ID: 1096392556

View in Genome Browser
Species Human (GRCh38)
Location 12:51240283-51240305
Sequence CAGAGCTACCAAAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096392556_1096392560 15 Left 1096392556 12:51240283-51240305 CCTGCCTCATTTTGGTAGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 266
Right 1096392560 12:51240321-51240343 TCATTTTTTTCTTGTCTTTCAGG 0: 1
1: 1
2: 18
3: 194
4: 1984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096392556 Original CRISPR CAGAGCTACCAAAATGAGGC AGG (reversed) Intronic
900579213 1:3400209-3400231 CAGAACTGGCAAACTGAGGCTGG - Intronic
901630623 1:10646511-10646533 CAGAGCTCCTAAAAGGAGGCAGG - Intronic
902858565 1:19227569-19227591 CAGAACTAGAAAAATGAGCCAGG + Intronic
907178039 1:52543990-52544012 CAAAGCTACAATAATCAGGCTGG + Intronic
908810323 1:67975559-67975581 AAGAGCTACCAACAAAAGGCTGG - Intergenic
909158625 1:72115318-72115340 CAGATCTAAGAAAATGTGGCTGG + Intronic
911444688 1:97976986-97977008 CAGGGCTGGCAAAATGTGGCAGG - Intergenic
912576864 1:110679939-110679961 GAGAGTTACCAAACGGAGGCGGG - Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
914324786 1:146601941-146601963 CTGAGCCACCAACATGATGCAGG - Intergenic
915273156 1:154769475-154769497 CATAGCTTCCAAGCTGAGGCTGG - Intronic
916418971 1:164618613-164618635 CAGAGCTGCCAAAATCAGTAGGG + Intronic
917134971 1:171781107-171781129 CAGAGGTGGCAAAATAAGGCGGG + Intergenic
918579182 1:186105287-186105309 CAGAGTAACCAAAATCAGTCTGG - Intronic
918840918 1:189538463-189538485 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
921283853 1:213591594-213591616 CAGATCTACCATCATCAGGCTGG - Intergenic
923810281 1:237307975-237307997 GAGGGCTAGGAAAATGAGGCCGG + Intronic
923810289 1:237308023-237308045 GAGGGCTAGGAAAATGAGGCCGG + Intronic
1063354263 10:5383114-5383136 GAGCGCTAGGAAAATGAGGCTGG - Intergenic
1063542917 10:6952740-6952762 CAAAACTACCAAAATTAGCCGGG + Intergenic
1063851454 10:10196928-10196950 GACAGCTACCAACAGGAGGCTGG - Intergenic
1064199102 10:13269809-13269831 AAGTGCTCCCAAAGTGAGGCGGG - Intergenic
1064569923 10:16682248-16682270 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1065461300 10:25967900-25967922 CATAGTTATCAAAATAAGGCTGG + Intronic
1067436326 10:46281673-46281695 GAGGGCTAGGAAAATGAGGCGGG + Intergenic
1067935210 10:50605328-50605350 CAGAGCTGCCACAGTGAGACAGG + Intronic
1068334570 10:55615994-55616016 CAGAGGTACCAAGATTAAGCTGG + Intronic
1072992698 10:100212706-100212728 CAGAAATACTAAACTGAGGCTGG + Intronic
1074476672 10:113780721-113780743 CAGAGCTCCCAAGAGGAGTCCGG + Intronic
1075240456 10:120773856-120773878 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1077225791 11:1438620-1438642 CAGAGCCACCAGCCTGAGGCTGG + Intronic
1078191922 11:9098027-9098049 TAGAGCTCCCAAGATGGGGCGGG - Intronic
1078251398 11:9619697-9619719 CGGAGCTACCAATATGTTGCAGG + Intergenic
1080409155 11:32007000-32007022 CAGAGATAGCAAAATCAGCCAGG + Intronic
1080881422 11:36324999-36325021 CAGAGCTCCCAAGATGATGGTGG + Intronic
1083287340 11:61668600-61668622 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1085082922 11:73648748-73648770 CAAAGTTACCAAGCTGAGGCTGG + Intronic
1085145900 11:74196991-74197013 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1088849800 11:113695452-113695474 CAGAGGTACCAACAAGAAGCTGG + Intronic
1090328823 11:125913222-125913244 CAGATCTACCAGACTGAAGCTGG - Intronic
1090638390 11:128708177-128708199 CAGAGCTACCAAAAAGGGAGAGG + Intronic
