ID: 1096394166

View in Genome Browser
Species Human (GRCh38)
Location 12:51253005-51253027
Sequence CTGAGAAAGAGAAAGGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1010
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 935}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096394166 Original CRISPR CTGAGAAAGAGAAAGGGGTC GGG Intronic
900719443 1:4165807-4165829 CTGAGAAGCAGGAAGGGGGCTGG - Intergenic
901141146 1:7032259-7032281 CAGAAAAAGAGAAAAGGGGCCGG - Intronic
901407730 1:9060940-9060962 CAGACAAAGAGAGAGGGGTGGGG + Intronic
902987926 1:20166720-20166742 ATGAGAAAGGGAGAGGGGGCAGG - Intronic
903024392 1:20417137-20417159 CTGAGAGAGGTAAAGGGCTCCGG - Intergenic
903143208 1:21352420-21352442 TTGAAAAAGAGTGAGGGGTCAGG + Intergenic
903283795 1:22264839-22264861 CTGAAAAAGAGAGTGGGGTGGGG + Intergenic
903293809 1:22331187-22331209 TTAAGAAAAAGAAAGGGGCCTGG + Intergenic
903326599 1:22572459-22572481 CTGATGAAGAGCAGGGGGTCTGG - Intronic
903978883 1:27170904-27170926 CTGAGAGAGGGAAAGGAGTGAGG - Intergenic
904064515 1:27738702-27738724 GTGTGAAAGAGAAAAGGGTGAGG + Intronic
904352656 1:29918969-29918991 CAGAGATGGAGAAAGGGGTGTGG - Intergenic
904786125 1:32984372-32984394 GCAAGAAAGAGAAATGGGTCGGG + Intergenic
905370343 1:37479679-37479701 CTGAGAAAGGCAAAGGGGAAGGG - Intronic
905481598 1:38265668-38265690 ATGAGAGAAAGAGAGGGGTCAGG - Intergenic
906512081 1:46415765-46415787 CTGAAAGAGAGAAATGGGGCAGG - Intergenic
906646172 1:47476873-47476895 CTGATAGAGAGAAAGGGCTCAGG - Intergenic
907177465 1:52538364-52538386 CTGAGAAAAAAAAAGGGAGCTGG + Intronic
907230730 1:52996079-52996101 CTGAGGTAGAGAAAAGGGGCAGG - Intronic
907780701 1:57563501-57563523 CCCAGGAAGTGAAAGGGGTCAGG + Intronic
907969743 1:59369120-59369142 CTCGGAAAGCGCAAGGGGTCAGG + Intronic
908447730 1:64216880-64216902 CTAAGAAAGGAAAAGGGGCCAGG - Intronic
908584220 1:65550751-65550773 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
908894349 1:68881556-68881578 CTGAGTCAAAGAAAGGGGTGAGG - Intergenic
908963976 1:69735777-69735799 GAGAGAAAGAGAAAGGGGCGAGG - Intronic
909379939 1:74986710-74986732 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
910157420 1:84234723-84234745 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
910684824 1:89905549-89905571 GTTAGAAAGATAAAGGAGTCAGG + Intronic
910910400 1:92227983-92228005 CTGAGAAAGAGAAAAGAGAATGG - Intronic
910927616 1:92412772-92412794 CAGAGAAAGGGAAAGGGATTTGG - Intergenic
910930286 1:92436695-92436717 CCCAGAAAGTGCAAGGGGTCGGG - Intergenic
911063413 1:93766628-93766650 CTAAGAAAGAGGAAGGCATCAGG - Intronic
911444692 1:97977005-97977027 CTGGCAAAGAAAAAAGGGTCAGG - Intergenic
911745104 1:101433162-101433184 GTGAGAAAGAGGGAGGAGTCAGG + Intergenic
911941792 1:104056940-104056962 CTGGGGAAGTGCAAGGGGTCGGG + Intergenic
912041105 1:105391832-105391854 CTGAGAAAGAGAAAGAGCTGGGG + Intergenic
912095989 1:106144621-106144643 GAGAGAAAGAGAAAGGGGGTGGG - Intergenic
912639948 1:111335407-111335429 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
912707505 1:111925891-111925913 CTGGGAAAGAGGATGGTGTCGGG - Intronic
913040728 1:115019973-115019995 CTCAGAAAGTGCAAGGGATCAGG - Intergenic
913061927 1:115216521-115216543 ATCAGTAAGAGAAAGGGGTTAGG - Intergenic
913567329 1:120085550-120085572 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
913630805 1:120707996-120708018 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
914288077 1:146246256-146246278 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914296323 1:146328919-146328941 CTGAGAAAAAGAAATGTGTGAGG - Intergenic
914511892 1:148340379-148340401 CTGAGAAGGAGATAGGGGATAGG - Intergenic
914549113 1:148697002-148697024 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914617569 1:149374717-149374739 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
915929636 1:160051867-160051889 GTGAGAAGGAGGAACGGGTCGGG - Intronic
916060491 1:161095177-161095199 GTGAGAAATAGAGAAGGGTCAGG + Intergenic
916349824 1:163836583-163836605 CTGGGCAAGAGAATGGGGTAGGG - Intergenic
916496493 1:165352783-165352805 CCGAGTCAGAGAAAGGGGCCTGG + Intronic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
916718776 1:167467131-167467153 CTGAAAAGGATAAAGGGGCCGGG - Intronic
917218499 1:172702656-172702678 TTGTGAGAGAGAAAGAGGTCAGG + Intergenic
917288275 1:173444184-173444206 CTGTGTTGGAGAAAGGGGTCGGG - Intergenic
917398098 1:174616012-174616034 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
917690683 1:177465175-177465197 CTTAGAAAGGCAAAGTGGTCAGG - Intergenic
917842549 1:178993406-178993428 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
918563129 1:185893119-185893141 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
918836680 1:189474519-189474541 CTGAGTCAAAGAAAGGGGTGAGG - Intergenic
919250537 1:195050879-195050901 GTGACAAGGAGAAAGGGCTCGGG + Intergenic
919274388 1:195393988-195394010 CTGAGAAAGCCAAAGGGGCTGGG - Intergenic
919561674 1:199127621-199127643 CAAAGAAAGATAAAGGGATCAGG + Intergenic
919603137 1:199647523-199647545 CCCAGGAAGAGCAAGGGGTCAGG + Intergenic
919700749 1:200628801-200628823 ATGAGAAATAGAGAGGGGTGGGG + Intronic
919783583 1:201240042-201240064 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
919796483 1:201324313-201324335 ATATGAAAGAGAAAGGGTTCTGG + Intronic
919969885 1:202568612-202568634 CTGGGAAAGAGAAATGGAACGGG + Intronic
920965131 1:210694978-210695000 CTGAGAATGAGAAAGGGAAGGGG + Intronic
921364019 1:214356991-214357013 CCTAGAAAGAGAAAGGAGTTGGG - Exonic
922918428 1:229278158-229278180 CTGAAAAGAAGAAAGGGGCCAGG - Intronic
923315081 1:232772760-232772782 CTGGGATGGAGAAAGGGCTCAGG - Intergenic
923421654 1:233822151-233822173 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
923983638 1:239354814-239354836 GGAAGAAAGATAAAGGGGTCAGG - Intergenic
924207820 1:241732184-241732206 TTTAGATAGAGCAAGGGGTCTGG - Intronic
924232817 1:241976622-241976644 AAGAAAAAGAGAAAGGGGTTTGG - Intergenic
924331892 1:242947905-242947927 CAGAGAAAGAGAGAAAGGTCAGG + Intergenic
924494096 1:244569197-244569219 CTGGGGAAGTGCAAGGGGTCAGG - Intronic
924743787 1:246813960-246813982 CTGAGTAAGAGAATCGGGGCTGG - Intergenic
924937347 1:248783541-248783563 CTCAGAAAGAGAGAGAGGACAGG + Intergenic
1062933707 10:1369459-1369481 CAGAGAAAGAGTGAGGGGTTTGG - Intronic
1063160810 10:3416792-3416814 GTAAGAAAGAGAAATGGGGCCGG + Intergenic
1063428875 10:5971383-5971405 CTGGGAAACAGAAAGAGGTGTGG - Intronic
1063656346 10:7994023-7994045 CAGAGAAAGAGAGAGGGGGAGGG - Intronic
1063672337 10:8109416-8109438 ATAAGAAGGAGGAAGGGGTCAGG - Intergenic
1063692934 10:8304343-8304365 CAGAGAAAGAGAGAGGTGACAGG + Intergenic
1063865983 10:10366162-10366184 CTGAGAAAGAGAGAGAGGGAGGG + Intergenic
1064348722 10:14557063-14557085 GTGAGGAAGAGCCAGGGGTCAGG - Intronic
1064671866 10:17722758-17722780 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1064840614 10:19587035-19587057 CTCGGGAAGAGCAAGGGGTCAGG - Intronic
1064866105 10:19882327-19882349 CCAATAAAGACAAAGGGGTCAGG + Intronic
1064939847 10:20721708-20721730 CTGAGCCAGAGAAGTGGGTCTGG - Intergenic
1065222625 10:23511865-23511887 CTCAGGAAGGGCAAGGGGTCAGG - Intergenic
1065237882 10:23672357-23672379 CCCAGAAAGCGCAAGGGGTCAGG - Intergenic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1065527561 10:26638329-26638351 CAGGGAAAGAGGAAGGGGTGGGG - Intergenic
1065695087 10:28372321-28372343 CTTAGAAAGAGCAACGCGTCTGG + Intergenic
1067063965 10:43093339-43093361 GGGTGAAAGAGAAAGGGATCTGG + Intronic
1067205420 10:44208218-44208240 CTGAGAAAGAGATAGGGGAAGGG - Intergenic
1067301535 10:45014979-45015001 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1067324214 10:45250833-45250855 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1067379709 10:45761621-45761643 CAGATATAGAGAAAGGAGTCAGG - Intronic
1067695948 10:48535873-48535895 CTGAGAAAGGGAAGGGTGTCGGG - Intronic
1068394924 10:56448023-56448045 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1068445094 10:57110496-57110518 CTGGGAAAGGGAGTGGGGTCTGG + Intergenic
1068472182 10:57479498-57479520 TTGAGAAAGGTAAAGGTGTCAGG - Intergenic
1068724829 10:60289382-60289404 GAGAGAAAGAGAAAGGGGGAGGG - Intronic
1068776695 10:60875043-60875065 CTGGGGAAGAGAGAGGGGGCAGG + Intronic
1069284039 10:66691166-66691188 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
1069338868 10:67387241-67387263 CTGGGGAAGCGCAAGGGGTCAGG + Intronic
1069889759 10:71645525-71645547 CTGGGACAGAGAAAGGGAGCAGG + Intronic
1069976035 10:72214055-72214077 AAGAGAAAGAGAAAAGGGCCAGG + Intronic
1070074511 10:73122152-73122174 CTAAGAAACAGAAAGGGGAAGGG - Intronic
1070271258 10:74957563-74957585 CTGGGAAAGAAAAATGGGTTTGG + Intronic
1070477718 10:76846402-76846424 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1071467635 10:85955910-85955932 TTGAGAAAGAGAAAGGGCTGAGG - Intronic
1071755196 10:88529453-88529475 CTGAGAGAGAGAAAGAGGAAAGG - Intronic
1072819392 10:98541525-98541547 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1073096725 10:100984465-100984487 GGGAGAAAGAGAAAGGGTTTGGG - Exonic
1073506746 10:104001278-104001300 CTGAGAAAGAAAGAGGGGAGAGG - Intronic
1073935943 10:108632075-108632097 CTAAGCAAGAGAAAGGGGATGGG - Intergenic
