ID: 1096396406

View in Genome Browser
Species Human (GRCh38)
Location 12:51269902-51269924
Sequence CACAGCCTGCCAAGCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 227}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096396404_1096396406 -6 Left 1096396404 12:51269885-51269907 CCAGGGCGCGGTCCGCGCACAGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396395_1096396406 18 Left 1096396395 12:51269861-51269883 CCCCTCCGGGCCTGCTTTCGCCG 0: 1
1: 0
2: 2
3: 1
4: 97
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396394_1096396406 19 Left 1096396394 12:51269860-51269882 CCCCCTCCGGGCCTGCTTTCGCC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396401_1096396406 8 Left 1096396401 12:51269871-51269893 CCTGCTTTCGCCGTCCAGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396393_1096396406 22 Left 1096396393 12:51269857-51269879 CCGCCCCCTCCGGGCCTGCTTTC 0: 1
1: 0
2: 0
3: 21
4: 399
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396396_1096396406 17 Left 1096396396 12:51269862-51269884 CCCTCCGGGCCTGCTTTCGCCGT 0: 1
1: 0
2: 2
3: 2
4: 52
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396403_1096396406 -2 Left 1096396403 12:51269881-51269903 CCGTCCAGGGCGCGGTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396397_1096396406 16 Left 1096396397 12:51269863-51269885 CCTCCGGGCCTGCTTTCGCCGTC 0: 1
1: 0
2: 1
3: 6
4: 49
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227
1096396398_1096396406 13 Left 1096396398 12:51269866-51269888 CCGGGCCTGCTTTCGCCGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG 0: 1
1: 0
2: 3
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096396406 Original CRISPR CACAGCCTGCCAAGCCTCAC TGG Intronic
902535425 1:17116939-17116961 CACAGCCAGCTGAGACTCACTGG - Intronic
903219247 1:21859863-21859885 CACAGGCCGCCCATCCTCACGGG + Exonic
903227832 1:21903880-21903902 CACAGCCTGCTCTGCCCCACCGG - Intronic
904732562 1:32606057-32606079 CACAGCCTGCCAGTCCACATGGG - Intronic
905927029 1:41758440-41758462 CACAGCCTTCCACGCTTCAATGG + Intronic
906207953 1:43997070-43997092 CACAGCCTGACAAGTAACACTGG + Intronic
906994779 1:50780557-50780579 CACAACATGCCAATCATCACTGG + Intronic
907605619 1:55814580-55814602 AACAGCCTGCCAAGGATCTCAGG - Intergenic
908682211 1:66674813-66674835 CACTTCCTGCCAAACCCCACTGG + Intronic
911288564 1:96028108-96028130 CACAGCCTACCAAGCCGAATGGG - Intergenic
913298480 1:117345355-117345377 CTCAGCCTTGCTAGCCTCACAGG - Intergenic
914846708 1:151287541-151287563 CACAGCCTTGCGAGCCACACTGG - Exonic
915246501 1:154559192-154559214 CACAGCATGCCCACCCCCACGGG - Intergenic
915284548 1:154844474-154844496 CACATCCTGTCAGGCCTCTCAGG + Intronic
916405109 1:164490416-164490438 CAGAGACTGCAAAGCCACACTGG - Intergenic
