ID: 1096389287

View in Genome Browser
Species Human (GRCh38)
Location 12:51217108-51217130
Sequence CCGGGTCCCACCGGTCGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389279_1096389287 -8 Left 1096389279 12:51217093-51217115 CCTGGGTCCCTACCCCCGGGTCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389266_1096389287 25 Left 1096389266 12:51217060-51217082 CCCTCCCATCACTGACCCACCCT 0: 1
1: 1
2: 2
3: 43
4: 476
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389268_1096389287 21 Left 1096389268 12:51217064-51217086 CCCATCACTGACCCACCCTTCCA 0: 1
1: 3
2: 5
3: 62
4: 519
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389267_1096389287 24 Left 1096389267 12:51217061-51217083 CCTCCCATCACTGACCCACCCTT 0: 1
1: 3
2: 5
3: 53
4: 327
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389275_1096389287 5 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389269_1096389287 20 Left 1096389269 12:51217065-51217087 CCATCACTGACCCACCCTTCCAG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389272_1096389287 9 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389270_1096389287 10 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389274_1096389287 6 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1096389276_1096389287 1 Left 1096389276 12:51217084-51217106 CCAGCAACGCCTGGGTCCCTACC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389287 Original CRISPR CCGGGTCCCACCGGTCGTCC CGG Intronic
905168789 1:36098374-36098396 CCGGGTTTCACGGGTCGCCCTGG - Exonic
906034458 1:42741652-42741674 TTGGGACCCACAGGTCGTCCAGG - Intergenic
910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG + Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
924017939 1:239748007-239748029 CAGAGTCTCACCTGTCGTCCAGG - Intronic
1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG + Intronic
1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG + Intronic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1090026743 11:123174055-123174077 CAGGGTCCCACCTGTTGCCCAGG - Intronic
1091720580 12:2810444-2810466 CTGGGTCCCACAGGTATTCCTGG - Intergenic
1094199303 12:27780360-27780382 CCGGGTAGCAGCGGTCCTCCAGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1122273031 14:100576870-100576892 CCGGGTGACACAGGTAGTCCGGG - Intronic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1131260364 15:90884563-90884585 CCAGCTCCCACCGCTCCTCCAGG - Intronic
1146446909 17:32939525-32939547 CCTGGTCTCACCGTGCGTCCAGG - Exonic
1147139604 17:38453818-38453840 CCGGGGCCCGCCGGCCGCCCGGG + Intronic
1148793591 17:50186903-50186925 CAGGGTCCCCCCGGCCCTCCTGG - Exonic
1152230189 17:79110449-79110471 CCGGGTCCCACCTGCTGTCCAGG - Intronic
1152834533 17:82520426-82520448 CTGGGTCCCGCTGGTGGTCCCGG - Intronic
1152919850 17:83060768-83060790 CCGGGTCCCACAGGCTGTACAGG - Intergenic
1154194222 18:12254197-12254219 CTGGGAGCCCCCGGTCGTCCTGG - Intergenic
1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG + Exonic
1165461159 19:35945068-35945090 CCAGGTCCCACAGGGTGTCCGGG - Exonic
1165886734 19:39084218-39084240 CCGGGTCCCACAGGTCCGGCCGG - Intronic
1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG + Intronic
926112979 2:10194586-10194608 CCGGGGCCCACCGGTGGTTGGGG - Intronic
926329233 2:11811068-11811090 CTGGGTCCCACCTGTCCTTCTGG + Intronic
936938321 2:117859115-117859137 CCGGGTGCCACCGGCCGCCAGGG - Intergenic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
1169483523 20:6006513-6006535 CCGGGCCCCACTGGCCGCCCGGG - Exonic
1175913010 20:62413608-62413630 AGGGGTCCCACCGGCTGTCCAGG - Intronic
950043256 3:9933540-9933562 CCTGGTCCCACCCCGCGTCCCGG - Exonic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
952064094 3:29546999-29547021 CAGGGTCCCACTGGTCACCCAGG + Intronic
953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG + Intronic
960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG + Intronic
985882909 5:2654023-2654045 CCGGGTCCCCCTCGTCTTCCAGG + Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1005994914 6:30925312-30925334 CCGGGTCCAAGAGGTCGTGCAGG + Exonic
1009935749 6:70232672-70232694 CCTGGTCCCCCCGGCCCTCCTGG - Exonic
1013556230 6:111259651-111259673 CCCGGTCCCACCGCTCTGCCAGG - Exonic
1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG + Exonic
1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG + Intronic
1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG + Exonic
1033547314 7:142413208-142413230 CAGGGTCCCTCCGATGGTCCAGG - Intergenic
1035248244 7:157579604-157579626 CCGGGTCCCCCCAGTCGACGGGG - Intronic
1038373126 8:27012321-27012343 CCTGGTCCCACCGCAGGTCCTGG - Intergenic
1046687151 8:117240130-117240152 CCTGGTGCCACCTGTGGTCCTGG - Intergenic
1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG + Intergenic
1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG + Exonic
1056020396 9:82433080-82433102 CCTGGTCCCACCGCAGGTCCTGG - Intergenic
1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG + Intronic
1062248718 9:135583719-135583741 CCGGGTCCCTCCTCTCATCCCGG - Intergenic
1192496977 X:71622699-71622721 CCGGGCCCCACCTGTGGTCAAGG + Intergenic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic