ID: 1096389292

View in Genome Browser
Species Human (GRCh38)
Location 12:51217124-51217146
Sequence GTCCCGGAGTTTGTTCATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389270_1096389292 26 Left 1096389270 12:51217075-51217097 CCCACCCTTCCAGCAACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389281_1096389292 1 Left 1096389281 12:51217100-51217122 CCCTACCCCCGGGTCCCACCGGT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389274_1096389292 22 Left 1096389274 12:51217079-51217101 CCCTTCCAGCAACGCCTGGGTCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389282_1096389292 0 Left 1096389282 12:51217101-51217123 CCTACCCCCGGGTCCCACCGGTC 0: 1
1: 0
2: 1
3: 5
4: 161
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389285_1096389292 -6 Left 1096389285 12:51217107-51217129 CCCGGGTCCCACCGGTCGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389284_1096389292 -5 Left 1096389284 12:51217106-51217128 CCCCGGGTCCCACCGGTCGTCCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389272_1096389292 25 Left 1096389272 12:51217076-51217098 CCACCCTTCCAGCAACGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389283_1096389292 -4 Left 1096389283 12:51217105-51217127 CCCCCGGGTCCCACCGGTCGTCC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389279_1096389292 8 Left 1096389279 12:51217093-51217115 CCTGGGTCCCTACCCCCGGGTCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389275_1096389292 21 Left 1096389275 12:51217080-51217102 CCTTCCAGCAACGCCTGGGTCCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389286_1096389292 -7 Left 1096389286 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1096389276_1096389292 17 Left 1096389276 12:51217084-51217106 CCAGCAACGCCTGGGTCCCTACC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1096389292 12:51217124-51217146 GTCCCGGAGTTTGTTCATTCGGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389292 Original CRISPR GTCCCGGAGTTTGTTCATTC GGG Intronic