1073960870 10:108926072-108926094 CTGAGAAAGAAAGTGGGGTGGGG - Intergenic
1074561669 10:114540671-114540693 TTGAGAAAGAGAAAGGTCACTGG - Intronic
1074617598 10:115085400-115085422 ATGAGGAAGATAAAAGGGTCAGG - Intergenic
1074678540 10:115880326-115880348 GTGATAAATAGAAAGGGGCCAGG + Intronic
1074888028 10:117710139-117710161 ATAAAAAAGAGAAAGGGGCCAGG - Intergenic
1075566962 10:123512022-123512044 GTGAGAAAGAGCAATGGGCCCGG + Intergenic
1075742391 10:124703872-124703894 CTCAGAAAGGGAAAGCAGTCAGG - Intronic
1075973728 10:126676668-126676690 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1076166999 10:128290695-128290717 CTAAGGAACAGAAAGGGATCTGG + Intergenic
1076209075 10:128626152-128626174 CATAGAAAAAGAAAGGTGTCGGG + Intergenic
1076300553 10:129422808-129422830 CTGTGAGATAGAAAGGGCTCAGG - Intergenic
1076366093 10:129921913-129921935 ATGAGCAAGAGACAGGGGGCGGG - Intronic
1077818419 11:5711415-5711437 CTGAGTAGGAGAAAGGGTTGAGG - Intronic
1078061229 11:8046092-8046114 CTGAGAAAGAGAAGGAGGGATGG - Intronic
1078077032 11:8171537-8171559 CTAAGAAATACAGAGGGGTCTGG + Intergenic
1078577502 11:12514308-12514330 CAGAGAAAGAGAGAGAGGTGTGG - Intronic
1078720193 11:13877246-13877268 CTGAGAAAGGAAAAGAGGTGAGG - Intergenic
1078732982 11:13992814-13992836 CCCAGGAAGAGCAAGGGGTCAGG - Intronic
1078950017 11:16120112-16120134 GAGAGAGAGAGAAAGGGGTGGGG - Intronic
1079093445 11:17496106-17496128 CAGTGAGAGAGAAAGGGGACCGG + Intronic
1079388666 11:20002369-20002391 CTGAGATAGAGAGAGGGCTTTGG - Intronic
1079404142 11:20130388-20130410 AAGAGAGAGAGAAAGGGGTGAGG + Intergenic
1079629192 11:22652730-22652752 CTGGGGAAGCGCAAGGGGTCAGG - Intronic
1080033690 11:27688670-27688692 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1080326268 11:31076952-31076974 CTGGGAAACAGAAGGTGGTCAGG - Intronic
1080563286 11:33484053-33484075 CTTTGAAAAAGAAAAGGGTCTGG - Intergenic
1081086754 11:38811374-38811396 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081394616 11:42571503-42571525 CTGAGAATGAGAAAAGGGTAGGG - Intergenic
1081671440 11:44944918-44944940 CTGGGAAAGAGACAGGGGGTTGG - Intronic
1081697784 11:45128279-45128301 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
1082134701 11:48533856-48533878 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1082287157 11:50330034-50330056 CCCAGGAAGTGAAAGGGGTCAGG - Intergenic
1082579617 11:54850136-54850158 CTTAGGAAGCGCAAGGGGTCAGG + Intergenic
1082602354 11:55173472-55173494 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1082711128 11:56554834-56554856 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1082970471 11:59015434-59015456 CTCAGGAAGAGCAAGGGGTCAGG + Intronic
1083931522 11:65848820-65848842 CTGAGAAAGTGCATGGGGTTGGG + Intronic
1084454522 11:69260395-69260417 TTCAGAAAGAGAAAGGGGGTTGG - Intergenic
1084551465 11:69845604-69845626 CTGAGGAACAGCGAGGGGTCAGG + Intergenic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1084977233 11:72808494-72808516 CTGGAAAAGAGAAATGGGTGTGG - Intergenic
1085257275 11:75182240-75182262 CTGTGAAAGAGCATGGGGTTTGG - Intronic
1085566989 11:77523074-77523096 CTGAGAGAGGGAAAGGGGCAAGG + Intronic
1085797167 11:79552849-79552871 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1085800680 11:79586275-79586297 CTGAGGAAGTGCAAGGGGTTGGG + Intergenic
1086069296 11:82782185-82782207 CTGAGGCAGAGAATAGGGTCTGG + Intergenic
1087132196 11:94678012-94678034 CTGATACAGAGAAAGAGGGCAGG + Intergenic
1087420768 11:97922912-97922934 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1087581672 11:100063406-100063428 CTTAGAAAGAGAAACTGGGCTGG + Intronic
1088292929 11:108260823-108260845 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1088670488 11:112135480-112135502 CTGAGAAAATGAATGGGGTTGGG + Intronic
1088823276 11:113474579-113474601 CTTAGAAACTGAAAAGGGTCAGG + Intronic
1088940588 11:114451353-114451375 CTGAGAAGGAGAAAGGGGAGGGG - Intergenic
1088958854 11:114639401-114639423 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1089121603 11:116139588-116139610 TTGAGAAGGAGAACTGGGTCAGG - Intergenic
1089224898 11:116910619-116910641 CTGGGAAAGAGAAAGGGACAAGG + Intronic
1089596346 11:119583432-119583454 CTGAGCAAGAGAAGAGGGGCAGG - Intergenic
1089624088 11:119740396-119740418 ATCAGAAAGAGAAAGGGGCTGGG - Intergenic
1089629044 11:119772360-119772382 CTTAGAACCAGAAAGGGCTCTGG + Intergenic
1090069816 11:123534322-123534344 CTGAGAAGGAGAAAGAGGAGGGG + Intronic
1090419187 11:126562308-126562330 CTGAGTAAGAGGGAGGGGTAGGG + Intronic
1090508943 11:127350973-127350995 GTGAAAAAGAAAATGGGGTCAGG + Intergenic
1091062709 11:132479207-132479229 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1091084778 11:132710910-132710932 ATGAGAGAGGGTAAGGGGTCTGG + Intronic
1091149090 11:133310102-133310124 ATGATGAAGAGAAAGGAGTCTGG + Intronic
1091153152 11:133348081-133348103 CTGGGAGAGAGAAAGGGCTCAGG + Intronic
1091451802 12:576652-576674 CTGAGAAAGAGCACGGAGGCCGG - Intronic
1092089172 12:5790041-5790063 CTTAGAAGGAGCAAGGGGACTGG - Intronic
1092322972 12:7498158-7498180 GAGAGAGAGAGAAAGGGATCTGG + Intronic
1092462276 12:8697602-8697624 CTGAGAAAGGGAAACGGATGGGG - Intronic
1092596209 12:10007606-10007628 CTGAGAAAGAAAAAGAGATTGGG + Intronic
1092652802 12:10652980-10653002 CTGAAATAGGGAAAGGAGTCAGG + Intronic
1093493980 12:19734626-19734648 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1093865988 12:24228057-24228079 CTGACAAAGAGAAAGGCATATGG + Intergenic
1094092780 12:26669755-26669777 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
1094489496 12:30950099-30950121 CCAAGAAAGAGAAGGGGGTGGGG - Intronic
1095227911 12:39699283-39699305 CTCGGGAAGCGAAAGGGGTCAGG + Intronic
1095423452 12:42049424-42049446 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1095591265 12:43906678-43906700 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1095786866 12:46119539-46119561 CTGAGAAGAAAAAAGTGGTCAGG + Intergenic
1095798405 12:46246212-46246234 CTCAGGAAGTGCAAGGGGTCTGG + Intronic
1095911090 12:47427100-47427122 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1096084615 12:48857349-48857371 CTCTGCAAGAGAAGGGGGTCTGG + Exonic
1096394166 12:51253005-51253027 CTGAGAAAGAGAAAGGGGTCGGG + Intronic
1096568304 12:52499610-52499632 CTTAAAAAGAGAAAGTGGTTGGG - Intergenic
1096931048 12:55210622-55210644 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1097088386 12:56486543-56486565 ATGAAAAAGAGAAAAGGGCCGGG + Intronic
1097497646 12:60361294-60361316 GTGAGAAAGAGCTAGGAGTCTGG - Intergenic
1097823382 12:64150088-64150110 CTCAGCAAGAGAAATGGGACTGG + Exonic
1098869536 12:75801549-75801571 CTAAGAAAGAGACATGGGCCGGG - Intergenic
1098957729 12:76704879-76704901 ATGAGTAAGAGAAGGGGGTGGGG - Intergenic
1099225703 12:79966685-79966707 CTAAGAAAAAGAAAAGGTTCTGG - Intergenic
1099745049 12:86690573-86690595 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
1099773734 12:87098598-87098620 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1100587452 12:95993263-95993285 CTCAGAAAAAGAAATGGGCCAGG - Intronic
1100666875 12:96764325-96764347 CTGTAAAAGAGAAAGGAGTTGGG + Intronic
1100720757 12:97355351-97355373 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1100739583 12:97576810-97576832 TTGAGAAATAGCAATGGGTCAGG - Intergenic
1101312696 12:103597990-103598012 GTGAGAAAGAAAAAGAGGCCTGG - Intronic
1101387169 12:104268149-104268171 GAGAGAAAGAGGAAGGGGCCGGG - Intronic
1101743822 12:107522696-107522718 AAGAGAAAGAGAGAGGGGTTGGG + Intronic
1101876363 12:108599006-108599028 TTGCCAAACAGAAAGGGGTCAGG + Intergenic
1103166041 12:118771593-118771615 GTGAGAAAAAGAAAGGGCTTTGG + Intergenic
1103841598 12:123869699-123869721 CTGAGAAGGAGGAAGGGGCTGGG - Intronic
1104215481 12:126728901-126728923 CTGAGGAAGAGAAAGGAGAGTGG - Intergenic
1104216311 12:126737058-126737080 CTGAAAATAAGAAAGGGGTGAGG + Intergenic
1104924819 12:132308633-132308655 CTGAGACAAAGAGAGGGGCCCGG + Intronic
1104942899 12:132403221-132403243 CTGGGAAGGAGAGAGGGGGCGGG + Intergenic
1105685852 13:22781065-22781087 GAGAGAAAGAGAAAGAGGTGGGG + Intergenic
1106139474 13:26999767-26999789 CTGAGATACAGGAAGGGGCCTGG - Intergenic
1107227180 13:38065570-38065592 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1107473530 13:40713113-40713135 CCCAGAAAGTGCAAGGGGTCAGG - Intergenic
1107687025 13:42912157-42912179 CTGAAAGAGAGAAAGGAGACAGG + Intronic
1107729876 13:43338271-43338293 CTGAGAAACTGAAAGTGGGCAGG + Intronic
1107939907 13:45374364-45374386 GAGAGAAAGAGAAAGAGGTGGGG + Intergenic
1108166034 13:47694068-47694090 ATGAGAAGGAGAAAGGGGTCAGG - Intergenic
1108410916 13:50146054-50146076 CTGAGAAAGAGAGAGTGGGTTGG - Intronic
1108628281 13:52254511-52254533 CTGGGGAAGCGCAAGGGGTCAGG + Intergenic
1108657779 13:52551938-52551960 CTGGGGAAGCGCAAGGGGTCAGG - Intergenic
1109192582 13:59343250-59343272 CTGAGCAAAAGAAGGGGGGCGGG + Intergenic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1109600917 13:64627455-64627477 CAGAGAAGGAGCAAGGGGTGGGG - Intergenic
1109902868 13:68796127-68796149 CCCAGGAAGTGAAAGGGGTCAGG - Intergenic
1110628489 13:77678722-77678744 CTGGGAAAGAGAAAGTGGGCAGG + Intergenic
