ID: 1096389275

View in Genome Browser
Species Human (GRCh38)
Location 12:51217080-51217102
Sequence GGGACCCAGGCGTTGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389275_1096389291 20 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389275_1096389292 21 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389275_1096389280 -4 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389275_1096389287 5 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389275 Original CRISPR GGGACCCAGGCGTTGCTGGA AGG (reversed) Intronic