916521749 1:165569657-165569679 CTTACCCTGCCCAGCCTCACTGG + Intergenic
917523686 1:175768704-175768726 CAGAGCCTCCCAAGCCTGAGAGG + Intergenic
917848577 1:179041507-179041529 CTCAGCCTGCCACACCTGACTGG - Intronic
918292761 1:183124690-183124712 CACAGGCGGCAAAGTCTCACAGG - Exonic
919639650 1:200035928-200035950 CACAGACTCCCAGGCCTCCCGGG + Intronic
919788005 1:201272339-201272361 GACAGCCTGCCCAGCCTGATGGG - Intergenic
920002153 1:202807699-202807721 ACCAGCCTGCCGAGCCTCGCCGG + Intronic
920053131 1:203175365-203175387 CCCAGCCTCCCCAGCCTCTCTGG + Exonic
921235272 1:213120540-213120562 AGCAGCCAGCCAAGCCCCACAGG + Intronic
921669945 1:217914150-217914172 CACAGACTGCCAAGCTTACCTGG - Intergenic
922422746 1:225470624-225470646 CACTGGCTGCAAAACCTCACTGG + Intergenic
922697326 1:227737237-227737259 CACAGCCTGCCAGGCTTCGGGGG - Intronic
922831192 1:228555426-228555448 AACAGCCGGCCCAGCCTCGCGGG - Intergenic
923495376 1:234520018-234520040 CTCAGCCTCCCAAGCACCACCGG + Intergenic
1064388916 10:14924238-14924260 CACAGTCTTTCAACCCTCACTGG - Intronic
1064615209 10:17146407-17146429 CAGAGCCTGACAATCCTCAGTGG - Intronic
1065117227 10:22494876-22494898 CACAACCTGCCATGTCTTACTGG - Intergenic
1066497187 10:35953990-35954012 CAGAGCCTGCCTAACCTCATGGG + Intergenic
1068632790 10:59314784-59314806 AGCAGCATGCCAAGCCTCTCAGG - Intronic
1069160136 10:65083377-65083399 CACAGCCTTCCAGGCCTAATAGG - Intergenic
1070938308 10:80319806-80319828 CCCAGCCTCCCAACCCTAACAGG + Intergenic
1073600105 10:104838378-104838400 CACAGCCTTCCAAACGCCACTGG - Intronic
1076043046 10:127267930-127267952 CACAGCCTGGCAAGCCTGCGAGG - Intronic
1076487998 10:130836503-130836525 CACAGCCTGCCAGGCCTCAGGGG + Intergenic
1076510662 10:131011806-131011828 TACAGCCAGCCCAGCCTCCCCGG - Intergenic
1076540112 10:131208320-131208342 CACAGAGTGCGAAGCCTCAGAGG + Intronic
1076837630 10:133029078-133029100 CACAGCCGGCCCAGCTCCACAGG + Intergenic
1076880326 10:133236604-133236626 CCCAGCCAGCCGAGCCTCCCGGG - Intergenic
1078709112 11:13773315-13773337 CACGGCATGCCAAGCTCCACAGG + Intergenic
1079580994 11:22064618-22064640 GACAGCCTGCAAAGAATCACTGG + Intergenic
1083310642 11:61781854-61781876 CCCAGCCTGGCAAGGCTCACTGG + Intronic
1084683200 11:70679156-70679178 CACACCATGCCAAGCCCCATGGG + Intronic
1086556861 11:88121001-88121023 CACAGGCTACTGAGCCTCACAGG + Intronic
1089118856 11:116117833-116117855 CACAGCCTGCCTTCCCACACAGG - Intergenic
1089174126 11:116536193-116536215 CACGGGCTGCCAAGCCTGGCTGG - Intergenic
1092492374 12:8956976-8956998 CACAGCCTGCCAAGCCCAGTGGG + Intronic
1092913651 12:13170604-13170626 CTCAGCCTCCAAAGCCTGACAGG - Intergenic
1094080011 12:26523918-26523940 CACAGACTGCCAAGCCACTGAGG - Intronic
1095372472 12:41485417-41485439 CCCAGCATGCCAGGACTCACCGG + Intronic
