ID: 1096396342

View in Genome Browser
Species Human (GRCh38)
Location 12:51269668-51269690
Sequence CTCCTAGCTGTGGAACCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096396342_1096396347 7 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396347 12:51269698-51269720 GACGCCATCCACCAGGTGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 74
1096396342_1096396349 12 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396349 12:51269703-51269725 CATCCACCAGGTGTCAGGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 238
1096396342_1096396354 18 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396354 12:51269709-51269731 CCAGGTGTCAGGAGAGGGCCGGG 0: 1
1: 0
2: 7
3: 63
4: 597
1096396342_1096396350 13 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396350 12:51269704-51269726 ATCCACCAGGTGTCAGGAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1096396342_1096396355 22 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396355 12:51269713-51269735 GTGTCAGGAGAGGGCCGGGAAGG 0: 1
1: 0
2: 1
3: 36
4: 445
1096396342_1096396352 17 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396352 12:51269708-51269730 ACCAGGTGTCAGGAGAGGGCCGG 0: 1
1: 0
2: 4
3: 45
4: 402
1096396342_1096396356 27 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396356 12:51269718-51269740 AGGAGAGGGCCGGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 65
4: 568
1096396342_1096396346 0 Left 1096396342 12:51269668-51269690 CCCTAGGGTTCCACAGCTAGGAG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1096396346 12:51269691-51269713 TTCTGGTGACGCCATCCACCAGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096396342 Original CRISPR CTCCTAGCTGTGGAACCCTA GGG (reversed) Intronic
900909762 1:5586787-5586809 CTCCAAGCTGTGAAACCAAATGG + Intergenic
901144729 1:7057225-7057247 CTCCAAGCTGAGAAACCCAAAGG - Intronic
902203514 1:14851321-14851343 CCCCTAGCTGTGGGACACGAAGG - Intronic
902623051 1:17661536-17661558 AGCCTCGCTGTGGAAGCCTAGGG - Intronic
904912315 1:33944596-33944618 CTACTAGCTGTGTGACCCTTCGG - Intronic
905278193 1:36832756-36832778 CTCCAACCTGGGGACCCCTATGG - Intronic
905476064 1:38229053-38229075 CTCCTGGGTGTGGCACCCTGTGG + Intergenic
906986135 1:50685622-50685644 CTCCTGGCTGTGCAACACAATGG - Intronic
908824063 1:68116503-68116525 TTCCTAGCTGTGTGACCTTAGGG + Intronic
916223927 1:162471212-162471234 CTACTAACTGTGTAACCTTAAGG - Intergenic
921157373 1:212449154-212449176 CTCCCAGCTGTGGGGCTCTAGGG + Intergenic
923301607 1:232645958-232645980 CTCCTAGCTTGGGAACACTTTGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068269954 10:54708723-54708745 CTCCTAATTGTGCAACCTTAAGG + Intronic
1069824349 10:71246107-71246129 CTCCCGCCTGTGGAAGCCTAAGG + Intronic
1069835067 10:71303048-71303070 CTCCTTGCTGTGTGACTCTAGGG - Intergenic
1071963083 10:90824953-90824975 CTGCTGGCTGTAGAGCCCTAGGG + Intronic
1073065205 10:100754522-100754544 CTCCTAGCAGTGGCAACCCAGGG + Intronic
1073304029 10:102488702-102488724 ATCCTGGCTGGGGTACCCTAGGG - Intronic
