ID: 1096389838

View in Genome Browser
Species Human (GRCh38)
Location 12:51219439-51219461
Sequence AGTCCAGGGAGAGAAACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096389838_1096389841 -1 Left 1096389838 12:51219439-51219461 CCTGTAGTTTCTCTCCCTGGACT 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1096389841 12:51219461-51219483 TGTGAATTCTTTGAGAGCACTGG 0: 1
1: 0
2: 2
3: 27
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096389838 Original CRISPR AGTCCAGGGAGAGAAACTAC AGG (reversed) Intergenic
900226987 1:1537520-1537542 GGTGCAGGGAGAGGAGCTACAGG - Intronic
902836426 1:19049883-19049905 AGAGCAGGGAGAGAAGTTACAGG + Intergenic
905728095 1:40272214-40272236 AGGCCAGGGATAGAAACTGGTGG + Intronic
905803243 1:40859286-40859308 AGGCCAGAGACAGAAACCACAGG - Intergenic
905882538 1:41474151-41474173 AGGCCAGGGAAGGAAACTTCAGG + Intergenic
905927377 1:41761059-41761081 AGTCTGGTGAGAGAGACTACAGG + Intronic
906225024 1:44114571-44114593 ATTCCAGGCAGAGATAATACAGG + Intergenic
906927357 1:50132680-50132702 TGTCCAAGGAGAGATCCTACAGG + Intronic
907275980 1:53316864-53316886 AGGCCAGGAAGAGAGACTGCTGG + Intronic
910550085 1:88465501-88465523 ATGCCAGGGAGAGAAAATTCAGG + Intergenic
910867453 1:91801401-91801423 TGGCCAGGGAGAGAATCCACTGG + Intronic
912448000 1:109751994-109752016 GGTCCAGGGAGAGAAGCTGGAGG - Exonic
912791052 1:112651403-112651425 AGTTCAGGGATAGATGCTACTGG + Intronic
913174561 1:116262246-116262268 AGGCCATGGAGAGTAATTACAGG + Intergenic
913440752 1:118894670-118894692 AGGGCAGGGAGGGAAACTTCCGG + Intronic
913588643 1:120301470-120301492 ATTCCAGGCAGAGAAACATCAGG + Intergenic
913619542 1:120596899-120596921 ATTCCAGGCAGAGAAACATCAGG - Intergenic
914570665 1:148913341-148913363 ATTCCAGGCAGAGAAACATCAGG + Intronic
914602166 1:149216928-149216950 ATTCCAGGCAGAGAAACATCAGG - Intergenic
914857113 1:151360794-151360816 AGACCAAGGAGAGAAACTTCTGG + Intergenic
916942393 1:169689482-169689504 AGTTCAGAGAGAGTAACAACTGG + Intronic
918482826 1:184998015-184998037 ATTCCTGGGAGTGAAAATACTGG - Intergenic
921546017 1:216475780-216475802 AGGAAAGGGAGAGAAAATACTGG + Intergenic
922108527 1:222533768-222533790 AGCACAGGGAGGGAAAATACAGG + Intronic
1063019720 10:2115753-2115775 ACTACAGGGAGGGAAGCTACAGG - Intergenic
1063222025 10:3977910-3977932 ATTCCAGGGAGAGAGGCCACTGG - Intergenic
1064415564 10:15146405-15146427 AGTCCAGAGAGAGAAACGATGGG - Intronic
1066046239 10:31597984-31598006 ATTCCATGGAGAGAATCTCCAGG + Intergenic
1066052900 10:31651701-31651723 ATTCCAGAGAGGAAAACTACGGG - Intergenic
1066401785 10:35083821-35083843 AGTTGAAGGAGAGAAAGTACAGG - Intronic
1066621758 10:37362370-37362392 AGGCAAGGGAGAGAAATTAAAGG - Intronic