1091450348 12:568950-568972 GACAGCCACCAAAATCAGGCTGG + Intronic
1092786365 12:12030569-12030591 CAGAACTACAAAAATTAGCCAGG + Intergenic
1093307286 12:17536951-17536973 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1095739515 12:45591879-45591901 CAGAGCTACCTTTATGATGCAGG + Intergenic
1096392556 12:51240283-51240305 CAGAGCTACCAAAATGAGGCAGG - Intronic
1096398973 12:51289452-51289474 CAAAAATACAAAAATGAGGCAGG + Intronic
1096562103 12:52443100-52443122 CAGAGTTCCTAAGATGAGGCAGG + Intergenic
1100863940 12:98835692-98835714 TAGAGCTACCCAGATGAGGGTGG + Intronic
1101352714 12:103947151-103947173 CCAAGCTAACAAAAGGAGGCAGG - Intronic
1103964457 12:124629806-124629828 CAGAGCCACCATGCTGAGGCAGG - Intergenic
1104161862 12:126189027-126189049 GAGGGCTAAGAAAATGAGGCTGG + Intergenic
1105458595 13:20563801-20563823 AAGAGCAACCAAGTTGAGGCCGG + Intergenic
1106458468 13:29948023-29948045 GAGAGATTCTAAAATGAGGCTGG - Intergenic
1106600417 13:31182563-31182585 CAAAGCTTCCACAATGAGGAAGG + Intergenic
1107121502 13:36801361-36801383 CTGAGCTGGCAGAATGAGGCTGG + Intergenic
1107706128 13:43107843-43107865 GAGAGCTACTAAAATGATTCAGG + Exonic
1108560426 13:51638001-51638023 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1108947023 13:56039970-56039992 TAGAGCTCCCAAGATGGGGCAGG + Intergenic
1109884499 13:68524716-68524738 CAGAGCTTCCACAATGTGGAAGG - Intergenic
1110652006 13:77952507-77952529 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1112373881 13:98820863-98820885 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1112751740 13:102590229-102590251 CAGAACTACAAAAATTAGCCAGG - Intergenic
1113735577 13:112676781-112676803 GAAAGCTAAGAAAATGAGGCCGG + Intronic
1114181015 14:20367903-20367925 CAGAACTACCCAGAGGAGGCCGG - Exonic
1116373651 14:44169413-44169435 TAGAAATACTAAAATGAGGCTGG - Intergenic
1116857463 14:49965571-49965593 CAGAGATACAAAAATTAGCCTGG + Intergenic
1118294184 14:64553939-64553961 CAGCTCTACCAAAAACAGGCTGG - Intronic
1118486634 14:66220492-66220514 CAGAAATACAAAAATGAGGCTGG - Intergenic
1119172445 14:72545411-72545433 CATAGCTAGCAAGCTGAGGCTGG - Intronic
1124416497 15:29476743-29476765 CAGAGGTACCAAAGTGAGGGCGG + Intronic
1124505096 15:30265460-30265482 CAGAGCTACCAGGCTCAGGCTGG - Intergenic
1124738456 15:32273175-32273197 CAGAGCTACCAGGCTCAGGCTGG + Intergenic
1125106551 15:35978559-35978581 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1125433501 15:39622353-39622375 AAGAGCTACTAAAATGAAGGTGG - Intronic
1126354434 15:47780241-47780263 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1127878123 15:63129748-63129770 AAAAGCTCCCAAAATGTGGCAGG - Intronic
1128350051 15:66882379-66882401 CAGCGCTTCCAAAGGGAGGCCGG + Intergenic
1128379731 15:67103737-67103759 CAGAGCTGCAACAATGAGGAGGG + Intronic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1132436488 15:101808660-101808682 GAGAGTTTCCAAAATGAGGAAGG - Intronic
1133943339 16:10328519-10328541 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1134256135 16:12613191-12613213 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1134306853 16:13040890-13040912 GAGAGCCACCAAAGTCAGGCTGG - Intronic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1135992443 16:27226417-27226439 CAAAACTACCAAGATGATGCAGG + Intronic
1136084898 16:27877768-27877790 CAGCACTCTCAAAATGAGGCTGG - Intronic
