ID: 1096389286

View in Genome Browser
Species Human (GRCh38)
Location 12:51217108-51217130
Sequence CCGGGACGACCGGTGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389286_1096389298 29 Left 1096389286 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1096389298 12:51217160-51217182 GTCACCCTGGCCGCCCCAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 293
1096389286_1096389296 16 Left 1096389286 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1096389296 12:51217147-51217169 AGAACCGTGACAGGTCACCCTGG 0: 1
1: 0
2: 0
3: 2
4: 72
1096389286_1096389295 7 Left 1096389286 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1096389295 12:51217138-51217160 TCATTCGGGAGAACCGTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 31
1096389286_1096389292 -7 Left 1096389286 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389286_1096389291 -8 Left 1096389286 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1096389291 12:51217123-51217145 CGTCCCGGAGTTTGTTCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389286 Original CRISPR CCGGGACGACCGGTGGGACC CGG (reversed) Intronic