1095443941 12:42266784-42266806 CACAGCCTGCCAGGCCAAATGGG - Intronic
1096396406 12:51269902-51269924 CACAGCCTGCCAAGCCTCACTGG + Intronic
1096635633 12:52957245-52957267 CACAGCCTTGCATACCTCACAGG - Intergenic
1098520035 12:71425070-71425092 CACAGCCTACCCAACCTCCCAGG + Intronic
1100864252 12:98839443-98839465 CACAGCCTTCCCAGCCTAAAAGG + Intronic
1101635834 12:106540814-106540836 CACACCCTGCAAAGCCACAGGGG - Intronic
1102064494 12:109962544-109962566 CACAGCCTGCAGTGCCTCCCTGG + Intronic
1102454847 12:113065077-113065099 CCCAGCCTGCCAGGCCCCAGTGG - Intronic
1102527406 12:113521618-113521640 CACAGCCTCTCAACCCTCCCAGG - Intergenic
1103624246 12:122206321-122206343 CACAGCCTGCAGAGCATCGCCGG - Exonic
1103879473 12:124154986-124155008 CACAGCCATTCAGGCCTCACTGG - Intronic
1103917747 12:124384681-124384703 CACAGCCTGCTCACCCTCTCTGG + Intronic
1104713016 12:130998055-130998077 CTCAGCCTGCCATGCCTGACTGG - Intronic
1106828709 13:33554746-33554768 CTCAGCCAGCTAAGCCTCTCTGG - Intergenic
1108395870 13:49990859-49990881 CTCAGCCTGCCAAGGTTTACAGG - Intergenic
1111091685 13:83454017-83454039 CACAGCCTGCCAAGCCAGGTGGG + Intergenic
1111487665 13:88926072-88926094 CACAGCCTGCCAGGCCTTGTGGG - Intergenic
1118752184 14:68815529-68815551 CACAGGGTGCCGACCCTCACAGG + Intergenic
1120887086 14:89460188-89460210 CACAGCCTGCCAGCCTTCCCCGG - Intronic
1122918955 14:104871734-104871756 CACAGCCTCCCCCTCCTCACCGG - Intronic
1123860450 15:24460796-24460818 CTTAGCCTGCCCAGCATCACTGG + Intergenic
1128337460 15:66796457-66796479 CCCAGCCTTCTAAGCCTCTCAGG - Intergenic
1129148162 15:73668976-73668998 CACAGCCTTCCATGCCCCTCAGG + Intergenic
1129461953 15:75704070-75704092 CCCAGCCTGCCAGGACTCCCTGG - Intronic
1129722901 15:77887775-77887797 CCCAGCCTGCCAGGACTCCCTGG + Intergenic
1131967489 15:97859583-97859605 CACAGCCTGCAAAGACTCCCAGG + Intergenic
1131982791 15:98011435-98011457 CACAGGCTGCCAAAACTCACTGG - Intergenic
1132693208 16:1190829-1190851 CACAGCCAGGCCAGCCTGACGGG - Intronic
1134057300 16:11178574-11178596 CACAGCCTCCGCAGCCTCACCGG + Exonic
1134094931 16:11412990-11413012 CATAGCCTGAGGAGCCTCACAGG + Intronic
1134230566 16:12425961-12425983 CACAGCCTGCCAAGACCTTCAGG + Intronic
1134378582 16:13702801-13702823 CACAGAATGCCAAGGCTCCCGGG + Intergenic
1134743823 16:16572081-16572103 CACAGCCTCCCAAACATCAGAGG - Intergenic
1135001659 16:18781670-18781692 CACAGCCTCCCAAACATCAGAGG + Exonic
1136170032 16:28483557-28483579 CCCACCCTGCCCAGTCTCACTGG + Intronic
1136909390 16:34133986-34134008 AACAGCCGGCCCAGCCCCACGGG - Intergenic
1138183729 16:54960982-54961004 CCCAGGCTGCCAAGCCTCTGGGG - Intergenic
1140151172 16:72367998-72368020 CACATCCTGCCAACTCACACTGG + Intergenic
1141140992 16:81496877-81496899 CACTGCCCGCCAAGCGGCACTGG - Intronic
