ID: 1096389278

View in Genome Browser
Species Human (GRCh38)
Location 12:51217090-51217112
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389268_1096389278 3 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389270_1096389278 -8 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389269_1096389278 2 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389267_1096389278 6 Left 1096389267 12:51217061-51217083 CCTCCCATCACTGACCCACCCTT 0: 1
1: 3
2: 5
3: 53
4: 327
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389272_1096389278 -9 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
1096389266_1096389278 7 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389278 12:51217090-51217112 ACGCCTGGGTCCCTACCCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type