ID: 1096389275 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:51217080-51217102 |
Sequence | GGGACCCAGGCGTTGCTGGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 199 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 14, 4: 183} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096389275_1096389291 | 20 | Left | 1096389275 | 12:51217080-51217102 | CCTTCCAGCAACGCCTGGGTCCC | 0: 1 1: 0 2: 1 3: 14 4: 183 |
||
Right | 1096389291 | 12:51217123-51217145 | CGTCCCGGAGTTTGTTCATTCGG | 0: 1 1: 0 2: 0 3: 1 4: 45 |
||||
1096389275_1096389292 | 21 | Left | 1096389275 | 12:51217080-51217102 | CCTTCCAGCAACGCCTGGGTCCC | 0: 1 1: 0 2: 1 3: 14 4: 183 |
||
Right | 1096389292 | 12:51217124-51217146 | GTCCCGGAGTTTGTTCATTCGGG | 0: 1 1: 0 2: 0 3: 6 4: 120 |
||||
1096389275_1096389280 | -4 | Left | 1096389275 | 12:51217080-51217102 | CCTTCCAGCAACGCCTGGGTCCC | 0: 1 1: 0 2: 1 3: 14 4: 183 |
||
Right | 1096389280 | 12:51217099-51217121 | TCCCTACCCCCGGGTCCCACCGG | 0: 1 1: 0 2: 1 3: 11 4: 164 |
||||
1096389275_1096389287 | 5 | Left | 1096389275 | 12:51217080-51217102 | CCTTCCAGCAACGCCTGGGTCCC | 0: 1 1: 0 2: 1 3: 14 4: 183 |
||
Right | 1096389287 | 12:51217108-51217130 | CCGGGTCCCACCGGTCGTCCCGG | 0: 1 1: 0 2: 0 3: 4 4: 51 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096389275 | Original CRISPR | GGGACCCAGGCGTTGCTGGA AGG (reversed) | Intronic | ||