1110698461 13:78519176-78519198 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1110841768 13:80152098-80152120 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1111046127 13:82814748-82814770 CAGAGCAAGAGAGAGGAGTCAGG - Intergenic
1111214348 13:85123424-85123446 CTGAGTCAAAGAAAGGGGTGAGG + Intergenic
1112630701 13:101158453-101158475 CAGAGAAGGAGAAAGGGGTGGGG + Intronic
1112724318 13:102284943-102284965 GTGAGAAAGAGAAAGAGGGAGGG - Intronic
1112877491 13:104062493-104062515 ATGAGAGAGAGAAATGGGGCAGG - Intergenic
1113017025 13:105838922-105838944 CAGAAAAAGAGAATTGGGTCTGG - Intergenic
1113307146 13:109090853-109090875 ATAAGAAAGAGAAATGGGACGGG - Intronic
1113674509 13:112197990-112198012 GAGAGAAAGACAAAGGGGTAGGG + Intergenic
1114167642 14:20236087-20236109 CTTGGAAAGCGCAAGGGGTCAGG - Intergenic
1114550874 14:23532202-23532224 AGGAGAAAGAGAAAGGGTTGGGG - Intronic
1114741680 14:25104446-25104468 CCCAGAAAGTGCAAGGGGTCAGG + Intergenic
1114760865 14:25312334-25312356 TGGAGAAAGAGCAAGGGGTTAGG - Intergenic
1115723132 14:36184746-36184768 CTTGGAAAGTGCAAGGGGTCAGG + Intergenic
1115905513 14:38199013-38199035 CAAAGACAGAGAAAGGGGTGAGG - Intergenic
1116138191 14:40954719-40954741 CTCAGAAAGCGCAAGGGGTCAGG - Intergenic
1116284952 14:42959006-42959028 CTGAGTCAAAGAAAGGGGTGAGG - Intergenic
1116465316 14:45225078-45225100 CTGAGAAATAGCAAGTGGTGTGG - Intronic
1116546108 14:46167063-46167085 CTGGGGAAGTGCAAGGGGTCAGG - Intergenic
1116570351 14:46508755-46508777 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1116916645 14:50532260-50532282 CCGTGGAAGAGAAAGGGGCCTGG + Intronic
1116933293 14:50711906-50711928 CTGAGAAAGTGAGAAGGGACAGG + Intergenic
1117237900 14:53798088-53798110 CTGAGGAAGTGTAAGAGGTCAGG + Intergenic
1117279244 14:54221112-54221134 CTGAGAAAGAGTGAGGGAACAGG + Intergenic
1117312227 14:54539352-54539374 CTTGGAAAGAGAAAAGGGTGGGG - Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1118477806 14:66134719-66134741 TTGAGAAAGAAGAAGGAGTCAGG - Intergenic
1119707695 14:76795526-76795548 CACAGAGAGAGAAAGGGGCCAGG - Intronic
1119843929 14:77814372-77814394 GTCAGAAAAAAAAAGGGGTCAGG - Intronic
1120069644 14:80088724-80088746 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1120114456 14:80597181-80597203 CAGAGAAAGAGAGACGGGGCAGG + Intronic
1120336847 14:83168124-83168146 ATGAGAGAGAGTAAGGGGTAAGG + Intergenic
1120488272 14:85143323-85143345 CTTAAAGAGAGAAAGGGGTGGGG - Intergenic
1120600464 14:86498989-86499011 CTTAGACAGATAGAGGGGTCAGG - Intergenic
1120868745 14:89318452-89318474 GAGAGAAAGAAAAAGGGGCCGGG - Intronic
1121193984 14:92053793-92053815 ATCAGAAAGAGAAAGGAGGCTGG - Exonic
1121277138 14:92676205-92676227 CTAGGAAAGGGGAAGGGGTCAGG + Intronic
1122748684 14:103917060-103917082 CTGAGAAACAATAAAGGGTCAGG + Intronic
1202888264 14_KI270722v1_random:129374-129396 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
1202889521 14_KI270722v1_random:142725-142747 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
1124496283 15:30189355-30189377 CTGAGAAGCAGAGAGGGGTAAGG - Intergenic
1124747291 15:32349292-32349314 CTGAGAAGCAGAGAGGGGTAAGG + Intergenic
1124957694 15:34370513-34370535 CTGATACAGATACAGGGGTCAGG - Intergenic
1125226835 15:37405258-37405280 CTTAGGAAGCGCAAGGGGTCAGG - Intergenic
1125316060 15:38432709-38432731 CTCAGAAAAAGAAAAGTGTCTGG - Intergenic
1125352558 15:38782944-38782966 CTCGGAAAGTGCAAGGGGTCAGG + Intergenic
1125899508 15:43331825-43331847 CTCAGAAGGAAAAAAGGGTCAGG + Intronic
1126109190 15:45165853-45165875 CTGGGGAAGAGAACGGGGTCGGG + Intergenic
1126254888 15:46614499-46614521 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1127580988 15:60339332-60339354 CTGACAGAGAGAAAGGCGGCAGG + Intergenic
1127609322 15:60621744-60621766 CTGAAAAAGAGTAAAGGGTGGGG + Intronic
1128051867 15:64671905-64671927 CTGAGAATAAGAAAGTGGTATGG - Intronic
1128482616 15:68053466-68053488 TTGAGAGAGAGAAAGGGTTTGGG - Intergenic
1128610207 15:69067123-69067145 CAGAGAAAGACTGAGGGGTCAGG - Intergenic
1129097214 15:73221863-73221885 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1129312735 15:74723961-74723983 CTGAGGAAGAGATAGGGGACAGG + Intronic
1129521478 15:76189214-76189236 CAGAGAAAGAGAAAGGAGAGAGG + Intronic
1129837453 15:78720027-78720049 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1130565240 15:84988551-84988573 CTGAGCAGGAGAAAGGGGAAAGG - Intronic
1130663282 15:85848650-85848672 GTTAGAAAGAGCCAGGGGTCTGG - Intergenic
1130778732 15:87012097-87012119 CTGAGAAGGAGAATAGGCTCAGG + Intronic
1131018023 15:89073973-89073995 AGGAGAAAGAGAAAGGGCTTTGG + Intergenic
1131074121 15:89484148-89484170 ATGAGAGAGAGAATGGGGTGAGG + Intronic
1131122226 15:89829729-89829751 CTGGGAAGGAGAAAGAGCTCAGG - Intergenic
1132010826 15:98275187-98275209 CTGATAAAGAGAAAGGGTAAGGG - Intergenic
1132260177 15:100417265-100417287 CTTGGGAAGAGCAAGGGGTCGGG + Intronic
1132310051 15:100850516-100850538 CTGGGAAAGTGCAAGGGGTGGGG + Intergenic
1132416851 15:101626645-101626667 CTTGGGAAGAGCAAGGGGTCAGG + Intronic
1132977533 16:2718042-2718064 CTTGGAAGGAGCAAGGGGTCGGG - Intronic
1133237308 16:4393217-4393239 CTGAGAAAGTGAAGGGGGCCGGG + Intronic
1133543292 16:6777372-6777394 CTGAGAAAGAGAACCGAGGCAGG + Intronic
1133898762 16:9953530-9953552 CTGAAGATGAGAAAGGGGTCAGG + Intronic
1134048893 16:11123195-11123217 CTGAGAAAGGGACAGGGGCTGGG - Intronic
1134167389 16:11941454-11941476 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1134398662 16:13889077-13889099 CGGAGAAGGAGAAAGGGGAGGGG - Intergenic
1134493307 16:14712242-14712264 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1134498688 16:14751366-14751388 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1134525242 16:14937996-14938018 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1134547653 16:15122923-15122945 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1134712830 16:16336480-16336502 AGGAGAAGAAGAAAGGGGTCTGG - Intergenic
1134720695 16:16379798-16379820 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1134820577 16:17243791-17243813 CTGAGAAAGTCAGAGGGGTGAGG + Intronic
1134946732 16:18332087-18332109 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1134953997 16:18372213-18372235 AGGAGAAGAAGAAAGGGGTCTGG + Intergenic
1135064784 16:19300251-19300273 ATAAAAAAAAGAAAGGGGTCGGG + Intronic
1135312822 16:21419102-21419124 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1135365745 16:21851382-21851404 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1135446069 16:22519780-22519802 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1135964990 16:27028232-27028254 CTGAGAAAGAGAAGGGAAACAGG - Intergenic
1136151983 16:28356850-28356872 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1136168236 16:28470718-28470740 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1136194763 16:28644333-28644355 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1136211097 16:28758432-28758454 AGGAGAAGAAGAAAGGGGTCTGG - Intronic
1136255818 16:29038390-29038412 AGGAGAAGAAGAAAGGGGTCTGG - Intergenic
1136309492 16:29397846-29397868 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1136322935 16:29499610-29499632 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1136437619 16:30239578-30239600 AGGAGAAGAAGAAAGGGGTCTGG + Intronic
1136513884 16:30756344-30756366 CTGGGAAAGAGACTGGAGTCAGG - Intronic
1136647630 16:31635805-31635827 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1136678444 16:31937747-31937769 CTTAGGAAGTGCAAGGGGTCAGG + Intergenic
1137051926 16:35721754-35721776 CCCAGGAAGAGCAAGGGGTCAGG - Intergenic
1137075733 16:35958707-35958729 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1137238555 16:46635298-46635320 CAGAGATAGAGAGAGGGGTGGGG + Intergenic
1137327611 16:47457587-47457609 CTGAGAGAGAAACAGGGGTGTGG + Intronic
1137371419 16:47910071-47910093 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1137447551 16:48540957-48540979 CCGAGAAAGGGAAAGGGGACAGG + Exonic
1137524863 16:49225957-49225979 CTGAGGAAGAGGAAGAGGACAGG + Intergenic
1137553433 16:49455685-49455707 CTGAGAAAGAGAAAGAACGCTGG + Intergenic
1137904305 16:52304277-52304299 TTGATAAATGGAAAGGGGTCAGG - Intergenic
1140034222 16:71360295-71360317 CTGAGAAAGCTAGAGGGGTAGGG + Intronic
1140037161 16:71380196-71380218 TTGAGAAAGAGAAAAGGGTCCGG - Intronic
1140146723 16:72318817-72318839 TTGAGAAAGACAAAGAAGTCAGG + Intergenic
1140307091 16:73813213-73813235 GAGAGAAAGAGAAAGAGGTAGGG - Intergenic
1140855820 16:78976897-78976919 CTGAGAAAAAGAAAAGGGCATGG - Intronic
1141604431 16:85144855-85144877 TGGAGAAAGAGGAAGGGGCCAGG - Intergenic
1142882512 17:2892875-2892897 CCCAGAAAGAGAAAGGGGAGGGG - Intronic
1143197561 17:5087785-5087807 CAGGGCAGGAGAAAGGGGTCAGG - Intronic
1144167519 17:12626767-12626789 CTGAGAAAGTGAGAGTGGTAGGG + Intergenic
1144331624 17:14229398-14229420 CTGAGAAAGGGCAGGGGTTCAGG - Intergenic
1146374333 17:32284258-32284280 CTGGCAAAGGGAAAGGGGACTGG - Intronic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1146967513 17:37045468-37045490 CTGAGAAGCAGAAAGGGGAACGG - Intronic
1147354291 17:39881391-39881413 ATGAGAAAGAGAAAGAGGTGGGG + Intergenic
1147862792 17:43533355-43533377 TTGAGAAGGAGACAGGGGTGAGG + Intronic
1148906089 17:50913170-50913192 CAGGGAAAGGCAAAGGGGTCTGG - Intergenic