1068139935 10:52992882-52992904 AGTCAAGGCAGAGAAGATACAGG + Intergenic
1068867269 10:61907682-61907704 ATTACATGGAGAGAAATTACTGG + Intronic
1071445533 10:85743005-85743027 AGTCGGGGGAGAGGCACTACTGG - Intronic
1073480622 10:103784148-103784170 AGTGCAGGGAGAGAAGATGCTGG + Intronic
1073897793 10:108183468-108183490 TGTCAAGGGAGAGAAGCGACTGG + Intergenic
1074413753 10:113249481-113249503 AGTCCAGGTAGAGAAAAGGCTGG + Intergenic
1074555069 10:114481353-114481375 GCTCTAAGGAGAGAAACTACAGG + Intronic
1075067095 10:119296424-119296446 AGTAAAGGGAGAGGAACCACTGG + Intronic
1075654417 10:124151950-124151972 AGTCCAGGGATGGAAGCTCCCGG - Intergenic
1079006410 11:16794406-16794428 TCTCCTGGGAGAGAAACTCCTGG - Intronic
1079716540 11:23755297-23755319 AGGCCAGTGAGAGAACCTCCTGG - Intergenic
1081526004 11:43928227-43928249 AGACCTGGGAGAGAGACTGCAGG + Intronic
1083826178 11:65205327-65205349 AAGACAGGGAGAGAAACTTCTGG + Intronic
1084605541 11:70169713-70169735 AGCCCAGGGAGAGAACTTGCAGG + Intronic
1086259744 11:84924565-84924587 ATTTCAGGGAGAGAAATTAAAGG + Intronic
1087886356 11:103487597-103487619 AGTCCAAGGCCAGAAACTAGGGG - Intergenic
1088313841 11:108487469-108487491 AGTGCAGGGAGGGAAACTGTAGG + Intronic
1089270675 11:117299653-117299675 AGACCGGGGAGAGAGACCACGGG - Intronic
1089753692 11:120670202-120670224 AATCCAGGGAGAAATAATACTGG - Intronic
1091819664 12:3466314-3466336 AGTCAAAGGAGAGAAACTTGGGG - Intronic
1092145280 12:6210428-6210450 AGGCCAGGGAGAGGAAGCACCGG + Intronic
1093146025 12:15567771-15567793 AATCCAGGGAGAGTAAGTCCTGG - Intronic
1096389838 12:51219439-51219461 AGTCCAGGGAGAGAAACTACAGG - Intergenic
1099712385 12:86243949-86243971 AGTCCAGGAGGAGAAAAGACTGG + Intronic
1102886718 12:116527567-116527589 AGTCCAAGAAGAGAAAGTGCAGG - Intergenic
1103719094 12:122964005-122964027 AGCCCAGGGAGGGAAGCTCCTGG + Intronic
1104110928 12:125703534-125703556 AGTCCTGGGAGAGAAAGTTTAGG - Intergenic
1108160075 13:47630019-47630041 AGTCCCTGGAGAGAAACTTATGG + Intergenic
1108363870 13:49691470-49691492 AAAGCAGGGAGAGAAACGACGGG + Exonic
1109719934 13:66262862-66262884 AGTCCATGTAGATAAACAACTGG - Intergenic
1113596848 13:111539727-111539749 CCACCGGGGAGAGAAACTACAGG - Intergenic
1115855099 14:37622400-37622422 AGTCCCGGGGGCGAAACGACCGG - Intronic
1117236297 14:53780573-53780595 ATTCCAAGGAGAGAAATTACAGG + Intergenic
1117938202 14:60931397-60931419 AGGCCAGGGAGAGAAATAATTGG + Intronic
1118238120 14:64029379-64029401 ATCCCAGGGAGAGAAACTAAAGG + Intronic
1118857106 14:69632223-69632245 AGACCAGGGAGAGAAGCAGCAGG - Intronic
1119418055 14:74488289-74488311 ATTCCAGGAAGACAAAATACTGG - Intronic
1119543882 14:75457945-75457967 ATTCCAGAGAGAGATGCTACAGG - Intronic
1119774273 14:77238874-77238896 AGTCCAGGGAGAGCCACCCCGGG - Intronic
