ID: 1096389279

View in Genome Browser
Species Human (GRCh38)
Location 12:51217093-51217115
Sequence GGACCCGGGGGTAGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389279_1096389291 7 Left 1096389279 12:51217093-51217115 CCTGGGTCCCTACCCCCGGGTCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389279_1096389295 22 Left 1096389279 12:51217093-51217115 CCTGGGTCCCTACCCCCGGGTCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1096389295 12:51217138-51217160 TCATTCGGGAGAACCGTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 31
1096389279_1096389292 8 Left 1096389279 12:51217093-51217115 CCTGGGTCCCTACCCCCGGGTCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389279_1096389287 -8 Left 1096389279 12:51217093-51217115 CCTGGGTCCCTACCCCCGGGTCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389279 Original CRISPR GGACCCGGGGGTAGGGACCC AGG (reversed) Intronic