1148953241 17:51332878-51332900 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1149017273 17:51922931-51922953 AGGAGAAAGTGATAGGGGTCTGG - Intronic
1150143103 17:62746467-62746489 CAGAGAGAGAGAGAGGGATCAGG + Intronic
1150272025 17:63872882-63872904 CTGAGAAGCAGAAGGAGGTCTGG + Exonic
1150275572 17:63895778-63895800 CTGAGAAGCAGAAGGAGGTCTGG + Exonic
1150277705 17:63910467-63910489 CTGAGAAGCAGAAGGAGGTCTGG + Exonic
1150278996 17:63918064-63918086 CTGAGAAACAGAGGGAGGTCTGG + Exonic
1150512430 17:65770041-65770063 CCCAGAAAGAGAAAGAGGTTTGG + Intronic
1150551038 17:66210427-66210449 CTGAGAAAGAGGCATGGGTGGGG + Intergenic
1151083741 17:71357673-71357695 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1151447712 17:74178023-74178045 GTAAGAAAGAGAACGGAGTCAGG + Intergenic
1151593790 17:75064362-75064384 CAGAGAAAGGGAAGGGGCTCTGG + Exonic
1151801463 17:76382270-76382292 GGGAGAAGGGGAAAGGGGTCTGG + Intronic
1152182920 17:78835814-78835836 CTAAGAAAGAGAAATGGGGTGGG - Intronic
1152401533 17:80069448-80069470 CTGAGGAAGCTGAAGGGGTCAGG + Intronic
1154118627 18:11633479-11633501 AGGAGAAGAAGAAAGGGGTCTGG + Intergenic
1155020151 18:21888875-21888897 CCCAGGAAGAGCAAGGGGTCAGG - Intergenic
1155578790 18:27279745-27279767 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1155616644 18:27729149-27729171 CTCAGAAAGATAAAGGGGGATGG + Intergenic
1155840110 18:30632966-30632988 CTGAAAAAGAGAGAGGTGGCAGG + Intergenic
1156622154 18:38865071-38865093 GTGAGAGAGAGAAAGGTGCCAGG - Intergenic
1156634414 18:39010441-39010463 CTGAGGAAGAGAAAGGAATTTGG - Intergenic
1156722566 18:40088161-40088183 CAGAGAAAGAGAAGGGGGAAAGG + Intergenic
1157464522 18:47931541-47931563 CTGAGAGAGAAAAGGGGTTCGGG + Intergenic
1157513620 18:48295849-48295871 GTGGGGAAGAGATAGGGGTCAGG + Intronic
1158121555 18:54054160-54054182 CTGAGAAATGGAAAGGGGACAGG - Intergenic
1158282479 18:55842445-55842467 GTTAGAAAGAGACAGAGGTCTGG + Intergenic
1158497184 18:57967046-57967068 ATAAGAAAGAGAAAAGCGTCAGG + Intergenic
1160053571 18:75459104-75459126 CAGAGACAGAGAGAGGGGGCGGG + Intergenic
1160093128 18:75845670-75845692 CTCAGAAAGAGAAAAGGGCCAGG - Intergenic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1161804445 19:6434383-6434405 CAGAGAGAGAGAAAGAGCTCTGG - Intergenic
1161908410 19:7174752-7174774 GAGAGAAAGAGAAAGGGGAGGGG + Intronic
1161916934 19:7235552-7235574 TTAAGAAAGTGAAAGGGGCCAGG + Intronic
1162069123 19:8143101-8143123 CTGAGAAAGAGAAAGAGAACCGG - Intronic
1162071665 19:8156096-8156118 ATTAGAAAGAGAAAGAGGCCAGG - Intronic
1162641048 19:12010597-12010619 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1162894126 19:13754732-13754754 CAGAGAACGAGACAGTGGTCAGG - Intronic
1163266540 19:16225777-16225799 CTGAGAAGCAAGAAGGGGTCAGG + Intronic
1163598318 19:18233190-18233212 ATGCGCCAGAGAAAGGGGTCTGG + Exonic
1163644173 19:18478957-18478979 CTGAGACAGAGGAAAGGGTGAGG + Intronic
1164236098 19:23335754-23335776 CCCAGAAAGCGCAAGGGGTCGGG - Intronic
1164318619 19:24117628-24117650 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
1164866292 19:31607042-31607064 CAGAGGAAGAGAGAGGGGTGAGG - Intergenic
1165168468 19:33873178-33873200 GTGAGAAAGAGGAAGAGGTCTGG + Intergenic
1165607301 19:37116665-37116687 CTCAGTAAGTGCAAGGGGTCAGG + Intronic
1165850009 19:38844369-38844391 CTGAGACGGAGAAAGTGGTGTGG - Intronic
1166117371 19:40663997-40664019 CTGTGAGGGAGAAGGGGGTCTGG - Intergenic
1166160606 19:40950017-40950039 ATGAAAAAGAGAATGGGGTATGG - Intergenic
1166169505 19:41017749-41017771 ATGAAAAAGAGAATGGGGTATGG - Exonic
1166306100 19:41937896-41937918 CTGAGAAAGAGACAGGGTTTGGG - Intergenic
1167055697 19:47110957-47110979 CTGTGAAGGAGAAAGGGGAAAGG + Intronic
1167383555 19:49151690-49151712 CCCAGAACGAAAAAGGGGTCCGG - Intronic
1167644507 19:50698403-50698425 GAGAGACAGAGACAGGGGTCTGG - Intronic
1167690636 19:50982458-50982480 CTGAGAAGGAGAAAGCATTCAGG + Intronic
1167802693 19:51755363-51755385 CTGAGCTAGAGACAGGGGTCTGG - Intronic
1168495415 19:56843846-56843868 CAGAGATAGAGAAATGGATCAGG - Intergenic
1168596706 19:57683323-57683345 TTGAGAAAGAGAGTGGAGTCAGG + Intronic
1168657669 19:58142825-58142847 GGGAGAAGGAGAAAGGGGTTGGG - Intronic
1168706403 19:58472701-58472723 CTGGGAAAGAGAAAAGGTTTGGG + Exonic
1202663657 1_KI270708v1_random:96166-96188 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
1202664926 1_KI270708v1_random:109494-109516 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
925028986 2:634844-634866 CTGAGAAAGAGACAGGAGAAGGG + Intergenic
925676380 2:6366554-6366576 GTGAGAAAAAGACAGGAGTCAGG + Intergenic
926989256 2:18659879-18659901 AAGAAAAGGAGAAAGGGGTCAGG - Intergenic
927144162 2:20150457-20150479 CTGAGAAAAAAAAATGGGTCAGG + Intergenic
928060670 2:28109697-28109719 ATGAGCCAGAGAAAGGCGTCAGG - Intronic
928235070 2:29532098-29532120 TTGAGAAGGAGAAAGGAGCCTGG + Exonic
929162168 2:38843211-38843233 CTGAGAAAGACAAAGGAATGTGG + Intronic
929272714 2:39990418-39990440 CTGACAAAGATTAAGGGCTCTGG + Intergenic
929923123 2:46187535-46187557 GAGAGAAAGAGAAAGGGGGTGGG - Exonic
930403983 2:50930383-50930405 GAGAAAAAGAGAAAGGGGGCAGG + Intronic
930905187 2:56557528-56557550 CTCAGAAAGCGCAAGGGGTCAGG - Intergenic
930987554 2:57609032-57609054 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
931690859 2:64833837-64833859 CAGAGGAAGGGATAGGGGTCTGG + Intergenic
931738064 2:65216165-65216187 GTAAGAAAGAGGAAGGGGTGGGG - Intergenic
931758345 2:65394463-65394485 CTGAGAATGAGAAAGGCCTCTGG + Intronic
931846183 2:66206514-66206536 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
932396860 2:71454519-71454541 CTGAGAGAGAGCAAAGGGCCAGG - Intronic
932457724 2:71860230-71860252 CTGAAGGAGAGAAAGGGGACGGG + Intergenic
932895716 2:75637667-75637689 GTGTGAGAGAGGAAGGGGTCAGG - Intergenic
932935443 2:76096567-76096589 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
933212555 2:79587507-79587529 GTGAGAAACAGAAAGAGGCCAGG - Intronic
933475626 2:82786454-82786476 TGGAGAAAGAGAAGGGGGGCGGG + Intergenic
933590248 2:84224936-84224958 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
934130802 2:88947114-88947136 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934132813 2:88966075-88966097 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934140235 2:89040037-89040059 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934146463 2:89099672-89099694 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934148198 2:89117155-89117177 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934221089 2:90083456-90083478 CTGAGAAAGAGAAAAGAATTAGG - Intergenic
934222804 2:90100903-90100925 CTGAGAAAGAGAAAAGAATTAGG - Intergenic
934228999 2:90160500-90160522 CTGAGAAAGAGAAAAGAATTAGG - Intergenic
934251120 2:90356265-90356287 CTCAGAAAGCACAAGGGGTCAGG - Intergenic
934258442 2:91447145-91447167 CTCAGAAAGCACAAGGGGTCAGG + Intergenic
934627086 2:95869719-95869741 CTCAGGAAGTGGAAGGGGTCAGG + Intronic
934786564 2:97013727-97013749 CTGAGAAAGAGAAGGAGGATTGG + Intronic
934806475 2:97231568-97231590 CTCAGGAAGTGGAAGGGGTCAGG - Intronic
934831033 2:97525610-97525632 CTCAGGAAGTGGAAGGGGTCAGG + Intronic
934956263 2:98622855-98622877 TTAAGAGAGAGAAAGGGGGCTGG + Exonic
935355611 2:102196768-102196790 GTGAGAAAGAGAATGGTGTTTGG + Intronic
935422094 2:102879963-102879985 CTCAGGAAGGGCAAGGGGTCAGG - Intergenic
935450202 2:103200753-103200775 CCCAGGAAGTGAAAGGGGTCAGG + Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935867582 2:107407628-107407650 AAGAGAAAGAGAAAGGGGAGGGG - Intergenic
936731104 2:115382367-115382389 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
937071266 2:119065520-119065542 GTGAGAAAAAGAAAGGAGTCAGG - Intergenic
937102740 2:119284089-119284111 CTGGGAATGAGAAAAGGGTGTGG - Intergenic
937297337 2:120817677-120817699 ATGAGACAGATATAGGGGTCTGG - Intronic
937551366 2:123096068-123096090 GAGAGAAAGAGAAAGCGCTCTGG - Intergenic
937799809 2:126070437-126070459 TTGAGAAGGAGGAAGGGTTCAGG - Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938187440 2:129243971-129243993 CAGAGAAAAAGAAAGTTGTCAGG - Intergenic
938949548 2:136244107-136244129 CTGAGGAAGAGAGAGGCGGCTGG + Intergenic
939047082 2:137262425-137262447 CTGCTAAAATGAAAGGGGTCAGG + Intronic
939176248 2:138751030-138751052 ATGAGAAAGAGATGGGGGTGGGG - Intronic
939239413 2:139538756-139538778 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
939486030 2:142812075-142812097 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
939751481 2:146052691-146052713 CTACCAAAGAGAAAGGGCTCAGG + Intergenic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940044417 2:149393714-149393736 CTGAGGAAGATTAAGGGATCTGG + Intronic
940083500 2:149831865-149831887 GTGGGAAAGATAAAGGGGTCTGG + Intergenic
940715778 2:157221883-157221905 GTCAGAAAGTAAAAGGGGTCAGG + Intergenic
940945621 2:159615266-159615288 CCGCGAAAGAGAACGGGGGCTGG + Intronic
941267926 2:163386658-163386680 CTGAGAAAGAGAAAATGGCTGGG + Intergenic
941276512 2:163497562-163497584 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
941867645 2:170351307-170351329 CTGGGAAAAAGAATGGGGTAGGG + Intronic
942227729 2:173831732-173831754 CTGAGCAAGGGTCAGGGGTCGGG + Intergenic
