ID: 1096389276 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:51217084-51217106 |
| Sequence | GGTAGGGACCCAGGCGTTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 164 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 14, 4: 149} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1096389276_1096389292 | 17 | Left | 1096389276 | 12:51217084-51217106 | CCAGCAACGCCTGGGTCCCTACC | 0: 1 1: 0 2: 0 3: 14 4: 149 |
||
| Right | 1096389292 | 12:51217124-51217146 | GTCCCGGAGTTTGTTCATTCGGG | 0: 1 1: 0 2: 0 3: 6 4: 120 |
||||
| 1096389276_1096389280 | -8 | Left | 1096389276 | 12:51217084-51217106 | CCAGCAACGCCTGGGTCCCTACC | 0: 1 1: 0 2: 0 3: 14 4: 149 |
||
| Right | 1096389280 | 12:51217099-51217121 | TCCCTACCCCCGGGTCCCACCGG | 0: 1 1: 0 2: 1 3: 11 4: 164 |
||||
| 1096389276_1096389287 | 1 | Left | 1096389276 | 12:51217084-51217106 | CCAGCAACGCCTGGGTCCCTACC | 0: 1 1: 0 2: 0 3: 14 4: 149 |
||
| Right | 1096389287 | 12:51217108-51217130 | CCGGGTCCCACCGGTCGTCCCGG | 0: 1 1: 0 2: 0 3: 4 4: 51 |
||||
| 1096389276_1096389291 | 16 | Left | 1096389276 | 12:51217084-51217106 | CCAGCAACGCCTGGGTCCCTACC | 0: 1 1: 0 2: 0 3: 14 4: 149 |
||
| Right | 1096389291 | 12:51217123-51217145 | CGTCCCGGAGTTTGTTCATTCGG | 0: 1 1: 0 2: 0 3: 1 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1096389276 | Original CRISPR | GGTAGGGACCCAGGCGTTGC TGG (reversed) | Intronic | ||