ID: 1096389282

View in Genome Browser
Species Human (GRCh38)
Location 12:51217101-51217123
Sequence GACCGGTGGGACCCGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389282_1096389292 0 Left 1096389282 12:51217101-51217123 CCTACCCCCGGGTCCCACCGGTC 0: 1
1: 0
2: 1
3: 5
4: 161
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389282_1096389291 -1 Left 1096389282 12:51217101-51217123 CCTACCCCCGGGTCCCACCGGTC 0: 1
1: 0
2: 1
3: 5
4: 161
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389282_1096389296 23 Left 1096389282 12:51217101-51217123 CCTACCCCCGGGTCCCACCGGTC 0: 1
1: 0
2: 1
3: 5
4: 161
Right 1096389296 12:51217147-51217169 AGAACCGTGACAGGTCACCCTGG 0: 1
1: 0
2: 0
3: 2
4: 72
1096389282_1096389295 14 Left 1096389282 12:51217101-51217123 CCTACCCCCGGGTCCCACCGGTC 0: 1
1: 0
2: 1
3: 5
4: 161
Right 1096389295 12:51217138-51217160 TCATTCGGGAGAACCGTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389282 Original CRISPR GACCGGTGGGACCCGGGGGT AGG (reversed) Intronic