1141273111 16:82558610-82558632 TACACCCTGCAAAGCCTCAGGGG + Intergenic
1141502434 16:84453242-84453264 CACTGCCAGCCAAGCCTCCGGGG - Intronic
1141825874 16:86480096-86480118 CACACCCTGCCCAGCCTCCGGGG + Intergenic
1142077999 16:88131631-88131653 CCCAGCCTGCCTCGCCTCACAGG - Intergenic
1142142336 16:88478199-88478221 CCCAGCCTGCCACGACTCTCTGG + Intronic
1142818414 17:2446724-2446746 CTCAGCCTGCTACGCCTCACTGG + Intronic
1143323685 17:6084383-6084405 CACAGCCAGTCCGGCCTCACTGG + Intronic
1144654819 17:17028753-17028775 CAGAGCCTGCCAGGCCCCAGGGG - Intergenic
1144717684 17:17445749-17445771 CAAGGCCTGCCTTGCCTCACAGG - Intergenic
1146467432 17:33097181-33097203 CCCAGCCTGCAAAGCCCCAAAGG - Intronic
1146944776 17:36866142-36866164 CTCAGCCTGCCTGGCCTCACTGG + Intergenic
1150105499 17:62459669-62459691 CACAGCCTGTGAAGCCTCCACGG - Intronic
1151718931 17:75844866-75844888 CTCAGCCTGCCTGGCCCCACAGG + Intergenic
1151878260 17:76879532-76879554 CACAGCCTGCGTGGCCTCACTGG - Intronic
1152325682 17:79634469-79634491 CATAGCCTGCAAAGCCTCCTTGG + Intergenic
1153444376 18:5155227-5155249 CACAGCCTGCATAGACTCACGGG - Intronic
1153533873 18:6079231-6079253 CACAGCCTGCCAATTTTCATGGG + Intronic
1155054614 18:22172222-22172244 CACAGCCTGCAGAGCCGCGCCGG + Exonic
1156736810 18:40270189-40270211 CACAACCTCCCAACCCTCATTGG + Intergenic
1159774168 18:72584871-72584893 CACAGCCTGCCAGGCCTAGTGGG - Intronic
1160283146 18:77512368-77512390 CCCAGCCTTCCAAGCCACATGGG + Intergenic
1160366173 18:78327794-78327816 CACAGCCTCCCAAGCTCCCCGGG + Intergenic
1160464230 18:79062825-79062847 CACACCATGCCACGCCACACAGG + Intergenic
1160551024 18:79693942-79693964 CACAGCCTGCCATGGCACAGTGG + Intronic
1160951037 19:1667554-1667576 CAGAGCCAGGCAAGCCCCACAGG - Intergenic
1162002804 19:7758064-7758086 CACACCCTGCAAAGCCACAGGGG + Intergenic
1162144580 19:8605783-8605805 CACAGCCTTCGCAGCATCACCGG + Exonic
1163546648 19:17944679-17944701 CTCAGCCCACAAAGCCTCACAGG - Intergenic
1164587324 19:29484177-29484199 CATGCCCTGCCAGGCCTCACAGG - Intergenic
1164938335 19:32231893-32231915 CCCTGCCTGCCCAGCCACACAGG - Intergenic
1165735622 19:38173712-38173734 CCCAGCCTCCCAACACTCACAGG - Intronic
1166194091 19:41194739-41194761 CACAGCCTGCCACCACTTACTGG + Intronic
1167506233 19:49872597-49872619 CAGAGCCTCCCAACCCCCACCGG + Intronic
1168515664 19:57008661-57008683 CAGAGCCTGAGAAACCTCACCGG + Intergenic
925333020 2:3073451-3073473 CACAGCCTGCACAGTCTCAGGGG + Intergenic
925417038 2:3677624-3677646 GACAACCTGCCCAGCCTCCCAGG - Intronic
925480643 2:4269845-4269867 CACAGCCTGTAAACCCTCCCTGG + Intergenic
926351455 2:11999032-11999054 CCAAGCCTGCCAAGCTACACTGG - Intergenic
929780641 2:44954852-44954874 CAGAGCCTGCGAAGACTCAGGGG - Intergenic