942350945 2:175052334-175052356 AAGAGAAAGAGAAAGAGGCCTGG + Intergenic
942407149 2:175668203-175668225 CCCAGAAAGTGAAAGGGGTCCGG + Intergenic
942809577 2:179981954-179981976 CAGAGAAAGAGAAAGAGATACGG - Exonic
943594639 2:189841680-189841702 CAGAGAAAGAGAGAGGAGACTGG - Intronic
943872811 2:193023489-193023511 CTTATAAAGTGAAAGGAGTCAGG - Intergenic
944374738 2:199028656-199028678 CTGGGGAAGTGCAAGGGGTCAGG + Intergenic
944518584 2:200539799-200539821 AGGAGAAAGAGAAAGAGGGCAGG - Intronic
944848232 2:203690408-203690430 CCAAGAAAGACAAAGGAGTCAGG - Intergenic
945171460 2:207001101-207001123 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
945203147 2:207305064-207305086 CTGGAAAGGAGGAAGGGGTCTGG + Intergenic
945355176 2:208831765-208831787 CTCAGGAAGGGCAAGGGGTCAGG + Intronic
945538868 2:211057123-211057145 CTGGGAAAGAGCAAGGAGTCTGG - Intergenic
945564753 2:211383546-211383568 CAGAGAAAGAGAGGGGGGTGGGG + Exonic
946307671 2:218865375-218865397 CTGAGGGAGAGAAAGGGCTCTGG + Intronic
946842327 2:223831129-223831151 CTCCAAAAGAGAAAGGGGCCAGG - Intronic
947244410 2:228031078-228031100 CTTGGGAAGAGCAAGGGGTCAGG + Intronic
947334662 2:229068940-229068962 CTGAGAGAGAGAGAGGGATTGGG - Intronic
947806377 2:232971261-232971283 GTGAGAAAGAGCACGGGGTGGGG - Intronic
947828202 2:233120653-233120675 CTGAACAGGAGCAAGGGGTCAGG - Intronic
948058776 2:235028715-235028737 CAGAGAAAGAGGATGGGGTGAGG + Intronic
948820829 2:240544691-240544713 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
1168908163 20:1423388-1423410 CTGAGAAACAGAAAAGAGGCTGG + Intergenic
1169465403 20:5833795-5833817 GAGAGAAAGAGAGAGGGGGCAGG + Intronic
1169487629 20:6046442-6046464 GTGAGAAAGAGAAGGGAGCCAGG - Intronic
1170660343 20:18333110-18333132 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1171065360 20:22009624-22009646 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1171337036 20:24394144-24394166 CTGAGAGAGGGACAGGGGTCGGG - Intergenic
1171941343 20:31332907-31332929 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1171951105 20:31423285-31423307 CTGAGAAGAAGAAGGGGGTGAGG + Intergenic
1172078226 20:32316124-32316146 CTGTGAAAGATAAAGAGCTCAGG - Intronic
1172333558 20:34094313-34094335 CTGGGAAGGAAAAAGGGGCCAGG + Intronic
1173107187 20:40148777-40148799 CTGAGAAATGGAGAGGGGTTAGG + Intergenic
1173215042 20:41073269-41073291 CTGAGAAAGAGAACGGGTCAGGG + Intronic
1173240045 20:41287191-41287213 CTGAGGAAGATAAAGGGAACAGG - Intronic
1173310988 20:41895629-41895651 CTGAGAGGGAGAAAGGGGAGGGG + Intergenic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174700477 20:52603407-52603429 GTGAGGAAGAGAAAGTGATCAGG - Intergenic
1175415889 20:58800689-58800711 CTTAGGAAGAGAAGTGGGTCCGG + Intergenic
1175766104 20:61594095-61594117 CTGAGAGGGGGAAGGGGGTCAGG + Intronic
1175766143 20:61594193-61594215 CTGAGCAGGGGAAAGGGGTCAGG + Intronic
1176205028 20:63883608-63883630 CTGAGAATGGGAAAGGGGTCAGG - Intronic
1176932190 21:14826871-14826893 GTGAGAAAGAGTACGGGGTATGG - Intergenic
1177375623 21:20267332-20267354 CTGAGAAAGATAAAACAGTCTGG - Intergenic
1177930474 21:27276822-27276844 GTGAGAAAGAGAGAGAGGCCGGG + Intergenic
1178062972 21:28872529-28872551 CTATGAAAGAGAAAGGTGACAGG - Exonic
1179414551 21:41187688-41187710 CTGAGCAAGAGAAAATGGTTGGG + Intronic
1180330391 22:11473050-11473072 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
1180331651 22:11486414-11486436 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
1180419638 22:12801528-12801550 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1181864921 22:25847369-25847391 CAGAGACACAGAAAGGGGACTGG - Intronic
1182162122 22:28133422-28133444 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1182586808 22:31348084-31348106 CAGAGAAAGAGAAAGGGGCCGGG + Intergenic
1182863832 22:33584818-33584840 ATGAAAAAGAGAAAGTGGGCTGG + Intronic
1183478069 22:38046789-38046811 CTGAGAAAGAGACAGAGACCGGG + Intergenic
1183594683 22:38803555-38803577 GAGAGAAAGAGAAAGAGGCCGGG - Intergenic
1183663156 22:39233365-39233387 CAGGGAAAGAGAACGGGGGCGGG - Intronic
1184101031 22:42341883-42341905 CTGAGAAGGAGATGGGAGTCTGG + Intronic
1184405437 22:44298161-44298183 TTGAGGAAGAGAAGGGGGCCTGG - Intronic
949245288 3:1919443-1919465 CTGGGAAAGTGCAAGGGGTTGGG - Intergenic
949346794 3:3084402-3084424 CTGAGGAACAGAAAAGGGTATGG + Intronic
949366715 3:3289711-3289733 TTAAGAAGGAGTAAGGGGTCAGG + Intergenic
949993377 3:9597813-9597835 CTGAGAAAGAGAACAAGGTAAGG - Intergenic
950491581 3:13308421-13308443 CAGAGGAAGAGAAAAGGGACTGG - Intergenic
950853965 3:16088344-16088366 GAGAGAAAGAGAGAGGGGTGAGG + Intergenic
950866325 3:16192270-16192292 TTGAGACAGAGAAAGGAGCCAGG + Intronic
950919180 3:16676812-16676834 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
951540831 3:23780329-23780351 CAGAGAAAAGGACAGGGGTCGGG - Intergenic
951626731 3:24673188-24673210 GGGAGAGAGAGAAAGGGGTGGGG + Intergenic
951747207 3:25992431-25992453 CTGAGAGAGAGAGAGAGTTCAGG - Intergenic
952808046 3:37375645-37375667 CAGAGAAAGAAAAAGGTTTCTGG - Intergenic
953373021 3:42406156-42406178 TTGAAAAAGGGAGAGGGGTCAGG + Intronic
954446509 3:50549747-50549769 CTGAGGATGACACAGGGGTCAGG - Intergenic
954687676 3:52379451-52379473 CTGAGATGGAGAGAGGGGGCAGG + Intronic
954827914 3:53391332-53391354 CCCAGGAAGAGCAAGGGGTCGGG + Intergenic
955153400 3:56391478-56391500 GTGAGAAAGAGAAATGGTTAAGG + Intronic
955338936 3:58109872-58109894 CTGAGAAAGAGTAAGGATTTGGG - Intronic
955403710 3:58611650-58611672 CTCAGAGAGAGAAAGAGTTCTGG + Intronic
955675924 3:61448928-61448950 GTCAGGCAGAGAAAGGGGTCAGG + Intergenic
955898229 3:63723984-63724006 TTGAGAAAGAGAAGGAGGGCTGG - Intergenic
957091016 3:75730238-75730260 CTGAGAAAGAGAATGGGAAAGGG + Intronic
957308280 3:78487233-78487255 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
957583935 3:82110823-82110845 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
957747748 3:84366560-84366582 CCCAGAAAGTGCAAGGGGTCAGG - Intergenic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
958264701 3:91424231-91424253 CTGGGAAAGAGGTAGGGGTTAGG + Intergenic
958670466 3:97197567-97197589 TTGAGAAAAAGAAAGGGGAAAGG - Intronic
958834595 3:99130019-99130041 AGGAGAAAGAGAGAGGGGTAAGG + Intergenic
958949274 3:100399873-100399895 CTGACAAAGGCCAAGGGGTCCGG + Intronic
959076426 3:101753837-101753859 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
959100864 3:102008400-102008422 CCCAGAAAGCGCAAGGGGTCAGG + Intergenic
959101594 3:102016610-102016632 GAGAGAAAGAGAAAGGTCTCTGG + Intergenic
959327794 3:104958830-104958852 GAGAGAAAGAGAAAGAGGGCTGG + Intergenic
959353371 3:105296418-105296440 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
959378176 3:105610362-105610384 CTCAGAAAGAAAAAGGTGCCTGG - Intergenic
959421927 3:106138615-106138637 CTAATAAAGAGAAAGGGATTGGG + Intergenic
959522249 3:107333942-107333964 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
959580762 3:107980184-107980206 CTCAGAAACAAAAAGGGGCCAGG - Intergenic
960239011 3:115318253-115318275 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
960305230 3:116052300-116052322 GAGAGACAGAGAAAGGGGTAGGG + Intronic
960919616 3:122733069-122733091 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
961229665 3:125292682-125292704 CTGAAAATGAGAAAAAGGTCAGG + Intronic
961420743 3:126801269-126801291 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
962047406 3:131775402-131775424 TAGAGAAAGAGAAAGGGGATAGG + Intronic
962161523 3:133005443-133005465 CTCGGAAAGTGCAAGGGGTCAGG - Intergenic
962404721 3:135091190-135091212 CTGAGAAGGAGAAAGAGTTGAGG + Intronic
962501588 3:135999702-135999724 CTGAGAAAGAAAAAGGGGATGGG - Intronic
962668315 3:137679219-137679241 CCCAGGAAGAGCAAGGGGTCAGG + Intergenic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
964646250 3:158961092-158961114 GAGAGAAGGAGAAAGGGGTGGGG - Intergenic
965193470 3:165562055-165562077 CTGAGAAGGATAGAGGGGTAGGG - Intergenic
965393010 3:168128468-168128490 CTGGGGAAGTGCAAGGGGTCAGG + Intergenic
965445862 3:168772451-168772473 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
966299982 3:178467837-178467859 ATGGAAAAGAGAAAGGGGGCAGG + Intronic
966905889 3:184525699-184525721 CTGGGAAAGAGAAAGCGGCCGGG - Intronic
966925492 3:184642050-184642072 TTGAGAAAGAGAAAGAGATAGGG - Intronic
967722771 3:192832789-192832811 CTGGAAAAGAAAAAGGGGACCGG + Intronic
967737213 3:192965435-192965457 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
967776504 3:193391554-193391576 CTGTGACAGAGACTGGGGTCGGG + Intergenic
967870411 3:194224639-194224661 GTGAGAAAGAGAGAGAGATCAGG - Intergenic
967957558 3:194888960-194888982 CTCAGAAAGGGAAAGGGTCCTGG + Intergenic
968353971 3:198086914-198086936 CTGCCAAAGATAAAGGTGTCAGG - Intergenic
969050057 4:4366319-4366341 CGGAGGAAGAGAAAGGAGGCTGG + Intronic
969836117 4:9843195-9843217 CTGAGAATCACAAAGGGGTGTGG + Intronic
970022340 4:11583318-11583340 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
970380328 4:15501018-15501040 CTGAGAAAGAAAAACGAGACGGG - Intronic
970867219 4:20772927-20772949 ATAAGAAAGGGAAAGGGGCCGGG - Intronic
972185881 4:36527778-36527800 ATGAGAAAGAGGAAGGAGTTAGG - Intergenic
973398952 4:49621115-49621137 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
