ID: 1096389280

View in Genome Browser
Species Human (GRCh38)
Location 12:51217099-51217121
Sequence TCCCTACCCCCGGGTCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389269_1096389280 11 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389272_1096389280 0 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389275_1096389280 -4 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389268_1096389280 12 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389267_1096389280 15 Left 1096389267 12:51217061-51217083 CCTCCCATCACTGACCCACCCTT 0: 1
1: 3
2: 5
3: 53
4: 327
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389270_1096389280 1 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389276_1096389280 -8 Left 1096389276 12:51217084-51217106 CCAGCAACGCCTGGGTCCCTACC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389266_1096389280 16 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164
1096389274_1096389280 -3 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389280 12:51217099-51217121 TCCCTACCCCCGGGTCCCACCGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389280 Original CRISPR TCCCTACCCCCGGGTCCCAC CGG Intronic