930207249 2:48600266-48600288 CACAGCCTTCCAAACTTCAGAGG + Intronic
932838149 2:75056528-75056550 CACACCAAGCCAAGCCACACAGG - Intronic
932842019 2:75092225-75092247 CACACGGTGCTAAGCCTCACTGG + Intronic
933786519 2:85847201-85847223 CACTGCCTTCCAGGACTCACTGG + Intronic
935172272 2:100619681-100619703 CTCAGCCTGCAGAGCCTCCCAGG + Intergenic
937066568 2:119022461-119022483 CCCATCTGGCCAAGCCTCACTGG + Intergenic
940212397 2:151268533-151268555 AACAACCTGCCAAACCTCATGGG - Intergenic
940422645 2:153498360-153498382 CACAGCCTGCCAGCCTTCAAGGG - Intergenic
940658458 2:156517683-156517705 CACAGCCTGTCAAGTCACCCAGG - Intronic
943197978 2:184780008-184780030 CACAGGCTCCCAGGCTTCACAGG + Intronic
946416342 2:219541863-219541885 CACGGCCTGGCACGCCTAACTGG - Exonic
948116655 2:235498391-235498413 CACAGCATGCCATGCCCCATAGG - Intronic
948754669 2:240151837-240151859 CACAGCCTGGCCAGACTCACCGG - Intergenic
948825978 2:240573624-240573646 TACAGCCCGCCCTGCCTCACTGG - Intronic
948858719 2:240742773-240742795 CTGAGCCTGTCAGGCCTCACGGG - Intronic
948903911 2:240968904-240968926 CCCAGCCAGCCCAGCCCCACAGG + Intronic
1169345187 20:4823441-4823463 CACCGCCTGCCCAGCCTGGCTGG - Intronic
1172068575 20:32239330-32239352 CCCTCCCTGGCAAGCCTCACGGG + Intergenic
1172195717 20:33090161-33090183 CACAGCCTCCACAGCCACACAGG + Intronic
1172677287 20:36682561-36682583 CACAGCCTGAAAAGCATCATTGG - Exonic
1172880033 20:38193886-38193908 CTCAGCCTGCCCAGCCCCGCTGG + Intergenic
1173562819 20:44018334-44018356 GGCAGCATGCCAAGCCTAACAGG + Intronic
1174411406 20:50339076-50339098 CACAGCCCCCAAGGCCTCACAGG + Intergenic
1174427081 20:50439380-50439402 TTCAGACTGCCAAGCCTCAGTGG - Intergenic
1174629639 20:51945079-51945101 CTCAGCCTCCCAAGTCTCCCGGG - Intergenic
1175767018 20:61598853-61598875 CACTGCCCGCCAAGCTTCCCTGG + Intronic
1177218818 21:18164162-18164184 CCCAGGCTGCCAAGCAGCACAGG + Intronic
1179997466 21:44980603-44980625 CACACCCTGGCCAGCCTCGCTGG + Intergenic
1180999646 22:19982061-19982083 CCCAGGCAGCCAGGCCTCACTGG - Exonic
1181476164 22:23168949-23168971 CACAGCCTGGCACAACTCACTGG + Intergenic
1181986807 22:26805548-26805570 CTCAGCCTGTCTAGCCTCATTGG - Intergenic
1184429005 22:44430328-44430350 CACTCCCTGCCCAGGCTCACAGG + Intergenic
1185385012 22:50527587-50527609 GACAGCCTGCCACTCATCACAGG - Exonic
949112992 3:285535-285557 CACAGGCTCACAAGTCTCACTGG + Intronic
953301702 3:41783623-41783645 CACAGCCTCCCAAGCAACAGGGG + Intronic
954419700 3:50412274-50412296 CACAGCCAGCCTAGCCTCACAGG - Intronic
959838557 3:110948911-110948933 CATACCCTGCAAAGCCTCAGGGG - Intergenic
961357123 3:126346263-126346285 CACAGAGTGCCACGCCTCCCAGG + Intronic
961822938 3:129584519-129584541 GGCAGCCTGCCCAGCCTCAGTGG - Exonic
962093239 3:132267415-132267437 GACAGGCAGCCAAGCCTCACTGG - Intronic