1136639333 16:31549407-31549429 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1140008777 16:71109005-71109027 CTGAGCCACCAACATGATGCAGG + Intronic
1140252345 16:73305152-73305174 ATGAGCTGCCAACATGAGGCGGG + Intergenic
1140744507 16:77969299-77969321 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1141298516 16:82791934-82791956 TAGAGCTCCCAAGATGGGGCGGG - Intronic
1143384795 17:6522622-6522644 CAGAGCGTCCAGCATGAGGCAGG + Intronic
1143803206 17:9402537-9402559 CAGTGCAACAAAAATGAGGTAGG + Intronic
1144662919 17:17082940-17082962 CAGACCTACCACAATCAGGAGGG - Intronic
1146359017 17:32159301-32159323 CAGAGCCACCATGATGGGGCCGG + Intronic
1146694555 17:34898637-34898659 CATAGCTTGCAAAGTGAGGCGGG - Intergenic
1147838475 17:43352727-43352749 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1147839414 17:43360392-43360414 GAGGGCTAGAAAAATGAGGCCGG - Intergenic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1151017909 17:70577924-70577946 TAGAGCTCCCAAGATGGGGCAGG - Intergenic
1152603013 17:81274580-81274602 CAGAGCTCCCAAGGGGAGGCAGG + Intronic
1152945692 17:83196302-83196324 CAGAGCCACCAAAGGCAGGCAGG - Intergenic
1156662190 18:39359088-39359110 TAGAGCTCCCAATATGGGGCAGG + Intergenic
1156930213 18:42632736-42632758 AAGGGCTAGAAAAATGAGGCTGG - Intergenic
1157359049 18:46962159-46962181 AAAAGATACCAAAATGAGCCCGG - Intronic
1157360043 18:46968086-46968108 AAAAGATACCAAAATGAGCCCGG - Intronic
1157360642 18:47021678-47021700 AAAAGATACCAAAATGAGCCCGG - Intronic
1157361631 18:47027593-47027615 AAAAGATACCAAAATGAGCCCGG - Intronic
1160301365 18:77683089-77683111 CACAGCTGCCAAAAGGAAGCGGG - Intergenic
1161645930 19:5453474-5453496 CAGTGCTACCAAGCAGAGGCAGG - Intergenic
1162387388 19:10368062-10368084 AAGAGGTACTCAAATGAGGCTGG + Exonic
1162930096 19:13953259-13953281 CAGAGCTCCCAAACTGATGGGGG - Intronic
1163030670 19:14542075-14542097 CATTGCCATCAAAATGAGGCAGG - Intronic
1165451944 19:35888883-35888905 CAGAGATACAAAAATTAGCCGGG + Intronic
1166791069 19:45398742-45398764 CAGAACTACAAAAATTAGCCGGG - Intronic
1167106957 19:47436024-47436046 AAGAGGTACCAGGATGAGGCTGG - Intronic
1168675908 19:58277983-58278005 GAGGGCTAGGAAAATGAGGCTGG + Intronic
926686023 2:15698279-15698301 CAGAGCTAGCACAGTGATGCTGG - Intronic
927473625 2:23395582-23395604 CAAAGCTACAAAAATTAGCCAGG + Intronic
927820269 2:26258242-26258264 TAGAGCTCCCAAGATGGGGCAGG + Intronic
928045170 2:27924032-27924054 GAGAGTAACCAAAATGTGGCCGG - Intronic
928978126 2:37110229-37110251 CAAAACTACAAAAATGAGCCAGG - Intronic
929154424 2:38776718-38776740 GAGGGCTAGGAAAATGAGGCTGG + Intronic
929491271 2:42398738-42398760 CTGAGTTCCCAAAATGAGCCCGG - Intronic
932547187 2:72725550-72725572 TAAAGATACAAAAATGAGGCGGG - Intronic
933078101 2:77954627-77954649 CAAAAATACCAAAATTAGGCAGG + Intergenic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933792042 2:85890596-85890618 GAGGGCTAGAAAAATGAGGCTGG - Intergenic
938686049 2:133738939-133738961 CAGAGTTACTAAAAAGAGGTTGG - Intergenic
939492919 2:142898702-142898724 TAGAGCTCCCAAGATGGGGCGGG + Intronic
939604132 2:144232075-144232097 CAGAGCTACTAAAATGAATCTGG - Intronic
940976302 2:159949068-159949090 CAGAGCTACAATAATGATGGTGG - Intronic
941444546 2:165584294-165584316 GAGGGCTAGAAAAATGAGGCTGG - Intronic
941760569 2:169237985-169238007 GAGAGCTACCCAGATGAGGTAGG + Intronic
944884681 2:204050176-204050198 CAGATCTGCCAAATTGAGCCAGG - Intergenic
945850163 2:214996123-214996145 CAGAGCTACCAAACAGAAACTGG + Intronic