973579319 4:52325597-52325619 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
973689428 4:53409924-53409946 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
974097791 4:57384022-57384044 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
974143616 4:57919454-57919476 CTCAGCAAGTGCAAGGGGTCAGG - Intergenic
974956391 4:68646167-68646189 CTGAGGAAGTGCAAGGGGTCAGG - Intronic
975062454 4:70019458-70019480 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
975447424 4:74482070-74482092 CTGAGAAGGATATAGGGGTGAGG + Intergenic
975513647 4:75220955-75220977 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
975574992 4:75853670-75853692 CTGAGACTGAGAAAGCTGTCAGG + Intergenic
976134943 4:81925439-81925461 CAGAGAAATAGGTAGGGGTCTGG + Intronic
976225211 4:82790443-82790465 CTGAGAAAGAGAGACAGGGCAGG - Intronic
976356683 4:84126981-84127003 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
976996220 4:91437687-91437709 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
977041212 4:92021571-92021593 CTCAAAGAAAGAAAGGGGTCTGG - Intergenic
977238837 4:94541980-94542002 CTGAAAAAGTGAATGGAGTCGGG + Intronic
977578621 4:98700895-98700917 CTAAGAAACAGAGAGGAGTCAGG - Intergenic
977582266 4:98738417-98738439 CTGAGAAAGCAAGAGGGGCCAGG - Intergenic
978060196 4:104327414-104327436 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
978209610 4:106120149-106120171 CTGGGGAAGCGCAAGGGGTCAGG + Intronic
978632552 4:110763416-110763438 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
978680734 4:111378101-111378123 CTCAAAAAGTGCAAGGGGTCAGG + Intergenic
978900313 4:113940985-113941007 CAGAGAAAAAGAAGGTGGTCAGG + Intronic
979502924 4:121460834-121460856 CTGAGAGAGAGACAGGGGGAAGG + Intergenic
979626463 4:122850359-122850381 CTCAGGCAGAGAAAGGAGTCTGG - Intronic
980290389 4:130843205-130843227 TTGAGAAAGAAAAAGTGTTCTGG - Intergenic
980507324 4:133739734-133739756 CTTGGGAAGAGCAAGGGGTCAGG - Intergenic
980631894 4:135447733-135447755 CTGGGGAAGCGCAAGGGGTCAGG + Intergenic
981445784 4:144836904-144836926 CCCAGAAAGCGCAAGGGGTCAGG + Intergenic
982052033 4:151511492-151511514 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
982062887 4:151622460-151622482 CTTAGAAAGAAAAAGAGGTCTGG - Intronic
982836566 4:160126018-160126040 CTCAGGAAGAGCAAGGGGTCAGG - Intergenic
983080330 4:163377562-163377584 TTTAAAAAGAGAAAGGGGGCTGG + Intergenic
983101562 4:163632429-163632451 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
983400008 4:167250776-167250798 CTGAGAAAGAGGATGGTGTCAGG - Intergenic
983464811 4:168074180-168074202 TTAAGAATGAGAAAGGGGCCAGG + Intergenic
983573851 4:169238970-169238992 CTGAAAAAGGGCAAGGGGTGGGG - Intronic
983704302 4:170639423-170639445 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
984002839 4:174271557-174271579 CTGAGTGAGGGAAAGGGGTTGGG - Intronic
984211369 4:176852746-176852768 CTGAGGAAGAGAAAGGAGTGAGG + Intergenic
984429948 4:179636720-179636742 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
984528085 4:180881272-180881294 TTGAGAAAGAGAAAAGGGATGGG + Intergenic
985148853 4:186924446-186924468 CTGAGAGAGAGAGAGGGAGCAGG + Intergenic
985823758 5:2178387-2178409 CTGAGAAAGAGACGGAGGACCGG - Intergenic
986093419 5:4533529-4533551 CTGAGAAGGAGAAAGTTGGCTGG + Intergenic
986519128 5:8594935-8594957 CTGAAGAAGAGAAAGGGACCTGG - Intergenic
987072643 5:14352303-14352325 CTGAGAAACAGAAGCAGGTCTGG - Intronic
987147330 5:15005110-15005132 AAGCGAAACAGAAAGGGGTCTGG - Intergenic
987151585 5:15046135-15046157 TTGAGGAATAGCAAGGGGTCCGG + Intergenic
987266162 5:16257170-16257192 CTGAGGAAGAGGAAGGACTCTGG + Intergenic
988188293 5:27896963-27896985 CAGAGAAAGAGAAAGAGTTGTGG + Intergenic
988445445 5:31281313-31281335 GGGAGAAAGAGAAAGGGGGCTGG + Intronic
988618139 5:32794888-32794910 CCTGGAAAGAGCAAGGGGTCTGG + Intergenic
989193986 5:38698238-38698260 CAGAGAAATAGAAAGGGAACTGG + Intergenic
989442966 5:41493870-41493892 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
989787258 5:45346571-45346593 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
989948047 5:50262912-50262934 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
989968234 5:50489920-50489942 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
990164154 5:52976543-52976565 CTTAGGAAGTGCAAGGGGTCAGG - Intergenic
990368883 5:55096737-55096759 CTGGGGAAGTGCAAGGGGTCAGG + Intergenic
991156811 5:63446589-63446611 CAGAGAAAGAGAAAGTGAACTGG + Intergenic
991387479 5:66106133-66106155 CCAAGGAAGAGCAAGGGGTCGGG + Intergenic
992328949 5:75695895-75695917 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
992348199 5:75902022-75902044 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
992448084 5:76851508-76851530 ATGAGAGAGAGAGAGGGGCCAGG + Intronic
992576422 5:78118385-78118407 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
992717512 5:79525724-79525746 CTGAGAAGGAGAAAGGGGCTAGG + Intergenic
993449091 5:88052526-88052548 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
993826256 5:92690589-92690611 AAGAGAAAGAGAAAGGGGACAGG + Intergenic
993974992 5:94468494-94468516 ATGAGAAGGAGAAAGTGGTATGG - Intronic
994120657 5:96109033-96109055 CTCAGAAAGCGCAAGGGGTCAGG - Intergenic
994290366 5:98022793-98022815 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
994572181 5:101529100-101529122 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
994624178 5:102196874-102196896 CTCAGGAAGCGCAAGGGGTCGGG - Intergenic
995712593 5:115050354-115050376 CTGAGAAAGAGTAAGAGGAGGGG - Intergenic
995907301 5:117141108-117141130 CTGAGAGAGAGAAGGGTTTCGGG + Intergenic
996002678 5:118383165-118383187 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
996773427 5:127109036-127109058 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
996781960 5:127197322-127197344 CCCAGAAAGAGCAAGGGGTTGGG + Intergenic
997297776 5:132778307-132778329 CTGAGTAGGAGAAACAGGTCAGG - Intronic
998027445 5:138830566-138830588 CTTAGAATGATAAAAGGGTCTGG + Intronic
998076218 5:139238637-139238659 CTAAGAGAAAGAAAGGGGTCAGG + Intronic
998607922 5:143654741-143654763 AAGAGACAGAGAAAGGGGTGGGG - Intergenic
999033456 5:148320173-148320195 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
999087423 5:148905039-148905061 CTGAGACACAGAAAGGGGCAGGG - Intergenic
999116420 5:149168118-149168140 CTGGGCAAGAGATAGGGGTCAGG + Intronic
999195001 5:149775818-149775840 TGGAGAAAGAGAAGGGGGTAGGG - Intronic
999209079 5:149871947-149871969 GTGAGGAAGAGAGAGGTGTCAGG + Intronic
999232709 5:150070943-150070965 CTGAGAAAGAGACAAGAGGCAGG + Intronic
999605181 5:153306355-153306377 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
999623208 5:153492435-153492457 CAGAGGAGGAGAAAGGGGACAGG + Intronic
1000154390 5:158536325-158536347 ATGAGAACTAGAAATGGGTCTGG + Intergenic
1000203035 5:159030660-159030682 CTGGGAAAGAGAAAGAAGTCTGG + Intronic
1000291715 5:159877149-159877171 CTGAGAAGGCGAAAAGGGGCAGG - Intergenic
1000348719 5:160335878-160335900 GTTAAAAAGAGCAAGGGGTCTGG - Intronic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1001296256 5:170501346-170501368 CTGAGAAATAGTGAGGGGTCTGG + Intronic
1001344828 5:170884550-170884572 CTGAGGAAGAGAAAGAGGAGAGG + Intronic
1002201834 5:177533143-177533165 CTTAGAAAGTGAAAGGAGACTGG - Intronic
1002789132 6:424849-424871 CTGGGACAGAGGAAGGGGCCAGG + Intergenic
1003065432 6:2900964-2900986 CTGAGGAGGAGAATGGGGTCAGG + Intronic
1003296693 6:4836012-4836034 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
1003457899 6:6300551-6300573 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
1003571987 6:7261882-7261904 CTGGGAAGAAGAAAGGCGTCTGG - Intergenic
1004111547 6:12723504-12723526 TTGAGAGAGAGAGAGGGGTCTGG + Intronic
1005000588 6:21236549-21236571 CTCAAAAAGAAAAAGTGGTCTGG - Intergenic
1005164478 6:22903562-22903584 CTAAGAAAGAGAGAGAGATCAGG - Intergenic
1005468761 6:26141367-26141389 CTGAGAAAGTGAACATGGTCTGG + Intergenic
1005506600 6:26474600-26474622 CTGGCACAGAGAAAGGGGTGAGG + Intronic
1005639987 6:27786819-27786841 CTGAGAAGTGGAAAGGAGTCAGG - Intergenic
1005723012 6:28621427-28621449 CTGGGGAAGTGCAAGGGGTCAGG + Intergenic
1006110761 6:31743663-31743685 CTGAGAAAGATAAATGGCTGAGG - Intronic
1006882996 6:37355200-37355222 TTGAGAAGGAGAACTGGGTCAGG + Intronic
1007247180 6:40471075-40471097 CTGAGAAAGAAAAAGGGCTGAGG + Intronic
1007778129 6:44235262-44235284 CTGAGGACGAGAAAGAGCTCAGG - Intergenic
1008262720 6:49387077-49387099 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1008318116 6:50072091-50072113 CTGAGAAACTGCAAGGAGTCAGG + Intergenic
1008329638 6:50229253-50229275 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1008492057 6:52096885-52096907 CTCGGGAAGAGCAAGGGGTCAGG - Intergenic
1008641082 6:53463400-53463422 GGGAGAAAGAGAAAGGAGTAGGG + Intergenic
1008769457 6:54961619-54961641 CTCGGGAAGCGAAAGGGGTCAGG + Intergenic
1008859352 6:56130326-56130348 CTGAGAGAGAGAAAGAGGACTGG + Intronic
1008874165 6:56307652-56307674 CCCAGGAAGAGCAAGGGGTCAGG - Intronic
1008990684 6:57598420-57598442 CTGGGAAAGAGGTAGGGGTTAGG - Intronic
1009060610 6:58393996-58394018 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1009179258 6:60496967-60496989 CTGGGAAAGAGGTAGGGGTTAGG - Intergenic