964175884 3:153825884-153825906 CAAAACCGGACAAGCCTCACAGG - Intergenic
964425675 3:156551428-156551450 CACAGATGGCCATGCCTCACAGG + Intronic
965534276 3:169808968-169808990 CAGTGTCTGCCAAGCCTCAATGG - Intronic
969079995 4:4610842-4610864 AACAGCCTGCCTGGCCTCACTGG - Intergenic
969387105 4:6859995-6860017 CACAGGCTCTCAGGCCTCACAGG + Intronic
970159562 4:13175390-13175412 CCCACCCTGCCAGGGCTCACAGG + Intergenic
970411027 4:15808030-15808052 CACAACCTGCAAAGCCCCACTGG - Intronic
971349814 4:25845823-25845845 CTCTGCCTGCCAAGCCTGGCTGG + Intronic
975685435 4:76916194-76916216 CTCAGCCTGCTACGCCTCACTGG + Intergenic
980932497 4:139195103-139195125 CACAGGTTCCCAAGCCTCATAGG - Intergenic
981935486 4:150235037-150235059 CACAACCTGCCTTGCCCCACTGG + Intronic
985582975 5:709498-709520 CACAACCTGCAAAGCCACAGGGG + Intergenic
985596653 5:794749-794771 CACAACCTGCAAAGCCACAGGGG + Intergenic
985972882 5:3392140-3392162 CCCAGCCTCCCCAGCCTCTCTGG - Intergenic
986319780 5:6620744-6620766 CCCAGCCTGCAGAGCCTCCCGGG - Intronic
988688528 5:33549219-33549241 CTCCACCTGCCACGCCTCACAGG + Exonic
990878912 5:60518268-60518290 CACAGCCTGCCCAGGCTGAGTGG + Intronic
992615085 5:78539741-78539763 CATAGCCTGCTAAGCCACACTGG + Intronic
1002771005 6:291282-291304 CACAGCCCAGCAAGCCTGACAGG + Intergenic
1005993739 6:30919702-30919724 CAGACCCTTCCAACCCTCACAGG + Intronic
1006949255 6:37808040-37808062 CACAGCTTGGTAAGCCACACAGG - Intergenic
1007421107 6:41720322-41720344 CCCAGCCTGCCATGGGTCACAGG + Intronic
1007791152 6:44309273-44309295 GACAGCCAGCCAAGCCCCAGAGG + Intronic
1008480549 6:51981460-51981482 CTCAGCCTGCTACGCCTCACTGG + Intronic
1009600020 6:65787020-65787042 CGCAGCCTGCTAAGCCTAGCGGG + Intergenic
1018420572 6:163637393-163637415 CACAGCCTGTCAAGGCTGCCTGG - Intergenic
1021805234 7:24348801-24348823 CACAGAATTCCATGCCTCACAGG - Intergenic
1022318424 7:29265459-29265481 CACAGCCTGCTCAGCTTCAGGGG - Intronic
1024026056 7:45410780-45410802 CACATCCGGACAGGCCTCACAGG + Intergenic
1024290110 7:47797060-47797082 CACACCCTGCAAAACCTCAGGGG + Intronic
1024382125 7:48708876-48708898 CACAGCGTGCCATGCCACAGGGG - Intergenic
1026540142 7:71272696-71272718 CTTAGGCTGCCAAGCCTCACAGG - Intronic
1027681822 7:81232191-81232213 CACAGCCTGCCAGGCCAAGCAGG - Intergenic
1028641192 7:93043705-93043727 CACAGCCTGCAGAGCCAAACTGG - Intergenic
1029176374 7:98667707-98667729 GGCAGCCTGCCACGCCACACAGG + Intergenic
1029366611 7:100120380-100120402 CACCGTCTGCAAAGTCTCACCGG - Intronic
1030993529 7:116330252-116330274 CAGAAGCTGCCCAGCCTCACTGG - Intronic
1031408823 7:121418946-121418968 CACAGTCTGCCAAAACTCACAGG - Intergenic
1031894927 7:127337788-127337810 CCCAGCATGCCAAGCCTCTGGGG - Intergenic
1032034659 7:128512869-128512891 CACAGCCTGTGAAGCCTCCACGG - Intergenic
