ID: 1096389502

View in Genome Browser
Species Human (GRCh38)
Location 12:51217803-51217825
Sequence GCGGGTCCCGACCAGCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389502_1096389514 7 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389514 12:51217833-51217855 CCCAGGCCCCCAGCCTGGGCTGG 0: 1
1: 2
2: 10
3: 100
4: 766
1096389502_1096389516 8 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389516 12:51217834-51217856 CCAGGCCCCCAGCCTGGGCTGGG 0: 1
1: 1
2: 12
3: 85
4: 766
1096389502_1096389524 22 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389524 12:51217848-51217870 TGGGCTGGGCAGAGCCGAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 369
1096389502_1096389523 21 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389523 12:51217847-51217869 CTGGGCTGGGCAGAGCCGAAGGG 0: 1
1: 0
2: 3
3: 29
4: 374
1096389502_1096389525 23 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389525 12:51217849-51217871 GGGCTGGGCAGAGCCGAAGGGGG 0: 1
1: 0
2: 4
3: 58
4: 566
1096389502_1096389509 2 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389509 12:51217828-51217850 CCGCCCCCAGGCCCCCAGCCTGG 0: 1
1: 0
2: 13
3: 168
4: 875
1096389502_1096389522 20 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389522 12:51217846-51217868 CCTGGGCTGGGCAGAGCCGAAGG 0: 1
1: 0
2: 5
3: 46
4: 468
1096389502_1096389504 -10 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389504 12:51217816-51217838 CGGGACCCGCCGCCGCCCCCAGG 0: 1
1: 0
2: 6
3: 51
4: 370
1096389502_1096389510 3 Left 1096389502 12:51217803-51217825 CCCGGGAGCTGGTCGGGACCCGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1096389510 12:51217829-51217851 CGCCCCCAGGCCCCCAGCCTGGG 0: 1
1: 0
2: 5
3: 79
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389502 Original CRISPR GCGGGTCCCGACCAGCTCCC GGG (reversed) Intergenic
902669954 1:17966356-17966378 TCAGGTCCCTTCCAGCTCCCAGG + Intergenic
905317768 1:37094554-37094576 GCTGGGCCCCACCAGCCCCCAGG + Intergenic
913453406 1:119007797-119007819 GCGGGGCCCGAGCAGCGGCCAGG - Intergenic
915319351 1:155047748-155047770 GCTGGTCCTGACCAGACCCCTGG + Intronic
915637244 1:157195512-157195534 CCGGGGCAGGACCAGCTCCCAGG + Intergenic
915835375 1:159171742-159171764 GCGCTTCCCGGCCGGCTCCCTGG - Exonic
916747929 1:167698567-167698589 TCTGCTCCCCACCAGCTCCCAGG + Intronic
919724693 1:200873984-200874006 GCAGGCCCCGTCCAGCGCCCGGG - Exonic
1071603690 10:86970990-86971012 CCGAGTCCAGCCCAGCTCCCAGG - Intronic
1076163755 10:128266034-128266056 GAGGGTCCTCACCAGCCCCCTGG - Intergenic
1076747436 10:132521496-132521518 GGGGGTCCCGGAGAGCTCCCTGG + Intergenic
1077141592 11:1027219-1027241 GGGGGTCCCTGCCAGGTCCCGGG - Intronic
1077516892 11:3007460-3007482 GGGGGTCCTGACCGGCACCCAGG + Intronic
1077541405 11:3148174-3148196 GCGGTTTCCGACCTGCTCCCCGG - Intronic
1079133583 11:17763442-17763464 GCGTGTCCGGGCCATCTCCCAGG - Intronic
1084428752 11:69099970-69099992 TCCGCTCCTGACCAGCTCCCTGG + Intergenic
1084772075 11:71349783-71349805 AAGGGTCTCGACCAGCTTCCTGG + Intergenic
1085507146 11:77067059-77067081 GCGGGTCCAGCCGGGCTCCCGGG - Exonic
1096389502 12:51217803-51217825 GCGGGTCCCGACCAGCTCCCGGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101931812 12:109020948-109020970 GCGGGTGCTGTCCAGCTTCCCGG - Exonic
1104787090 12:131456837-131456859 GCCGTTCCCTACCAGCTGCCTGG - Intergenic