1120065751 14:80039112-80039134 AGGCAAGGGAGAGAATCTCCTGG - Intergenic
1120302962 14:82731668-82731690 TGTGCTGTGAGAGAAACTACTGG - Intergenic
1120614352 14:86684396-86684418 AGTACATGGAGAGAAAATACAGG - Intergenic
1120834891 14:89030630-89030652 AGTTCAGGGAGAGACACTCCAGG - Intergenic
1122352277 14:101103133-101103155 ACTCCAGGGAGAGTCACCACCGG - Intergenic
1122943685 14:104995103-104995125 AGTCCAGGGGGAGCAACTTGTGG + Exonic
1123159898 14:106268201-106268223 AGTCCTGGGACAGAAACCTCAGG - Intergenic
1126251457 15:46572654-46572676 AGTCCAGGAAGAGAGCCTGCAGG - Intergenic
1126330406 15:47525123-47525145 AGGACAGAGAGAGAGACTACTGG - Intronic
1126484056 15:49159609-49159631 ATTCCAAGAAGAGAAATTACAGG + Intronic
1126774657 15:52089949-52089971 AGTTCAAAGAGAGAACCTACAGG + Intergenic
1128292854 15:66491699-66491721 AGTCCAGAGATTGAAATTACAGG - Exonic
1129625373 15:77192560-77192582 AGTCCAGTGATACAAACCACAGG - Intronic
1129973033 15:79796997-79797019 AGTCCAGGGAGAGTGACTTTGGG - Intergenic
1130443089 15:83974959-83974981 AGTACAAGGAGAGAGACCACAGG - Intronic
1130630012 15:85558029-85558051 ATTCTGGGGAGAAAAACTACTGG - Intronic
1138624305 16:58236982-58237004 TGTCCAGGCAGAGGAACTACCGG + Intronic
1139811267 16:69619694-69619716 AGTGCAGGGAGATAAGCCACAGG - Intronic
1144166898 17:12621189-12621211 AGCCCAAGGAGTGAAACTGCTGG + Intergenic
1144316278 17:14064834-14064856 ATTCCTGGGAGAGAAACTGCTGG + Intergenic
1146952791 17:36918464-36918486 AGTCCAGGGAGGGAAGAGACAGG - Intergenic
1150914096 17:69418783-69418805 ATTCCAGGGAGCAAAACCACAGG + Intronic
1152002994 17:77658483-77658505 AGTCCATGGAAACAAACAACCGG + Intergenic
1156393441 18:36675004-36675026 ATTCCAGGGAAAGGAAATACAGG - Intronic
1156940488 18:42761207-42761229 AGTCCAAGGAGAAAAGCTAAAGG - Intronic
1157616778 18:48991842-48991864 AGTCTAGGGAGAGAAAACCCAGG - Intergenic
1160237554 18:77098008-77098030 AGGCCAGCAAGAGAAGCTACGGG - Intronic
1160398882 18:78594322-78594344 AGGCCAGGGAAAGAAACAAAAGG + Intergenic
1163258962 19:16175182-16175204 AGGCCAGGTAGAGAAAACACAGG - Intergenic
1163615746 19:18327098-18327120 AGTCCAGGGTGAGGAACTTCTGG + Intergenic
1164383268 19:27753072-27753094 AGTCTAGGGATAGAGACAACTGG - Intergenic
1165403960 19:35618803-35618825 AAACCAGGGAGAGACACTGCAGG - Intronic
1165770463 19:38376900-38376922 AGTCCAGTGAGAGAAAGGGCTGG - Intronic
1166419000 19:42620014-42620036 AGACCAGGGAGAAGACCTACAGG + Intronic
925873734 2:8293904-8293926 TGGCCATGGAGAGAAGCTACAGG + Intergenic
927967622 2:27281361-27281383 AGTCCAGGGAGAGAAGTTTGAGG - Exonic
928993123 2:37256667-37256689 AATCCATGGAGAGAAATTTCTGG - Exonic
931755704 2:65372231-65372253 AGTCCAGGAACAGAATTTACGGG - Intronic