1009230300 6:61053339-61053361 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1009341038 6:62555268-62555290 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1009834197 6:68976741-68976763 CTGAGAAGGAGAAAGAGGAGGGG + Intronic
1009998191 6:70920360-70920382 CCGAGGAAGTGCAAGGGGTCAGG - Intronic
1010033336 6:71291585-71291607 CTGAGCAGGTGAAAGGGGTCTGG + Intronic
1010296267 6:74200380-74200402 CTGAGAAGGATAAAGGGGTGAGG - Intergenic
1010678790 6:78775258-78775280 CTGTGAAAGACAAAGGGGACAGG + Intergenic
1010733840 6:79419615-79419637 CTGAGACACAGAAAGGTCTCAGG + Intergenic
1011244407 6:85307235-85307257 CTCGGGAAGTGAAAGGGGTCAGG + Intergenic
1011392799 6:86873024-86873046 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1011538651 6:88406691-88406713 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1011788725 6:90875085-90875107 CTCAGAAAGAGGAAGTAGTCAGG + Intergenic
1012285472 6:97382488-97382510 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1012334962 6:98044182-98044204 ATGAAAAAGAGAAAGGGGGAGGG + Intergenic
1012398725 6:98827684-98827706 CTGAGCAAGGGAAGGGGGGCCGG - Intergenic
1012582526 6:100886037-100886059 CTGAGAAAGCGAAATGTGTATGG - Intergenic
1012654172 6:101794144-101794166 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1014373640 6:120643430-120643452 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1014946382 6:127503622-127503644 TTGAGAAAGGGAATGGGGACAGG - Intronic
1014990021 6:128063123-128063145 GTGAGTAAGAGAAAGGACTCTGG - Intronic
1015769328 6:136752839-136752861 AGGGGAAAGAGAAAGGGGTCAGG + Intronic
1015972156 6:138753039-138753061 TTGAGAAAAAGCAAGGGGGCAGG - Intronic
1016299212 6:142611295-142611317 ATGAGAAAGAGAGAGCAGTCAGG + Intergenic
1016365186 6:143308140-143308162 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1017257519 6:152350543-152350565 ATGACAGAGAGAAAGGAGTCAGG + Intronic
1017402159 6:154077143-154077165 CTGAGAAACTGAAAGGGGGTGGG - Intronic
1017532222 6:155306709-155306731 CTGAGATAGATAAAGGGGGAAGG + Intronic
1017605798 6:156131470-156131492 CAGAGAAAGAGAAAGAGCTTGGG - Intergenic
1018013076 6:159689362-159689384 TTGAGAAGGAGTAAAGGGTCTGG - Intronic
1018403748 6:163454650-163454672 TTGAGAAAAAGGAAGGGGTAAGG - Intronic
1018690215 6:166338633-166338655 CTGAGGAGGAGAAAGAGGGCAGG + Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1018943386 6:168326752-168326774 CTGAGAAAGAGTTTGGGCTCAGG + Intergenic
1019413764 7:918215-918237 CTTAGAAACAAAAAAGGGTCGGG - Intronic
1019552565 7:1610456-1610478 ATGAGGCTGAGAAAGGGGTCAGG + Intergenic
1019795123 7:3043449-3043471 GTGAGAGAGAGAAGGGGGGCAGG + Intronic
1020117943 7:5486944-5486966 ACGAGAAAGAGAAAAGCGTCAGG + Intronic
1020487012 7:8732150-8732172 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1020922129 7:14279064-14279086 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
1021105096 7:16629139-16629161 GTGAGAAAGAGAAAAGAGCCAGG - Intronic
1022615560 7:31926670-31926692 CTGGGAAAGTGCAAGGAGTCAGG + Intronic
1022911857 7:34906435-34906457 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1023168492 7:37367030-37367052 CAGAGAAAGAGACAGAGGCCAGG - Intronic
1023528413 7:41129270-41129292 GAGAGAAAGAGAAAGAGGTTGGG - Intergenic
1023952420 7:44857154-44857176 CAGAGAAACAGAAAGCGGACTGG - Intergenic
1024134524 7:46392791-46392813 CTTAGAATGAGAGAGGGGACTGG - Intergenic
1024380862 7:48694858-48694880 CTCACAGAGAGAAAGGGGACTGG + Intergenic
1024490322 7:49975121-49975143 CTGTGAAAGTGGCAGGGGTCAGG + Intronic
1026549187 7:71352612-71352634 TTGAGAGAGAGATAGGGGTTGGG + Intronic
1026634783 7:72072074-72072096 CTGAGAAAGAGAAAAGGGTAGGG + Intronic
1027221661 7:76218039-76218061 CTCAGAAAGGAAAAGGGATCTGG + Intronic
1028526292 7:91790654-91790676 CCCAGAAAGAGCAAGGGGTTGGG + Intronic
1028630075 7:92925162-92925184 CCTGGGAAGAGAAAGGGGTCGGG - Intergenic
1028796166 7:94907281-94907303 CTGCCAAAGAGAAAGGGATGAGG - Intronic
1029413094 7:100427809-100427831 CTGAGAGAGAATAAGGGGTGAGG - Intronic
1029617006 7:101665404-101665426 CAGAGGAAGAGACAGGGGCCGGG - Intergenic
1030255831 7:107508090-107508112 CTCGGGAAGAGCAAGGGGTCAGG + Intronic
1030325933 7:108218192-108218214 CTCAGGAAGTGCAAGGGGTCGGG - Intronic
1030331767 7:108278694-108278716 CTGGGGAAGCGCAAGGGGTCAGG - Intronic
1030476204 7:110036071-110036093 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1030610985 7:111688491-111688513 CTGAGATAGGGAAGAGGGTCTGG + Intergenic
1030699136 7:112619643-112619665 AAGAGAAAGAGAAAGGAGACAGG - Intergenic
1030796793 7:113798714-113798736 CTGTGAAAGATAAAGGGGAAAGG + Intergenic
1030945955 7:115720592-115720614 CTTAGGAAGAGAAAGGGTTAAGG - Intergenic
1031082575 7:117272766-117272788 CTGAAAAAGAGAGAGTGGCCGGG - Intergenic
1031699014 7:124900709-124900731 CTGGGGAAGTGCAAGGGGTCGGG + Intronic
1031851684 7:126872378-126872400 CTGGGTAAGACAAAGAGGTCTGG - Intronic
1032098684 7:128954612-128954634 CTGAGAGAATGAACGGGGTCAGG + Exonic
1032118561 7:129138712-129138734 CAGAGAGACAGAAAGGGGGCAGG - Intergenic
1032661623 7:133990274-133990296 CTGAGAAATAAAAAGGGGTGGGG - Intronic
1032851158 7:135796732-135796754 ATTAGAAAGAGAAAGGACTCTGG + Intergenic
1032863923 7:135906977-135906999 CTGATAAAGAGTCAGGGGTCCGG - Intergenic
1032943110 7:136818344-136818366 CTGGGAAAGATCATGGGGTCAGG + Intergenic
1033253850 7:139782074-139782096 CTGAGACAATGAGAGGGGTCTGG + Intronic
1033510265 7:142053717-142053739 CAGAGTAAGTGAAAGTGGTCAGG + Intronic
1033830160 7:145241859-145241881 CTTGGAAAGTGCAAGGGGTCAGG - Intergenic
1034009052 7:147507844-147507866 ATAAGAAAGAGAAAGTGGCCAGG - Intronic
1034369277 7:150580403-150580425 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1034382100 7:150706434-150706456 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1034420964 7:150990491-150990513 CTGAGAAAGATAACAGGGACCGG + Intergenic
1034701182 7:153097837-153097859 CTGAGAGAGAGAGAGGGGAAGGG + Intergenic
1035085440 7:156253797-156253819 CTGAGAGAGAGAAAAGGGGAAGG - Intergenic
1035705729 8:1672960-1672982 CTGAGAAAATGAAAGTGGGCGGG - Intronic
1035792853 8:2323521-2323543 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1035799951 8:2398184-2398206 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1036448340 8:8842968-8842990 CTAAGAAAGCGAAAGAGGCCGGG + Intronic
1036598034 8:10231605-10231627 CTAAGAATGTGAAAAGGGTCGGG + Intronic
1036722576 8:11190474-11190496 CTGAGAAAGAGAATGGAGTGAGG + Intronic
1037158350 8:15734760-15734782 CAGAGACAGAGAAATGGGTAAGG + Intronic
1037274119 8:17159159-17159181 CTGTGAAAAGGAAAGGAGTCTGG - Intronic
1037548231 8:19944453-19944475 GAGAGAGAGAGAAAGGGGTGGGG + Intronic
1037886384 8:22598527-22598549 ATGAGAAAGAGGCAGGGGACCGG + Intronic
1038197308 8:25380203-25380225 CTGGGAATGAGCAAGTGGTCTGG - Intronic
1038638472 8:29305579-29305601 AAGAGCAAGCGAAAGGGGTCTGG - Intergenic
1039473943 8:37829587-37829609 CAGAGAAAGGGACAGGGGTCTGG - Intronic
1039558450 8:38494148-38494170 CTGAGGAAGAAAAATGGGCCAGG + Intergenic
1039707471 8:40022330-40022352 CCCAGGAAGAGCAAGGGGTCAGG - Intergenic
1040030055 8:42815639-42815661 GAGAGAAAGAGAAAGGGCCCAGG + Intergenic
1040062335 8:43114544-43114566 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1040794526 8:51274318-51274340 CAGAGAAAGAGAAAGAGACCTGG - Intergenic
1040989816 8:53337851-53337873 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1041022953 8:53657089-53657111 CTGACCAAGTGAGAGGGGTCGGG + Intergenic
1041197723 8:55417972-55417994 CTGAGAAAGAGACAGCGATTTGG + Intronic
1041203745 8:55476603-55476625 CTCAGGAAGTGCAAGGGGTCAGG + Intronic
1041279771 8:56198186-56198208 CTGAGACAGAGAAAGTGGGGTGG + Intronic
1041315465 8:56557514-56557536 CTGGGAAAAAGAAAGGGCACAGG + Intergenic
1041584033 8:59495352-59495374 CTGGGGAAGTGCAAGGGGTCGGG - Intergenic
1041951726 8:63510695-63510717 CTCGGGAAGAGCAAGGGGTCAGG - Intergenic
1042703094 8:71637937-71637959 AACAGAAAGAGAAAGGGGACAGG - Intergenic
1042970468 8:74402488-74402510 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1043007403 8:74836711-74836733 CTCAGAAAGAGTAAGTGGTCAGG + Intronic
1043272329 8:78350705-78350727 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1043981978 8:86653496-86653518 CTGAGAAATAGGCAGAGGTCAGG - Intronic
1044030484 8:87229058-87229080 CTGAGGAAGCACAAGGGGTCAGG - Intronic
1044381776 8:91542176-91542198 TTGAGGAAGAGCACGGGGTCAGG + Intergenic
1044816314 8:96116866-96116888 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1045371905 8:101532839-101532861 GAGAGAAAGAGAAAGAGGTGGGG + Intronic
1045489538 8:102657637-102657659 CTGAGGAAGGGACAGGGTTCTGG - Intergenic
1045658409 8:104410799-104410821 TGGAGAATGAGAGAGGGGTCAGG - Intronic
1045867082 8:106879809-106879831 ATGAGAAAAAGATAGGGGTTTGG + Intergenic
1045889234 8:107134796-107134818 CTGATAAAGAGAAACTGGGCCGG - Intergenic
1046422732 8:114006101-114006123 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1046585261 8:116142619-116142641 CTGGGCTAGGGAAAGGGGTCTGG + Intergenic
1046829048 8:118723655-118723677 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1046879455 8:119292230-119292252 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1047046303 8:121056619-121056641 CTCAGGAAGAGCAAGGGGTCAGG - Intergenic