1114157115 14:20117541-20117563 GCTGGGACTGACCAGCTCCCAGG + Exonic
1114485295 14:23058100-23058122 TCTGTTCCCGACCCGCTCCCTGG - Intergenic
1117803006 14:59464477-59464499 GGGCGCCCCGAGCAGCTCCCAGG + Exonic
1119777251 14:77256881-77256903 GGGGGTCCTGACCTGCTGCCCGG + Exonic
1121250198 14:92493644-92493666 GGGTGTCCAGATCAGCTCCCAGG - Exonic
1122864650 14:104598065-104598087 GGGTGTCCCGACCACCTGCCCGG - Intronic
1126356573 15:47802318-47802340 GCAGTTCCTAACCAGCTCCCAGG - Intergenic
1129193483 15:73951262-73951284 GCGCGGCCCTCCCAGCTCCCCGG + Intronic
1129856884 15:78831047-78831069 GCTGCTCCCTAACAGCTCCCTGG + Intronic
1132407344 15:101551860-101551882 GCGGGGCCTGAGCAGCTCCTAGG + Intergenic
1132760398 16:1506089-1506111 TCCGGCCCCGCCCAGCTCCCAGG - Intronic
1134666920 16:16025418-16025440 GCGGTTCCCAACAAGTTCCCAGG + Intronic
1142177884 16:88653230-88653252 GGGGGGCCCGCCCAGCCCCCAGG - Intronic
1143015645 17:3889915-3889937 CCAGGGCCTGACCAGCTCCCAGG - Intronic
1143141966 17:4745869-4745891 GCGGGGCCCGCCCGGCGCCCGGG + Exonic
1147948417 17:44093277-44093299 GCGGGGCCCTACGAGGTCCCAGG + Intronic
1149439384 17:56662272-56662294 CCGGGTCCTGACCAGCAGCCTGG + Intergenic
1151719176 17:75845928-75845950 GCAGGTCCCGGCCAGCACACAGG + Exonic
1151907149 17:77056129-77056151 GGGTGTCCCTGCCAGCTCCCCGG - Intergenic
1151971959 17:77462363-77462385 GTGGGTTCAGAGCAGCTCCCGGG - Intronic
1152239777 17:79155240-79155262 GCGGGTTCTGAGCAGCGCCCTGG - Intronic
1152604711 17:81283302-81283324 GCTTCTCCCGACCAGCACCCAGG + Intronic
1157602383 18:48902101-48902123 GCCCGGCCCGACCAGCCCCCAGG + Intergenic
1161086933 19:2339707-2339729 CCGGGTCCCCTCCTGCTCCCGGG + Intronic
1161238263 19:3208477-3208499 GCGGCCCCAGCCCAGCTCCCAGG + Exonic
1161361951 19:3855470-3855492 GCTGGTCCCCACTAGCACCCAGG - Intronic
1161587459 19:5113432-5113454 GGGGGAACCGACCACCTCCCTGG - Intronic
1162268997 19:9598761-9598783 TTGTGTCCCCACCAGCTCCCTGG - Intergenic
1162810755 19:13163228-13163250 GGGGGTCGCGCCCAGGTCCCGGG + Intergenic
1163294668 19:16404565-16404587 GTGGGTCCCGGCCACCTCCGGGG - Intronic
1163808981 19:19418559-19418581 TGGGTTCCCAACCAGCTCCCAGG - Intronic
1165055971 19:33176601-33176623 CCGGGGCCCTGCCAGCTCCCGGG - Intergenic
1166375219 19:42324043-42324065 GCGGCTCTCCCCCAGCTCCCCGG + Intronic
1166753869 19:45178920-45178942 GCTGGTCCCGAGCAGCTCACGGG + Intronic
1168257612 19:55175228-55175250 GCGGGTCCCTATGAGCTCCGTGG - Exonic
924987926 2:288239-288261 GCGGGTGCCAGGCAGCTCCCCGG + Exonic
925158030 2:1662104-1662126 GCAGCTCCCGTGCAGCTCCCAGG - Exonic
925991512 2:9258974-9258996 GCGGGGCCAGACCAGGACCCTGG + Intronic
926801881 2:16666037-16666059 GCGGGTCCGCACCAGCTCCTGGG - Intronic
927787147 2:25981998-25982020 GCGGGGCCGGCCCAGCCCCCAGG + Exonic
931642937 2:64397252-64397274 GGGGGTCCTGGGCAGCTCCCTGG + Intergenic
931906058 2:66845316-66845338 GCATGTCCCAACCAGCTTCCTGG - Intergenic
932209625 2:69915705-69915727 GCTGGTCCCGGCCGGCCCCCAGG + Intronic
934656020 2:96117076-96117098 GCCGGTCCCGACCCTTTCCCAGG + Intergenic
937261242 2:120587731-120587753 GCCGGTCCCGACCTGCGGCCCGG + Intergenic
938195069 2:129319542-129319564 GCGGGCTCCCACCAGCTCCATGG + Intergenic
940422947 2:153499973-153499995 GCTTGTTCCCACCAGCTCCCTGG + Intergenic
946420588 2:219562377-219562399 GTGGGCCCAGCCCAGCTCCCCGG - Intronic