946751849 2:222899978-222900000 GAGGGCTAGGAAAATGAGGCTGG - Intronic
947183748 2:227435929-227435951 TAAAGATACAAAAATGAGGCAGG + Intergenic
948997705 2:241592146-241592168 CAGAGCCACCCACATAAGGCAGG + Intronic
1170723794 20:18907731-18907753 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1171028092 20:21651274-21651296 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1172556826 20:35849437-35849459 TAGAGCTACCAGGAGGAGGCAGG + Intronic
1173076808 20:39827166-39827188 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1173143785 20:40507457-40507479 CATAGCTAGCAAAAAGAAGCAGG - Intergenic
1173176067 20:40765831-40765853 CAGAGCTCCCGACTTGAGGCTGG + Intergenic
1173253883 20:41379377-41379399 CAGAGCTTCCAAAATAAGAAGGG - Intergenic
1175847900 20:62068160-62068182 CAGAGATACTAAAATTTGGCGGG - Intergenic
1178808886 21:35862673-35862695 CAGTGCTACCAAAATGAATATGG + Intronic
1179272303 21:39860954-39860976 CAGAGCTTCCAAAATGGGCCTGG + Intergenic
1180945860 22:19692970-19692992 CAGAAATACAAAAATTAGGCCGG - Intergenic
1183017346 22:34999954-34999976 CAGAGCTCCCAAGAGGAGACAGG + Intergenic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
949487006 3:4549573-4549595 CAGAGATACCAAAATGTTCCAGG - Intronic
951954961 3:28243350-28243372 CAGAAGTACCATAATTAGGCTGG - Intronic
952506001 3:34007361-34007383 GCCAACTACCAAAATGAGGCTGG - Intergenic
952711731 3:36438680-36438702 CAGAGCAAGAAAAATGTGGCAGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955207686 3:56911299-56911321 CAAAGCTGCCAAGCTGAGGCAGG + Intronic
959675353 3:109028937-109028959 CTGAGCTACCAAAAAGAGGAGGG + Intronic
962103837 3:132370465-132370487 GAGGGCTAGCAAAATGAAGCTGG - Intergenic
962416480 3:135187201-135187223 CAGTGGGACCAAAATTAGGCTGG + Intronic
963255737 3:143142823-143142845 TAGAGCTCCCAAGATGGGGCGGG - Intergenic
964273364 3:154982646-154982668 AAGAGCTAACAAAATGCGGGTGG - Intergenic
966059740 3:175740424-175740446 GAGGGCTAGGAAAATGAGGCTGG + Intronic
966508781 3:180736951-180736973 CTGAGATTCCAGAATGAGGCAGG + Intronic
967859902 3:194142523-194142545 CAGAGTTACAAAATTGAGGCAGG - Intergenic
968078048 3:195827297-195827319 CAGAAATACAAAAATTAGGCTGG - Intergenic
968391570 4:197029-197051 TAGAGCTCCCAAGATGTGGCGGG - Intergenic
968761433 4:2444366-2444388 CAGTGCTCCCAACTTGAGGCAGG - Intronic
969052629 4:4384256-4384278 CACAGCCACCAAAATGGGGATGG - Intronic
969162610 4:5274691-5274713 CAGAGCTCCCAAAAAAAGGGAGG - Intronic
970793154 4:19882950-19882972 AAGATTTAACAAAATGAGGCTGG + Intergenic
971034863 4:22682167-22682189 CTGAGCTATAAAAATGAGGGAGG - Intergenic
972501172 4:39679393-39679415 TAGAACTAAAAAAATGAGGCCGG - Intergenic
973291530 4:48476014-48476036 CACAGCTTCAAAAATGCGGCAGG + Intergenic
974894851 4:67926731-67926753 GGGAGCTACCACAATGGGGCTGG + Intronic
975418755 4:74138318-74138340 TAGAGCTCCCAAGATGTGGCAGG + Intronic
976777663 4:88723532-88723554 CAGAGTTACCAAAATTATTCAGG + Intergenic
976931510 4:90571581-90571603 CAGAGACTCCAAAATGAGGGAGG + Intronic
978307814 4:107351399-107351421 GAGAGCTAGGACAATGAGGCTGG - Intergenic
979405449 4:120305121-120305143 CTGAGCTCCCAGAATGAGCCAGG - Intergenic
979573545 4:122258744-122258766 CAGAGCTACCAGGTGGAGGCCGG - Exonic
980057408 4:128091755-128091777 CAGAACTACAAAAATTAGCCAGG - Intronic
980778731 4:137469036-137469058 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
981541604 4:145852240-145852262 CAAAGCTAGGGAAATGAGGCAGG - Intronic
