001-30329023 GGTCTCAGGGGTTGATGGAAGGG - Intergenic
1191252727 X:58267146-58267168 TGGCCCAGGGGCTGCTGGAAAGG + Intergenic
1191815707 X:65241974-65241996 GGACCCAAGGCTTGATGGAATGG + Intergenic