947602917 2:231465332-231465354 GTGGCTCTCGACCTGCTCCCGGG - Intronic
1168895627 20:1321503-1321525 GCAGGTCCCCATCATCTCCCTGG + Intronic
1169065893 20:2693891-2693913 GACGGTCCCGGCGAGCTCCCCGG + Intronic
1171242455 20:23582519-23582541 GGGGGGCCCAACAAGCTCCCAGG + Intergenic
1175997291 20:62817477-62817499 CCGGGTCCCGAGCGGCTCCGGGG - Intronic
1176159603 20:63641595-63641617 GCGGGGCCCAGCCAGCTCCCAGG - Intronic
1176625398 21:9087748-9087770 GCGGGTGCCGATGAGCTCGCAGG - Intergenic
1179480183 21:41671981-41672003 GCCGGCCCCCAGCAGCTCCCTGG - Intergenic
1180096250 21:45556407-45556429 GCTGCTCCCCACCAGCGCCCGGG + Intergenic
1181074552 22:20367000-20367022 TCGGGGCGAGACCAGCTCCCTGG - Intronic
1183192039 22:36327806-36327828 GCAGGTCCCACTCAGCTCCCAGG - Intronic
1183393729 22:37560365-37560387 GCGGGGCCCGGCCCCCTCCCCGG - Intergenic
1184676061 22:46044180-46044202 GCTGGCCCGGCCCAGCTCCCCGG - Intergenic
1185095423 22:48803698-48803720 GCGGGTCCTGACCAGCACACTGG + Intronic
953881490 3:46693527-46693549 GCGGTCCCCGCCCAGCTCCTTGG - Intronic
954611062 3:51944810-51944832 GCGGGTGCAGCCCTGCTCCCTGG + Exonic
957079064 3:75621884-75621906 GCTGGTCCTGGCCTGCTCCCTGG + Intergenic
957865069 3:86012634-86012656 GCGGGACCCGGCCAGATGCCAGG + Intronic
968879934 4:3293413-3293435 GCGGGTCCCGCCAAGGGCCCGGG - Intronic
973230885 4:47837673-47837695 CCTGGTCCCGACCACCACCCCGG - Intronic
986019450 5:3787589-3787611 GCAAGTCCCGCCCATCTCCCTGG + Intergenic
987132464 5:14872005-14872027 GCGAGTCCCGCCCAGCGCCCCGG - Intergenic
988796234 5:34656127-34656149 GCAGGTCCCGGCCAGAGCCCGGG + Intergenic
989103108 5:37838619-37838641 GCGGGTTCCCGCCAGCTTCCTGG - Intronic
998849908 5:146342673-146342695 GCGGATCTCCCCCAGCTCCCTGG + Intergenic
1001060766 5:168486754-168486776 GAGGGTCCCCACCCTCTCCCAGG + Intronic
1002484242 5:179523781-179523803 GGGGGTCACGACCACCTCCTGGG - Intergenic
1006500751 6:34457583-34457605 GTGGGACCCCACCAGCTCCATGG - Intergenic
1019153247 6:170023111-170023133 GCGGGTCCCGACCCACTTCAGGG - Intergenic
1020852649 7:13376853-13376875 GCCGGGCCCTATCAGCTCCCCGG + Intergenic
1022207542 7:28179616-28179638 GCGGGCCGCGCCCAGCGCCCCGG - Intronic
1022285986 7:28956610-28956632 GCGGTTGCCTACCAGCTCCCTGG + Exonic
1022502040 7:30887764-30887786 GCGGGTCCCCGTCAGCACCCAGG - Intronic
1029629843 7:101743492-101743514 GCCGCTCCCGAGCAGCTCCGCGG - Intergenic
1032218736 7:129977937-129977959 GCTGGTCCCCACCATCTCTCTGG - Intergenic
1032550621 7:132780914-132780936 GCTGGTCCTGCCCATCTCCCTGG - Intergenic
1035266801 7:157693641-157693663 GCGGTTCCCCAGCTGCTCCCCGG - Intronic
1036788599 8:11703615-11703637 TGGGCTCCCGACCATCTCCCTGG + Intronic
1037424411 8:18740110-18740132 GTGGGTCCAGAGCAGCTCCATGG - Intronic
1057716703 9:97501661-97501683 GCGGGGCTGGACGAGCTCCCGGG - Exonic
1060481675 9:124019885-124019907 GCAGGTCCCCATCAGCTTCCAGG + Intronic
1060977549 9:127773960-127773982 GCAGGTCCCAACCAGCCCCTGGG + Intronic
1061420739 9:130471854-130471876 GCCTGTGCCCACCAGCTCCCAGG + Intronic
1062269649 9:135702639-135702661 GGGGGTCCTGAGCATCTCCCAGG + Intronic
1062279357 9:135745016-135745038 ACGGGTCCCGACCCCCACCCTGG - Intronic
1190322207 X:49186007-49186029 AGGGGTCCCCACCAGGTCCCAGG + Intronic
1190339615 X:49286316-49286338 GCGGGCCCTGAACAGCGCCCTGG + Exonic
1195636189 X:107118502-107118524 GCAGCACCCGGCCAGCTCCCGGG + Intronic