1073458416 10:103651576-103651598 CTCCCAGCTGTGCAACCTTGGGG + Intronic
1075729502 10:124627817-124627839 CTCCAAGCTGGGAAGCCCTAGGG - Intronic
1076346374 10:129781463-129781485 TTCCTAGCTGTGGGACCCTCAGG + Intergenic
1080128557 11:28766537-28766559 CTGCTGGCTGTAGAACCCTTAGG + Intergenic
1080975461 11:37334401-37334423 ATCCTGTCTGTGGAACCCTCTGG - Intergenic
1081073831 11:38643204-38643226 CTCCTGGCAGTGGCACCATAAGG - Intergenic
1083063504 11:59898991-59899013 CACCAAGTTGTGGAACCCAAAGG - Intergenic
1093176883 12:15922764-15922786 CATCTAGCTGTGGAACCTTGCGG + Intronic
1095169784 12:39020344-39020366 CTGCTAACTGTAGAACCCTAGGG + Intergenic
1096396342 12:51269668-51269690 CTCCTAGCTGTGGAACCCTAGGG - Intronic
1100232550 12:92623028-92623050 CTCCTTGCTGTGTCACCCCATGG - Intergenic
1100901360 12:99244519-99244541 CTCTTAACTGTGGAACACTGTGG - Intronic
1101239143 12:102820722-102820744 CTCCTAGCTGGGTAACCTTGGGG - Intergenic
1102960245 12:117088041-117088063 CTCCTAGCTGTGTGACCTTCAGG - Intronic
1103877008 12:124135503-124135525 CTTCTAGTTGTGAAAACCTAAGG + Intronic
1105718237 13:23088578-23088600 CTCCTAGCTGTGAAATTCAATGG - Intergenic
1107646445 13:42498973-42498995 CTCCTGGGTGTGTGACCCTATGG + Intergenic
1109303893 13:60618099-60618121 CTCCTAGCTCTGCTACCCTTGGG + Intergenic
1109979602 13:69889707-69889729 TTACTAGCTGTGGAACATTAAGG + Intronic
1113769139 13:112897452-112897474 GTCCCTGCTGTGGAACCCCATGG - Intronic
1115250610 14:31342601-31342623 CTCCTAGCTGTGCACCTTTAGGG - Intronic
1119966826 14:78925819-78925841 TTCCTAGCTGTGTGACCTTAAGG + Intronic
1126112400 15:45183468-45183490 CTCCAAGTTGTGAAGCCCTAAGG + Intronic
1127695068 15:61437767-61437789 CTCCTAGCTTTGGGCCCCTCAGG - Intergenic
1130923830 15:88370527-88370549 TTCCTAGCTGTGTGACCTTAGGG - Intergenic
1131099601 15:89677673-89677695 CTCATTGCTATGGGACCCTAAGG - Intronic
1132171436 15:99660531-99660553 GTCCTATATGTGGAACCATAAGG + Intronic
1138903690 16:61304626-61304648 CTCCTAGCTGTGGGAACATATGG - Intergenic
1139931343 16:70529160-70529182 TTCTTAGCTGTGGATCCCAAAGG + Exonic
1141875978 16:86824862-86824884 CTTCTAGCTGGGGAACCCGGTGG - Intergenic
1144648798 17:16993269-16993291 CTCCTAGCTGTGTATCCCAAAGG - Intergenic
1146257071 17:31397760-31397782 GTCCTAGCTGGGGCACCCTCTGG + Intronic
1146298767 17:31672075-31672097 CTCAGAGCTGAGGGACCCTAGGG - Intergenic
1146515681 17:33487381-33487403 CTCTTAACTGTGCAACCTTAAGG - Intronic
1146527901 17:33582490-33582512 CTGCTAGCTGTGTGACCCTTGGG + Intronic
1146888875 17:36491880-36491902 TTACTAGCTGTGGACCCCAATGG + Intronic
1150447875 17:65241676-65241698 CTGTAAGCTGTGGAACCCCAGGG + Intergenic
1151140306 17:71985377-71985399 CTCCTTGCTGTGAGAACCTAAGG - Intergenic
1152162819 17:78679680-78679702 TTCTTAGCTGTGGAACCCTGAGG + Intronic
1153355645 18:4132443-4132465 TTTCTAGCTGTGTGACCCTAGGG + Intronic
1153425822 18:4961674-4961696 CTCCTGGTTGTAGAACCCCACGG + Intergenic
1154178501 18:12108285-12108307 CTCCTGGCTGGGGAAGCCTCAGG + Intronic
1161040236 19:2106814-2106836 CTCCTAGGAGTGGAACCACACGG - Intronic
