ID: 1096389284

View in Genome Browser
Species Human (GRCh38)
Location 12:51217106-51217128
Sequence GGGACGACCGGTGGGACCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389284_1096389291 -6 Left 1096389284 12:51217106-51217128 CCCCGGGTCCCACCGGTCGTCCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1096389284_1096389296 18 Left 1096389284 12:51217106-51217128 CCCCGGGTCCCACCGGTCGTCCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1096389296 12:51217147-51217169 AGAACCGTGACAGGTCACCCTGG 0: 1
1: 0
2: 0
3: 2
4: 72
1096389284_1096389292 -5 Left 1096389284 12:51217106-51217128 CCCCGGGTCCCACCGGTCGTCCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389284_1096389295 9 Left 1096389284 12:51217106-51217128 CCCCGGGTCCCACCGGTCGTCCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1096389295 12:51217138-51217160 TCATTCGGGAGAACCGTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389284 Original CRISPR GGGACGACCGGTGGGACCCG GGG (reversed) Intronic