981823814 4:148915969-148915991 CAGAGCTCCCAAGATGTGGCAGG - Intergenic
982962844 4:161862350-161862372 CATCACTACCAAAATTAGGCAGG + Intronic
984097664 4:175451773-175451795 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
986615238 5:9610151-9610173 CAGAGGTAACAGAATGAAGCTGG + Intergenic
988740482 5:34064318-34064340 TAGAGCTCCCAAGATGTGGCGGG + Intronic
988957338 5:36332619-36332641 CAGAGCTCCCAAGATGATGGCGG + Intergenic
989742121 5:44785607-44785629 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
989743075 5:44794562-44794584 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
990153964 5:52853159-52853181 CAGAGCAACCAAAAAGATGTGGG + Intronic
990346921 5:54880541-54880563 AAGAGCTACCAATGTTAGGCTGG - Intergenic
991440963 5:66648774-66648796 CAGTGCTGCCAAAATGAAGTCGG + Intronic
991578669 5:68131514-68131536 CAGAGATACCTGAATGAGGTAGG - Intergenic
993043130 5:82837839-82837861 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
994273515 5:97809131-97809153 GTGAGCCCCCAAAATGAGGCAGG + Intergenic
997099482 5:130953223-130953245 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
999774272 5:154799738-154799760 CAGCACTACCAAAAGGAGACAGG + Exonic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1004432496 6:15557684-15557706 CTAAGCTACAAAAAAGAGGCAGG + Intronic
1006866921 6:37216237-37216259 TAAAACTACCAAAATTAGGCGGG - Intronic
1007171622 6:39868117-39868139 CAGAGCCACAAAAATAATGCAGG - Intronic
1007715369 6:43852510-43852532 CAGACTGACCTAAATGAGGCTGG - Intergenic
1009685514 6:66950344-66950366 CAAAGCTACCACAGTGTGGCAGG - Intergenic
1010793153 6:80088688-80088710 CAGAGCTATCAACATGACGGTGG - Intergenic
1011836104 6:91433223-91433245 CGCAGCTACCAACATGAGGTAGG + Intergenic
1011937315 6:92796963-92796985 CAAAGATACAAAAATGAGCCAGG + Intergenic
1012853876 6:104478282-104478304 CACAGCTACCAAAATCTGCCTGG + Intergenic
1013072839 6:106744432-106744454 AAGAGCAACCAAAGTTAGGCAGG + Intergenic
1016290861 6:142526908-142526930 CAGAGGTACCAAAAAGAGACAGG - Intergenic
1017129922 6:151099410-151099432 CAGAGCCACTACAGTGAGGCTGG + Intronic
1019076824 6:169394596-169394618 GAGAGCCTCCAAAATGATGCAGG + Intergenic
1019765501 7:2846811-2846833 TAGAAATACCAAAATGAGCCAGG + Intergenic
1024534308 7:50417385-50417407 CACAGCCACCTGAATGAGGCAGG + Intergenic
1024641410 7:51331842-51331864 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1024674030 7:51622156-51622178 GAGGGCTAAGAAAATGAGGCTGG - Intergenic
1025956938 7:66190197-66190219 CTGGGCTACCACAATGGGGCTGG - Intergenic
1026123804 7:67561805-67561827 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1026126162 7:67581647-67581669 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1026969436 7:74458976-74458998 GAGAGCTACCAAAATAGGGTGGG - Intronic
1030560598 7:111079853-111079875 CTGAGCTCCCATAATGAGACTGG + Intronic
1033127332 7:138717609-138717631 CAGAGATAACAAAACAAGGCCGG + Intronic
1034248826 7:149672033-149672055 TAGAGCTCCCAAGATGGGGCAGG - Intergenic
1034707015 7:153154871-153154893 TAGAGCTCCCAAGATGGGGCAGG + Intergenic
1036066877 8:5390473-5390495 GAGAGATAGAAAAATGAGGCAGG + Intergenic
1037379902 8:18274323-18274345 TAGAGCTCCCAAGATGGGGCAGG + Intergenic
1037570657 8:20155173-20155195 TAGAGCTCCCAAGATGGGGCGGG - Intronic
1039241009 8:35556869-35556891 GAGGGCTAGGAAAATGAGGCTGG - Intronic
1039482165 8:37882242-37882264 GAGGGCTAGGAAAATGAGGCTGG + Intronic