1161222609 19:3124632-3124654 CTCCTAGGAGTGGAACCATGCGG + Intergenic
1163673646 19:18644401-18644423 CTCCTAGATGTGTACCCCAAAGG - Intronic
1165746724 19:38233944-38233966 CTCCTAACCCTGGAACCCAAGGG + Intergenic
1166733863 19:45073208-45073230 TTCCAAGCTGTGCAACCCTGGGG - Intronic
927171626 2:20375247-20375269 CTGGTTGCTGTGGAACCGTATGG - Intergenic
927186195 2:20484272-20484294 CTACTATCTGTGGAACCCAAGGG - Intergenic
928398835 2:30963711-30963733 TTCCTAGCTGTGTGACCCTGGGG - Intronic
930232885 2:48860535-48860557 CTCCTTGCTGTGGGACTCTCAGG + Intergenic
930887236 2:56340321-56340343 ATCCTAACTGTGGATCCTTAGGG + Intronic
934654454 2:96109996-96110018 CCCCAAGCTGGGGAACCCTGGGG + Intergenic
934740284 2:96715845-96715867 CTTATAGCTGTGTAACCCTTCGG + Intronic
935155744 2:100482185-100482207 CTTCTCTCTGTTGAACCCTAAGG - Intronic
945180631 2:207087531-207087553 CTGCAAGCTGGGGAACCCTGAGG + Intronic
945742324 2:213678747-213678769 CTGCTATCTGTGGAAGCCCAAGG + Intronic
946855511 2:223945871-223945893 CTCATAGCTGTGCAACCTTAAGG - Intergenic
947729928 2:232422062-232422084 CTCATAGCTGGGGAGCCCTCAGG - Intergenic
1169395476 20:5225183-5225205 CTACAAGCTGAGGAACACTAAGG + Intergenic
1169700338 20:8439087-8439109 ATCCTACCTGTGTATCCCTAGGG + Intronic
1172715225 20:36958176-36958198 CCTCTAGATGTGGAGCCCTAAGG - Intergenic
1173204129 20:40979463-40979485 CTCCTGATTGTAGAACCCTAGGG - Intergenic
1174713462 20:52731405-52731427 CTCCCAGCTGTGGGGCCCTCAGG + Intergenic
1175432188 20:58913237-58913259 CACCTGGCTGTGGAATCCCATGG - Intergenic
1175436894 20:58959133-58959155 CTACTAGCTGTGGAAATCTGCGG + Intergenic
1177049976 21:16220853-16220875 CTCCTAATTGTGACACCCTATGG - Intergenic
1178148162 21:29763572-29763594 CTCCTGGCTCTGATACCCTAAGG - Intronic
1178662942 21:34522123-34522145 CTGCTGGGTGGGGAACCCTAGGG - Intronic
1183271923 22:36867632-36867654 CTCCTATCTCTGGAACCCTAAGG - Intronic
1184838248 22:47036745-47036767 CGCCTATCTGTGGAGCCCCACGG + Intronic
951772076 3:26269650-26269672 TTCCCAGCTGTGGAACCATAGGG - Intergenic
959547353 3:107612770-107612792 CTGCTGACTGTGGAGCCCTAGGG - Intronic
963106374 3:141650945-141650967 CTCTTAGGTGTGGAGCCCCAAGG - Intergenic
967358428 3:188600780-188600802 CTCCTATATGTAGAACCATATGG + Intronic
968764062 4:2459014-2459036 GTCCTGGCTGGGGAACCCTGGGG + Intronic
980318732 4:131239991-131240013 CTCCTGGCTGGGGAAGCCTCAGG - Intergenic
986189459 5:5481002-5481024 ATTCTAGCTGTGGAGCGCTAGGG + Intronic
986215156 5:5712897-5712919 CTCCTTGCTGGGGACCCCAAGGG + Intergenic
986243405 5:5981826-5981848 CTCCTAGCTGTGGACACCCATGG - Intergenic
987004358 5:13694506-13694528 CTCCTCCTTCTGGAACCCTAAGG - Intronic
988413654 5:30918201-30918223 CTCCAAACTCTGGAAGCCTAGGG - Intergenic
990933031 5:61114937-61114959 CTGCTCACTGTGGAGCCCTAGGG - Intronic
992189408 5:74276396-74276418 CTCCTATCTGTGTGACCCTAAGG + Intergenic
995218127 5:109618472-109618494 CTCACTCCTGTGGAACCCTATGG - Intergenic
996631526 5:125638904-125638926 CTCCTAGCTCTGGAAGCAGAGGG + Intergenic