1047151497 8:122268671-122268693 CTGGCAAAGAGAAAGGCATCTGG - Intergenic
1047247859 8:123160465-123160487 AAGAGAGAGAGAAAGGGGGCAGG + Intergenic
1048091911 8:131250537-131250559 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048391879 8:133974608-133974630 CTGAGGAAAAGAGAGGAGTCAGG - Intergenic
1048664018 8:136641041-136641063 AAGAGAAAGAGAAAGGCATCAGG + Intergenic
1048785738 8:138048368-138048390 CTCGGAAAGTGCAAGGGGTCAGG - Intergenic
1048947970 8:139467906-139467928 CTGAGGAAGAGAAAGAGGGCTGG - Intergenic
1049611793 8:143559309-143559331 CTGAGGAGGGGAAATGGGTCAGG - Intronic
1050071972 9:1824662-1824684 CTGAGAAAAACAAAGGAGTTTGG - Intergenic
1050326290 9:4501065-4501087 CTGAGACTAAGAAAGGGCTCGGG - Intronic
1050512032 9:6406362-6406384 CAGAGAGAGAGACGGGGGTCGGG + Intergenic
1051532969 9:18125882-18125904 CTGAGAAAGGGCAGGGGCTCTGG + Intergenic
1051579000 9:18650325-18650347 CTCAGGAAGTGCAAGGGGTCAGG - Intronic
1051768634 9:20551365-20551387 GTGAGAAAGAGGATGGGGTGGGG - Intronic
1051784339 9:20725425-20725447 CTGAGAAAGAGAGAGGGGGGTGG + Intronic
1051903479 9:22068108-22068130 CTGAGAAAGAGAAAAAAGTGAGG - Intergenic
1052239053 9:26249967-26249989 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1052434633 9:28410159-28410181 CAGAGAAAGAGAAAGAGGAAAGG + Intronic
1053157719 9:35792061-35792083 CTGAGAAGGAAAAGGGGATCTGG - Intergenic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053461074 9:38272032-38272054 CTGTGAAGGAGAAAGGGTGCTGG - Intergenic
1053717968 9:40915981-40916003 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1054425396 9:65062189-65062211 CTTGGGAAGAGCAAGGGGTCAGG + Intergenic
1054866952 9:70012733-70012755 CAGAGAAGGAGAAAGGGGGAGGG - Intergenic
1055422920 9:76162619-76162641 CTGAAAAAAAGACAAGGGTCTGG - Intronic
1055827507 9:80345075-80345097 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1055843325 9:80531706-80531728 CACAGAAAGAAAAAGTGGTCTGG - Intergenic
1056164135 9:83925316-83925338 CTGAGAAAAAAAAAGGGGGAGGG + Intergenic
1056484490 9:87042071-87042093 CTCGGGAAGAGCAAGGGGTCAGG + Intergenic
1057211603 9:93203709-93203731 CTGAGACAGAGAAGGGGATGTGG + Intronic
1057674552 9:97128642-97128664 GTGAGAAAGAGCAAGAGGCCAGG - Intergenic
1057711363 9:97448395-97448417 CTGAGAAAGAGATAGGGAAATGG - Intronic
1058036566 9:100259352-100259374 CCCAGAAAGTGCAAGGGGTCGGG - Intronic
1058051435 9:100410854-100410876 CAGAGAAAGAGAAAAGGGAGTGG - Intergenic
1058490677 9:105495434-105495456 CTCGGGAAGAGCAAGGGGTCAGG - Intronic
1058601860 9:106679058-106679080 GTGAGAGAGAGAAAGGAGGCTGG - Intergenic
1058826508 9:108779760-108779782 CAGAGAAAGAGAACTGAGTCAGG + Intergenic
1058896466 9:109404955-109404977 CTGAGAAAGAAAGGGGAGTCGGG - Intronic
1059450770 9:114370367-114370389 CTGAGGCTGAGAGAGGGGTCTGG - Intronic
1059710331 9:116862153-116862175 CTGAGAAACAGACAAAGGTCAGG - Intronic
1059741203 9:117151699-117151721 ATGAGCAAGAGAAAGGGGCAAGG + Intronic
1059949127 9:119443441-119443463 AAGAAAAAGAGAAAGGGGCCAGG + Intergenic
1060276514 9:122186834-122186856 CTGAGAAAGAGAGTAGGCTCCGG - Intronic
1060290705 9:122299999-122300021 CTGGGAAAGACAAAGGGGAGAGG + Intronic
1060306205 9:122414555-122414577 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1060552033 9:124490246-124490268 CTGAGACAGAGAGATGGGTGTGG - Intronic
1061276124 9:129570167-129570189 CAGAGAGAGAGAGAGGGGTGGGG + Intergenic
1061411732 9:130425626-130425648 GGGAGAGGGAGAAAGGGGTCAGG - Intronic
1061751872 9:132784149-132784171 AAGAGAAAGAGAAGGGGGTAGGG + Intronic
1062416696 9:136454809-136454831 CTGAGTAAGAGAAAGCGCTAAGG + Intronic
1062485423 9:136772406-136772428 CAGAGAAAGAGAAGGTGGTTAGG + Intergenic
1203443652 Un_GL000219v1:34296-34318 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1203485449 Un_GL000224v1:49304-49326 CTGAGAAAGAGAATGGGAAAGGG - Intergenic
1203374231 Un_KI270442v1:349651-349673 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1203394770 Un_KI270512v1:15240-15262 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1203408051 Un_KI270538v1:66129-66151 CTGAGTCAAAGAAAGGGGTGAGG + Intergenic
1203514460 Un_KI270741v1:153205-153227 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1186866400 X:13724806-13724828 CCCAGAAAGTGCAAGGGGTCGGG + Intronic
1188219830 X:27527453-27527475 CTCAGGAAGCAAAAGGGGTCAGG - Intergenic
1189007699 X:37011818-37011840 CTTAGAAAGAGAAATGGGGTCGG + Intergenic
1189049987 X:37634375-37634397 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1189348930 X:40262782-40262804 CTGACAAAGAGCAAGGTCTCTGG + Intergenic
1189536744 X:41943139-41943161 CTGAGATGGGTAAAGGGGTCTGG - Intergenic
1189751987 X:44231536-44231558 CTGAGAAGGATAAAGGGGGAGGG - Intronic
1190287069 X:48968756-48968778 CTCAAAAAGAGAAAGAGGCCAGG + Intronic
1190536482 X:51433381-51433403 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1190606756 X:52151063-52151085 CCCAGAAAGTGCAAGGGGTCAGG - Intergenic
1191266225 X:58397017-58397039 CTTGGGAAGAGCAAGGGGTCAGG - Intergenic
1191640350 X:63424782-63424804 CAGAGAAAAAGAAGGGGGACAGG - Intergenic
1191840312 X:65509079-65509101 CTGAGTACGGGATAGGGGTCTGG + Intergenic
1191960252 X:66692918-66692940 CTTGGGAAGAGCAAGGGGTCAGG - Intergenic
1191998605 X:67123957-67123979 CAGAGGAAGAGAAAGCGGTTAGG - Intergenic
1192569643 X:72192293-72192315 TTGAAAAGGAGAAAGGGCTCTGG - Intronic
1192719755 X:73680621-73680643 CTAACAAAGAGATAGGGGTGTGG + Intronic
1192825667 X:74693273-74693295 CCGGGGAAGTGAAAGGGGTCAGG - Intergenic
1192850734 X:74953449-74953471 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1193426434 X:81345689-81345711 CTAAGGAAGTGCAAGGGGTCAGG - Intergenic
1193544410 X:82808727-82808749 CTCAGGAAGGGCAAGGGGTCAGG - Intergenic
1193646706 X:84079195-84079217 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
1193761839 X:85476536-85476558 GAAAGAAAGACAAAGGGGTCTGG + Intergenic
1193773890 X:85620226-85620248 CTGATAATGAGTAGGGGGTCAGG - Intergenic
1193792319 X:85830360-85830382 CTGAGAGCAGGAAAGGGGTCAGG - Intergenic
1193870452 X:86791106-86791128 CTGAGAAGGAGGAAGAGGACTGG + Intronic
1194079435 X:89440497-89440519 CTGAGAAGGAGAAAGCAGTTGGG + Intergenic
1194271875 X:91825484-91825506 CTTGGAAAGTGCAAGGGGTCAGG - Intronic
1194411476 X:93563773-93563795 CTGAGACAGTGAAAGAGATCTGG + Intergenic
1194629773 X:96269583-96269605 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1194736212 X:97515319-97515341 CTCAGGAAGCGCAAGGGGTCAGG - Intronic
1194803535 X:98300537-98300559 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1194962843 X:100255677-100255699 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1195104092 X:101585973-101585995 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1195233737 X:102877108-102877130 CTCAGGAAGCGCAAGGGGTCGGG - Intergenic
1195418417 X:104645555-104645577 ATGAGAAAGACAAAGGTGTCTGG - Intronic
1195421274 X:104677905-104677927 CTGGGGAAGCGCAAGGGGTCAGG - Intronic
1195983620 X:110606025-110606047 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1196481863 X:116159394-116159416 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1197080421 X:122406601-122406623 CTGAGAAATAAAAAGAGGGCTGG - Intergenic
1197174644 X:123472549-123472571 CTGACAGAGAGAAGGGGCTCAGG - Intronic
1197193668 X:123676788-123676810 CTTTGGAAGAGAAAGGGTTCAGG - Intronic
1197306189 X:124844850-124844872 TTGAGAAACAGTAGGGGGTCAGG - Intronic
1197619561 X:128732934-128732956 CTCAGGAAGCGCAAGGGGTCAGG + Intergenic
1197917569 X:131552883-131552905 CTCAGGAAGTGGAAGGGGTCAGG + Intergenic
1198080773 X:133237104-133237126 CTGAGACACATAAATGGGTCTGG - Intergenic
1198140866 X:133801956-133801978 CTGAGAAACAGAAATGGGCCTGG + Intronic
1198216873 X:134563570-134563592 CAGAGAAAGTGCAAGTGGTCTGG - Intergenic
1198313161 X:135439028-135439050 GTGGGAAAGAGGAAGGGGACGGG + Intergenic
1198620152 X:138499080-138499102 GAGAGAAAGAGAAAGAGGTGGGG + Intergenic
1199517396 X:148693396-148693418 CTCAGAAAGAGGCAGGGATCTGG + Intronic
1199906916 X:152241813-152241835 CTTGGGAAGAGCAAGGGGTCAGG - Intronic
1200056346 X:153463403-153463425 CTGAGAGGAAGAGAGGGGTCAGG - Intronic
1200150520 X:153949201-153949223 GAGAGAAAGAGAAAGGGGAGAGG + Exonic
1200331757 X:155305383-155305405 CTTGGGAAGAGCAAGGGGTCAGG - Intronic
1200357573 X:155568043-155568065 CTCAGGAAGCGCAAGGGGTCAGG + Intronic
1200432053 Y:3095802-3095824 CTGAGAAGGAGAAAGCAGTTGGG + Intergenic
1200589125 Y:5046921-5046943 CTCGGAAAGCGCAAGGGGTCAGG - Intronic
1200755069 Y:6983448-6983470 CTAAGAAAGGAAAAGGGATCAGG + Intronic
1201053764 Y:9967539-9967561 CTCAGGAAGCGCAAGGGGTCAGG - Intergenic
1201229233 Y:11847071-11847093 CAGAGAAAGAGAGAAAGGTCAGG + Intergenic
1201415654 Y:13746525-13746547 CTTGGAAAGCGCAAGGGGTCAGG - Intergenic
1201476886 Y:14391836-14391858 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic
1201511475 Y:14769433-14769455 CCTGGGAAGAGAAAGGGGTCAGG + Intronic
1201519835 Y:14861292-14861314 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1201702720 Y:16901969-16901991 CTCAGGAAGTGCAAGGGGTCAGG + Intergenic
1201981131 Y:19911449-19911471 CTGGGAAAGAGAAGGGGTTGGGG - Intergenic
1201992618 Y:20043661-20043683 CTCAGGAAGTGCAAGGGGTCAGG - Intergenic