ID: 1096396395

View in Genome Browser
Species Human (GRCh38)
Location 12:51269861-51269883
Sequence CGGCGAAAGCAGGCCCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096396395_1096396406 18 Left 1096396395 12:51269861-51269883 CCCCTCCGGGCCTGCTTTCGCCG 0: 1
1: 0
2: 2
3: 1
4: 97
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396395_1096396407 19 Left 1096396395 12:51269861-51269883 CCCCTCCGGGCCTGCTTTCGCCG 0: 1
1: 0
2: 2
3: 1
4: 97
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096396395 Original CRISPR CGGCGAAAGCAGGCCCGGAG GGG (reversed) Intronic
901238042 1:7678100-7678122 CCGCGGAAACAGGCCTGGAGGGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG + Intergenic
907834232 1:58093865-58093887 AGGGGCAAGCAGGCCAGGAGAGG - Intronic
908826916 1:68141959-68141981 CTGCGACAGTCGGCCCGGAGTGG - Intronic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
923659271 1:235944551-235944573 GAGCAAAAGGAGGCCCGGAGAGG + Intergenic
924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG + Exonic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1069844254 10:71359713-71359735 AGGAGGAAGCAGGCCCAGAGAGG + Intronic
1070596914 10:77838816-77838838 CGGCAAGAGCAGACCAGGAGGGG - Intronic
1072706957 10:97687551-97687573 CGGCGAAAGCTGGCCCTGCCGGG + Intergenic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077410387 11:2401150-2401172 CGGCGAAAGCCGGCAACGAGTGG - Intronic
1078920494 11:15826162-15826184 AGGAGAGAGCAGGCCTGGAGAGG - Intergenic
1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG + Intergenic
1083656165 11:64230714-64230736 AGACTGAAGCAGGCCCGGAGAGG - Exonic
1083674697 11:64318897-64318919 AGGGGAAATCAGGCCGGGAGTGG - Intronic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG + Intergenic
1106504005 13:30355684-30355706 GGGAGAAAGGAGGCCAGGAGAGG - Intergenic
1113379039 13:109786420-109786442 CGGCGGCAGCAGCCCCGGTGCGG - Exonic
1117546493 14:56798096-56798118 CGGCGAAAGCAAGCCCAGCAGGG - Intergenic
1122938137 14:104969338-104969360 GGGCTAGAGCAGGCACGGAGAGG - Intronic
1127449821 15:59105453-59105475 CGGGGAAAGGCGGGCCGGAGAGG - Intronic
1129710756 15:77819300-77819322 CGGGGGATGCCGGCCCGGAGCGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132143998 15:99416163-99416185 CAGAGAAAGCAGGCCTGGAATGG + Intergenic
1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG + Intronic
1136016864 16:27406046-27406068 TGGGGAAAGGAGGCCCAGAGAGG - Intronic
1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG + Intergenic
1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG + Intronic
1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG + Intronic
1145390887 17:22454598-22454620 CGGCGCAAGCAGCCGCGGATCGG + Intergenic
1146275048 17:31511257-31511279 CGGCAAAAGGAGGCGCGGGGTGG - Intronic
1147386202 17:40083826-40083848 CGGCGAAAGAAGCCCTGGGGTGG - Exonic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1147970901 17:44218869-44218891 CGGCGAAGGGAGCCCGGGAGGGG - Intronic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1151453396 17:74212700-74212722 TGCCGAACGCAGGCCAGGAGGGG - Intergenic
1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG + Intronic
1152835600 17:82528690-82528712 CGAGGAAAGCAGGGCCGCAGGGG - Intronic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1162808274 19:13150202-13150224 CCGCGAACCCAGGCCGGGAGGGG - Exonic
1165454073 19:35900644-35900666 CGGCGAACGCAGTCCCTGAATGG + Exonic
1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG + Intronic
1165901929 19:39173250-39173272 TGCCGACATCAGGCCCGGAGAGG - Exonic
1167056191 19:47112761-47112783 CGGAGAAAGCAGGCGGCGAGCGG - Intronic
1167464377 19:49642389-49642411 CGGCGAAACCTGGCGCCGAGAGG + Intronic
926726089 2:15999104-15999126 CTGCAAAAACAGGCTCGGAGGGG - Intergenic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
941563463 2:167078544-167078566 CGGCAAAAACTGGCCGGGAGTGG + Intronic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
943734436 2:191339073-191339095 ATGAGAAAGCAGGCCTGGAGGGG + Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG + Intergenic
1169092560 20:2870656-2870678 AGGGGAAAGGAGGCCCCGAGAGG + Intronic
1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG + Exonic
1173865950 20:46312751-46312773 CGGAGAAAGCGGGCTCGCAGAGG - Intergenic
1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG + Intergenic
1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG + Intergenic
1180064849 21:45407040-45407062 AAGCGGAAGCAGGCCCAGAGAGG + Intronic
1181669560 22:24419827-24419849 ATGTGAAAGCAGGCCCTGAGGGG - Intronic
1181670968 22:24425265-24425287 CGGCCAAAGCAGGGCCAGTGAGG - Intronic
1182279767 22:29211171-29211193 AGACCAAAGCAGGCCCAGAGGGG - Intronic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
960426937 3:117520374-117520396 CAGCTAAAGCAGTCCTGGAGTGG + Intergenic
961764678 3:129200214-129200236 AGGTGAAAGCAGGCACGGGGTGG - Intergenic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG + Intergenic
998168174 5:139856276-139856298 CAGAGATAGCAGGCCTGGAGGGG - Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
1005510635 6:26508956-26508978 AGGCAAAAGAAGGGCCGGAGGGG - Exonic
1006256405 6:32835874-32835896 AGGGGAAAGCATGCCAGGAGGGG + Intronic
1009176592 6:60467484-60467506 GGGGGAAAACAGGCCCAGAGAGG - Intergenic
1012895484 6:104941422-104941444 CGGCCAAAGCCGGCTTGGAGCGG + Intergenic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG + Intronic
1020252938 7:6483939-6483961 CGGCGGGGGAAGGCCCGGAGAGG - Intronic
1023119560 7:36895486-36895508 TGGCGAAAGCAGTCTGGGAGAGG - Intronic
1027499582 7:78932058-78932080 CAGCCAAAGGAGGCCAGGAGGGG - Intronic
1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG + Exonic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1037108448 8:15137985-15138007 CCATGAAAGCAGTCCCGGAGGGG + Intronic
1038760869 8:30383991-30384013 CTGAAAAAGCCGGCCCGGAGTGG + Intergenic
1049216277 8:141409812-141409834 CAGCGCAAGCAGGGCAGGAGGGG - Intronic
1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG + Intergenic
1053199404 9:36142510-36142532 AGGAGAAAGCAGGCCCGGGATGG + Intronic
1055356962 9:75447496-75447518 CTGTGAAAGCAGGCCTGAAGTGG + Intergenic
1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG + Exonic
1060204330 9:121673839-121673861 TGGGGAAACCAGGCCCTGAGAGG - Intronic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1189035684 X:37492004-37492026 CGGCGACAGCGGGCCCAGGGCGG - Intronic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1198378824 X:136065193-136065215 CGGCGACAGGAGGCTGGGAGGGG - Intergenic