933642802 2:84782331-84782353 AGCCCTGGGAGAGAACCTCCAGG + Intronic
934117368 2:88810330-88810352 AGTCCTGGGAAAGAAAATTCTGG - Intergenic
935732280 2:106074010-106074032 AGCCCATGTAGAGAAACTGCTGG - Exonic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
941219236 2:162754627-162754649 AGTCCAGGAAAAGAAACTTGGGG + Intronic
941304398 2:163844130-163844152 ATTCAAGGAAGAAAAACTACAGG - Intergenic
941367705 2:164627424-164627446 AGTCCAGGGGGAATAACCACCGG + Intergenic
943749588 2:191497352-191497374 AGACCAGGGAGAGAAAGTGGAGG + Intergenic
945206280 2:207335527-207335549 TGTCCAAGGAGAGAAACTCGGGG + Intergenic
1168951351 20:1803964-1803986 AGTGCAGGTAGAGAAACTGAGGG - Intergenic
1172607760 20:36226023-36226045 AGGCAAGGGAGAGAAACTTCTGG - Intronic
1174295225 20:49540772-49540794 AGTCCTGGGAGGGAAACTGCAGG + Intronic
1174406949 20:50308955-50308977 AGTCCGGGGAGAGAAACTCCCGG + Intergenic
1176038626 20:63052553-63052575 GGGACAGGGAGAGAAACTGCAGG + Intergenic
1180993972 22:19955387-19955409 AATCCAGGGAGAGCCAGTACAGG - Intronic
1181679813 22:24486231-24486253 AGTCAATGGATAGAAACTAAGGG - Intergenic
1181723006 22:24790483-24790505 AGCCCAGAGAGAGAAGCTGCAGG + Intergenic
1181783338 22:25208405-25208427 ATTCCAGGCAGAGAAATAACAGG + Intergenic
1182281655 22:29220876-29220898 GGCCCAGGGCTAGAAACTACAGG + Intronic
1182911732 22:33990099-33990121 AGTCAAGGGAGAGAAAAAGCTGG - Intergenic
1184250072 22:43254985-43255007 ACTCCTGGGAGGGAAGCTACCGG - Intronic
1185297868 22:50063035-50063057 AGACCAGGGAAGGAAACTTCAGG + Intronic
949644081 3:6073027-6073049 AGGTCAGAGAGAGAAAATACCGG - Intergenic
952751031 3:36825174-36825196 AGTCAAGGGAGTGAATCTTCAGG - Intergenic
954422056 3:50423985-50424007 AGTCCAGGGAGGGATGCTTCTGG - Intronic
956505000 3:69928777-69928799 AGTCCATGGACACAAACCACAGG - Intronic
956547210 3:70418024-70418046 GGTCCTGGGACAGAAACTTCAGG - Intergenic
959742306 3:109734954-109734976 AGTCCCTGGAGGGCAACTACCGG + Intergenic
961325293 3:126105921-126105943 AGTCCCTGGAGAGAAAGTCCAGG + Exonic
961555843 3:127696222-127696244 AGGCCAGGGAGAGCAAGGACAGG - Intronic
964195995 3:154065619-154065641 AGACCAATGATAGAAACTACAGG + Intergenic
964417066 3:156458637-156458659 AATCCAAGGAGAGAAAGTAAAGG + Intronic
964422365 3:156517097-156517119 TGTCAAGGGAGAGAGAATACAGG + Intronic
964424497 3:156536856-156536878 AATCCAGGGAGGGACACTAGAGG - Exonic
964559626 3:157979742-157979764 AGTTCAGGGAGACAAAGTAGTGG + Intergenic
965987369 3:174771735-174771757 GGTACAGGGGAAGAAACTACTGG + Intronic
966681363 3:182644973-182644995 CTTCCAGGGAGAGAAATGACTGG - Intergenic
967724871 3:192852143-192852165 AGTTCAGGGAGAGAAAATATGGG + Intronic
967844753 3:194034800-194034822 AGTCCAGGGGGAGTGACTTCTGG + Intergenic