1040033181 8:42844217-42844239 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1042208307 8:66351262-66351284 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1044556290 8:93565822-93565844 CAGAGGTGGCACAATGAGGCTGG - Intergenic
1045593005 8:103619608-103619630 CAGAACTACAAAAAGGAGGCAGG + Intronic
1045637308 8:104207264-104207286 CAGAGCTAGCAAATAGAGACTGG + Intronic
1046112508 8:109742598-109742620 CACAGCTTCAAAAATGAAGCTGG + Intergenic
1049389447 8:142360484-142360506 CAGGGCTGCCTCAATGAGGCCGG + Intronic
1049803385 8:144528396-144528418 CAGGGCTTCCAAAAAAAGGCAGG + Intronic
1050614829 9:7391075-7391097 TAGAGCTAGTAAACTGAGGCTGG - Intergenic
1051054562 9:12968923-12968945 CAGAACTAACAAAATGATACAGG + Intergenic
1051386647 9:16516250-16516272 CAGTCCTACCAAGATGGGGCTGG + Intronic
1052013777 9:23442088-23442110 CAGAGCTTCCAGAATGAGCTCGG + Intergenic
1052034515 9:23665170-23665192 AAGTGATACCAAAATGAGACTGG - Intergenic
1052299405 9:26936745-26936767 CAGAGCAACAACAAAGAGGCAGG + Intronic
1053223594 9:36332211-36332233 CTCATCTACCAAAATAAGGCCGG - Intergenic
1054777227 9:69133845-69133867 AAGAGCCAGAAAAATGAGGCTGG - Intronic
1055504427 9:76933196-76933218 GAGGGCTACGAAAAAGAGGCTGG + Intergenic
1055669884 9:78594069-78594091 CAGAGGGACAAAAATGAAGCTGG - Intergenic
1057220244 9:93253636-93253658 CAGAGCTATGAAAATAGGGCGGG + Intronic
1058037468 9:100268484-100268506 GAGGGCTACGAAAATGAGGCTGG - Intronic
1058318250 9:103595851-103595873 CAGAGCTCCAGAAATGAGGTAGG - Intergenic
1058854142 9:109043629-109043651 CTGAGCTACCAAAAGGAGGGAGG - Intronic
1059674277 9:116522949-116522971 CATACCTTCCAAAATAAGGCTGG + Intronic
1059953965 9:119496706-119496728 CTGACCTACCACCATGAGGCTGG - Intronic
1060568888 9:124619422-124619444 CAGAGATACAAAAATTAGTCAGG - Intronic
1062046644 9:134427505-134427527 CTGTGCAACCAAAATGAGGGAGG - Intronic
1186011733 X:5142209-5142231 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1186161652 X:6783009-6783031 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1186205710 X:7197794-7197816 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1187220949 X:17325266-17325288 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1187890726 X:23932696-23932718 AAGAGCTAGCAACAGGAGGCCGG + Intronic
1187961102 X:24567337-24567359 GAGAGCTGGCAAATTGAGGCTGG - Intronic
1188935425 X:36170066-36170088 CAGAGCTGTCAAAAGGAGGATGG + Intergenic
1189992042 X:46604591-46604613 CAGAAATACAAAAATGAGCCAGG - Intronic
1190828877 X:54043204-54043226 CACAGCGTCAAAAATGAGGCTGG + Intronic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1193120547 X:77818764-77818786 GAGGGCTAGGAAAATGAGGCTGG - Intergenic
1193494088 X:82188480-82188502 CACAACTACCAGACTGAGGCAGG - Intergenic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1193967961 X:88012240-88012262 ATGGGCTACCAAAATGAGTCTGG + Intergenic
1195052024 X:101105734-101105756 CTGAGATATCAAAAGGAGGCTGG - Intronic
1196420953 X:115520621-115520643 CAGAACTACAAAAAAGAGCCCGG + Intergenic
1196492836 X:116289120-116289142 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1196975162 X:121151184-121151206 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1197590099 X:128397998-128398020 GAGAGGTACAAAAATGAGGCTGG - Intergenic
1199393603 X:147308997-147309019 GAGGGCTAGGAAAATGAGGCTGG + Intergenic
1200242771 X:154506561-154506583 CAGTGTTACGAAAAGGAGGCGGG + Exonic
1200960122 Y:8988805-8988827 CAGAGCTTCCACAATGTGGAAGG - Intergenic