1034209244 7:149348690-149348712 CACACCCTGCAAAGCCACAGAGG - Intergenic
1035273854 7:157735841-157735863 CAGAGCCCACCCAGCCTCACGGG - Intronic
1037446732 8:18972862-18972884 CACAGCATGGAAAGCATCACTGG + Intronic
1037897141 8:22665487-22665509 CACACCCTGCCATGCTGCACTGG - Intronic
1042439541 8:68810128-68810150 CACAGCCTGCCAGGCCAAGCAGG - Intronic
1044475297 8:92618817-92618839 CACAGCCTGCTGAGCCTCACAGG + Intergenic
1048960479 8:139572794-139572816 CCCAGCCTGTCATCCCTCACGGG + Intergenic
1049065372 8:140309417-140309439 CACAGCCTGCCAGGCAGCCCTGG - Intronic
1049234943 8:141507776-141507798 GGCAGCCTGCCCAGCCCCACAGG - Intergenic
1051781493 9:20693108-20693130 CAGATCATGGCAAGCCTCACAGG - Intronic
1051822414 9:21182983-21183005 TCCAGCCTGCCCAGCCTCCCCGG - Intergenic
1051823650 9:21195038-21195060 TCCAGCCTGCCCAGCCTCCCCGG - Intergenic
1051825468 9:21213574-21213596 TCCAGCCTGCCCAGCCTCCCCGG - Intronic
1051827452 9:21235636-21235658 TCCAGCCTGCCCAGCCTCCCCGG - Intronic
1053282563 9:36830564-36830586 CATGGCCTGCAAAGCCCCACAGG - Intergenic
1054254617 9:62800537-62800559 AACAGCCGGCCCAGCCCCACAGG + Intergenic
1054343725 9:63893598-63893620 CACGGCCTGCCTGGGCTCACTGG - Intergenic
1055512115 9:77005328-77005350 CAAAGCCTGCCAAGATTCAAGGG - Intergenic
1056699582 9:88891115-88891137 CACACCCTCCCATGGCTCACAGG + Intergenic
1057550418 9:96047982-96048004 CACAGCCTGAGAAGCCTGGCCGG - Intergenic
1059808400 9:117829242-117829264 ATAAGCCTGCTAAGCCTCACAGG + Intergenic
1060252587 9:121997936-121997958 CACAGCCTGCCTCGTCTCCCTGG + Intronic
1061036590 9:128117799-128117821 CAGAGCCCGCCAAGCCTCGTAGG - Intergenic
1061811494 9:133164754-133164776 CACAGCCTCCCAGGCCCCTCAGG + Intergenic
1185466319 X:356803-356825 CACACCCTGGCCAGCCACACGGG + Intronic
1187264046 X:17714811-17714833 CTCAGCCTGCCACGCCTTAATGG - Intronic
1187314465 X:18179843-18179865 TACTGCCTGCCAAGCCACAGTGG - Intronic
1187366863 X:18672989-18673011 CACAGACTGCCAACCCAGACTGG + Intergenic
1189041256 X:37543572-37543594 CAGAGCCTGCCAAGACTCGTCGG - Intronic
1189041275 X:37543647-37543669 CAGAGCCTCCCAAGACTCATTGG - Intronic
1189207483 X:39254326-39254348 GACAGAATGCCAAGACTCACTGG + Intergenic
1193468608 X:81874461-81874483 CACAGCCTGCCAGGCCAAATGGG - Intergenic
1193826898 X:86237597-86237619 CACAGCCTGCCAGGCCAAATGGG - Intronic
1193995621 X:88363688-88363710 AACAGCCCTCCAATCCTCACTGG + Intergenic
1194045782 X:89000721-89000743 TAGAGCCTGCCAAGACTCAAAGG + Intergenic
1194572902 X:95574726-95574748 CATATCCTGCAAAGCCTCACAGG + Intergenic
1196893551 X:120311621-120311643 CCCAGCCTTCCAAGCCAGACAGG + Intergenic
1200213159 X:154355845-154355867 CACAGCCCCCCAAGCCTCCACGG - Intronic
1201065440 Y:10091066-10091088 AACAGCCGGCCCAGCCCCACGGG + Intergenic