969135761 4:5027451-5027473 TGTCCTAGGAGAAAAACTACAGG + Intergenic
970837415 4:20426946-20426968 AGTCCAGGTAGAGGCACTCCAGG + Intronic
972378070 4:38492001-38492023 GGTCCAGAGAGGTAAACTACTGG + Intergenic
975618353 4:76270306-76270328 AGTCCAGTGAGAGTAATTCCTGG - Intronic
981496924 4:145404154-145404176 CTTCCAGGCAGAGAAACTAGGGG + Intergenic
981982894 4:150816813-150816835 AGTGCAGGGAAAGAAAATAAAGG + Intronic
985969703 5:3365485-3365507 AGTGCAGGGAGAGAACTTAAAGG - Intergenic
986165376 5:5267991-5268013 AGGCCAGGAAGAGACACTTCAGG + Intronic
986321773 5:6637307-6637329 AGCCCAGGGAGACAAAATAGAGG - Intronic
986368072 5:7054933-7054955 AGTCCTGGAAGAGAAAGGACTGG - Intergenic
986416025 5:7529153-7529175 AGTCCAGGGAGAGACAGAGCTGG + Intronic
986703231 5:10432166-10432188 AGTCAAGGTAGAGAAGGTACTGG + Intronic
986968351 5:13302504-13302526 AGTGGATGGAGAGAAACAACTGG + Intergenic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
989193711 5:38695421-38695443 ATTAAAGGGAGAGAAAGTACGGG + Intergenic
991080090 5:62589230-62589252 TGTCCAGGGAGGGAAACAATAGG - Intronic
991193697 5:63906397-63906419 AGGCCAGGGAGAGTAACCATAGG - Intergenic
993001970 5:82389530-82389552 AGTCCAGGGGGAGAAAACCCAGG - Intergenic
994275441 5:97831486-97831508 AGTACAGGGAGACAAAATAATGG + Intergenic
995101426 5:108311597-108311619 AGTCCAAGGAGAGATACCAGTGG - Intronic
995356864 5:111248026-111248048 AGTCCAGTGAGATAATCTGCAGG - Intronic
995537302 5:113150078-113150100 CTTCCAGGAAGAGAAACTGCTGG + Intronic
995780207 5:115767368-115767390 AGTCCATGGAGAGGGACTTCAGG + Intergenic
996324121 5:122252884-122252906 AGTCCCTGGAGAGAATCTCCTGG + Intergenic
996334570 5:122368787-122368809 AGTGAATGGAGAGAAACTTCAGG - Intronic
996850642 5:127947973-127947995 AGTCCAGGGAAAGAAAGAAAAGG - Intergenic
1000937542 5:167321336-167321358 AGGCCAGAGAGAGAAGCTTCAGG - Intronic
1001680154 5:173550807-173550829 TGTCCAGGTAGGGAAACTCCTGG - Intergenic
1004411874 6:15388782-15388804 AGGTCAGGGAGAGAAGCTACGGG - Intronic
1005000930 6:21240926-21240948 AGTCAAGGGAGAGCCACTACAGG + Intergenic
1005839000 6:29728211-29728233 ACTCAAGGGAGAGAAAGTCCTGG - Intronic
1006080882 6:31565733-31565755 ATTCCAGGGGTAGAAACAACAGG - Intergenic
1007299314 6:40854722-40854744 AATCCAGTGAGAGAAGCTCCTGG - Intergenic
1007993947 6:46286657-46286679 AGTCCACAGAGAGAAACTGTTGG - Intronic
1010336475 6:74690304-74690326 AGTCAATAGAGAGAAAATACTGG - Intergenic
1013752302 6:113421510-113421532 AAACCAGGGGGAAAAACTACAGG + Intergenic
1014016848 6:116541043-116541065 ATTCCAGGGAAACAAACTATGGG + Intronic
1014643330 6:123941893-123941915 AGTCCAAGGATAGAATCTGCAGG - Intronic
1015392645 6:132700462-132700484 ACTCCTGGGACAGAAACTGCTGG + Intronic
1017798454 6:157869522-157869544 ACTCTAGGGAGAGAAACCAATGG - Intronic