1000911007 5:167021812-167021834 GTACTAGCTGTGTTACCCTAGGG + Intergenic
1003149498 6:3536945-3536967 CTGCTAGCTGAGGGACCTTAAGG + Intergenic
1006671600 6:35732713-35732735 CAACTACCTGTGGAATCCTAAGG - Intergenic
1009371255 6:62905847-62905869 CTGCTAATTGTAGAACCCTAGGG + Intergenic
1017051515 6:150398158-150398180 CTCCTTGCTGGGGTACCCCACGG - Exonic
1029957277 7:104653063-104653085 CTCCTATCTGGGAAACCTTAAGG - Intronic
1031612801 7:123846570-123846592 CTCCTAGCTGTGAAAGCAAACGG + Intronic
1031993849 7:128215785-128215807 CTCTAAGCTGTGTAAACCTAGGG + Intergenic
1032476383 7:132214178-132214200 CTCGGAGCTGTGAAACCCTCCGG + Intronic
1034456689 7:151174542-151174564 CTCCTCGCTGTGGAAACCCCAGG - Intronic
1034982033 7:155485236-155485258 CTCCTAGCTGTGTGCCCCTGGGG + Intronic
1036964529 8:13281230-13281252 CTTCTACATTTGGAACCCTAAGG + Intronic
1037589597 8:20302081-20302103 CTATTAGCTGTGGGACCTTAGGG + Intronic
1039442767 8:37606837-37606859 TTACTAGCTGTGCAACCTTAGGG - Intergenic
1040680872 8:49807138-49807160 CTCCTAGCTGTGGTAACTTGGGG - Intergenic
1041095859 8:54349057-54349079 CTGCTAGCTGTGGAACTTTGGGG + Intergenic
1041209116 8:55529616-55529638 TTCCTAGCTGTGGGACCTTTGGG - Exonic
1042574910 8:70206985-70207007 CAACTAGCTGTGGAACTGTAGGG - Intronic
1046114072 8:109764755-109764777 CTGCTAATTGTGGAGCCCTAAGG - Intergenic
1047564677 8:126031004-126031026 CTCCTTGATGTGGAATCCTTGGG - Intergenic
1052944870 9:34160253-34160275 AGCCTTACTGTGGAACCCTAGGG + Intergenic
1053107742 9:35426661-35426683 GTCCTAGCTATGGAACTCAAGGG - Intergenic
1054751599 9:68912709-68912731 CTCCTTGCTCTGGAACCAGATGG - Intronic
1055502475 9:76915410-76915432 CTCCTTCCTGTGGAACCATAAGG + Intergenic
1058558475 9:106197760-106197782 CTTCTAGCTGTGTAACACTTTGG + Intergenic
1059926292 9:119212526-119212548 TTACTAACTGTGCAACCCTAGGG + Intronic
1062013635 9:134280432-134280454 CACCTAGCCATGGAACCCTTGGG - Intergenic
1062450564 9:136614094-136614116 CTCGGAGCTGTGGGACCCCAGGG + Intergenic
1189593935 X:42544092-42544114 CTCCTGATTGTGGAGCCCTAGGG + Intergenic
1190462909 X:50696391-50696413 TTCCTAGCTGTGTGACCCTTAGG + Intronic
1191030648 X:55966231-55966253 CTGCTAATTGTGGAGCCCTAGGG + Intergenic
1191052655 X:56211555-56211577 CTGCTAACTGTAGAGCCCTAGGG - Intergenic
1192170336 X:68850945-68850967 CTTCAAGCTGTGGTCCCCTAGGG + Intergenic
1193047184 X:77065853-77065875 CTTCTAGTTTTGGAACCCTGAGG - Intergenic
1193282977 X:79676990-79677012 CTCCCAGCAGTGGAACCTCAAGG + Intergenic
1193409103 X:81141281-81141303 CTGCTGACTGTAGAACCCTAGGG + Intronic
1193455315 X:81724677-81724699 CTGCTAACTGAAGAACCCTAGGG + Intergenic
1193795453 X:85867351-85867373 CTCATAGCTGGGGAGGCCTAAGG - Intronic
1195122857 X:101774592-101774614 CTGCTAACTGTGGAGCCCCAGGG - Intergenic
1195486714 X:105416913-105416935 CGCCTAGGTGTGGGACCCGAAGG - Intronic
1196022161 X:111001769-111001791 CTACCAGCTGAGGAACCCTTAGG - Intronic
1198369010 X:135973551-135973573 CGCTTCGGTGTGGAACCCTAGGG - Intronic
1200773944 Y:7152900-7152922 CTCCTAACTCTGAAAGCCTACGG + Intergenic