1018230189 6:161667774-161667796 AATCCAGGCAGTGAAATTACAGG + Intronic
1020505745 7:8985559-8985581 TGATCAGGGAGAGAAACAACAGG + Intergenic
1020507689 7:9014261-9014283 AGTTCTGGGAGAGAAAACACTGG - Intergenic
1020518360 7:9154517-9154539 ATTCCAGGGACAGAGAATACAGG - Intergenic
1020646176 7:10816967-10816989 AGTCCAGGTAGAGATAGTTCAGG - Intergenic
1022972178 7:35528414-35528436 AGTCCAGGTAGAGAAGCTTAGGG + Intergenic
1027814504 7:82951855-82951877 ACTTCAGGGAGAGTTACTACAGG - Exonic
1028917819 7:96279099-96279121 AGTCAAAGGAGAGGAACTTCTGG + Intronic
1032657828 7:133951162-133951184 GGTCAAGGGAGAGAAAGTCCAGG - Intronic
1033710251 7:143935529-143935551 AGGCCAGGGAGAAAAATAACTGG - Exonic
1033712275 7:143960267-143960289 AGGCCAGGGAGAAAAATAACTGG - Exonic
1034093128 7:148382247-148382269 GGAACAGGGAGAGAAACCACGGG - Intronic
1036654341 8:10667100-10667122 AGTCCAGGCATAGTAACTGCTGG + Intronic
1036769813 8:11571283-11571305 ATTCCAGGAAGAGAAACATCTGG + Intergenic
1042467549 8:69145103-69145125 AGTCCAAGGAGAGAAAGAAGGGG + Intergenic
1043188133 8:77181316-77181338 AGTGCAGGCAGAGAAACTTTAGG + Intergenic
1043360006 8:79461133-79461155 AGTCCAGAGAGAGGAAATGCAGG + Intergenic
1043740160 8:83801329-83801351 AGCCCATGGGGAGAAACTTCAGG + Intergenic
1050920118 9:11189562-11189584 AGTGCAGGGAGGGCAACTAGAGG + Intergenic
1053434541 9:38066705-38066727 AGGCCAGGCAGAAAAACTAGAGG + Intronic
1054747691 9:68871375-68871397 AGTCCAGGGAGGGAAAACAATGG - Intronic
1056499664 9:87196421-87196443 AGTCCATTGAGAGCTACTACCGG + Intergenic
1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG + Intergenic
1059072977 9:111159146-111159168 ATTCCTGGGAAAGAAATTACTGG - Intergenic
1059281137 9:113135203-113135225 ATTCCAGGAAGGAAAACTACTGG - Intergenic
1060566755 9:124599474-124599496 TGCTCAGGAAGAGAAACTACTGG + Intronic
1060835301 9:126751219-126751241 AATCCAGGGAAAGAAATCACTGG + Intergenic
1186548107 X:10472564-10472586 TGTCCAGGGACAGAAAAGACTGG - Intronic
1189380605 X:40499956-40499978 AATCCAGAGAGAGTAATTACAGG - Intergenic
1193035748 X:76949507-76949529 AGTGGAGGTAGAGAAACTAAAGG - Intergenic
1193322323 X:80137359-80137381 AGGTCAGTGAGAGAAACAACTGG + Intergenic
1195402659 X:104478205-104478227 AGGCCAGGGAGAGATCCTTCAGG - Intergenic
1195880522 X:109588169-109588191 AGTCCAAGGAGTAAAATTACTGG - Intergenic
1196203086 X:112908449-112908471 AGTCTAGTGATAGAAACTGCAGG + Intergenic
1198662133 X:138981225-138981247 ACTCTAGGTAGAGAAACAACAGG + Intronic
1200142474 X:153908958-153908980 AGGCCAGGGAGGGCAACGACTGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200748708 Y:6925216-6925238 AGAACAGGGAGAGAAACTTGTGG + Intronic
1201018465 Y:9626976-9626998 TGTCCAGGGAGGGAAACTGGTGG + Intergenic